Journal articles: 'Families Australia Canberra (A.C.T.)' – Grafiati (2024)

  • Bibliography
  • Subscribe
  • News
  • Referencing guides Blog Automated transliteration Relevant bibliographies by topics

Log in

Українська Français Italiano Español Polski Português Deutsch

We are proudly a Ukrainian website. Our country was attacked by Russian Armed Forces on Feb. 24, 2022.
You can support the Ukrainian Army by following the link: https://u24.gov.ua/. Even the smallest donation is hugely appreciated!

Relevant bibliographies by topics / Families Australia Canberra (A.C.T.) / Journal articles

To see the other types of publications on this topic, follow the link: Families Australia Canberra (A.C.T.).

Author: Grafiati

Published: 11 December 2022

Last updated: 25 January 2023

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Consult the top 50 journal articles for your research on the topic 'Families Australia Canberra (A.C.T.).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Simone,LuizRicardoL. "Comparative morphological study and phylogeny of representatives of the superfamily Calyptraeoidea (including Hipponicoidea) (Mollusca, Caenogastropoda)." Biota Neotropica 2, no.2 (2002): 1–137. http://dx.doi.org/10.1590/s1676-06032002000200013.

Full text

Abstract:

With the objective of testing the monophyly of the Calyptraeoidea and of searching for its ground plan, a detailed morpho-logical analysis was conducted for the following species: a) Family Calyptraeidae, 1) Bostrycapulus aculeatus (Gmelin) (formerly Crepidula); 2) Crepidula aff. plana Say; 3) C. protea Orbigny (these from Brazil); 4) C. aff. protea (from Argentina) (published elsewhere); 5) C. convexa Say (from Venezuela); 6) C. fornicata (L.) (from Europe); 7) Calyptraea centralis (Conrad) (from Brazil); 8) Crucibulum auricula (Gmelin) (from Venezuela); 9) Cr. quiriquinae (Lesson) (from Chile); 10) Trochita trochiformis (Born) (from Chile); 11) Sigapatella calyptraeformis (Lam.) (from New Zealand, formerly Calyptraea); b) Family Hipponicidae, 12) Hipponix costellatus Carpenter (formerly H. grayanus); 13) H. subrufus (Lam.); 14) H. incurvus (Gmelin) (formerly Capulus incurvatus) (these 3 from NE Brazil); 15) H. grayanus Menke (from Mexico and Ecuador); 16) H. leptus n. sp. (N.E. Brazil); 17) Sabia conica (Schumacher); 18) Malluvium devotus (Hedley) (both Australia); 19) Cheilea equestris (L.) (N.E. Brazil); c) Family Capulidae, 20) Capulus sycophanta Garrard (Australia); d) Family Trichotropidae, 21) Trichotropis cancellata Hinds (W. USA); 22) T. borealis Broderip & Sowerby (N. Atlantic); 23) T. sp. (Alaska); e) Family Vanikoridae, 24) Vanikoro sp. (Australia). A phylogenetic analysis of 112 characters (177 states) from morphology of all systems and organs results in the following single most parsimonious tree: ((Trichotropis cancellata - T. borealis) (Capulus sycophanta (Vanikoro sp ((Cheilea equestris (Sabia conica (Malluvium devotus ((Hipponix grayanus - H. leptus) (H. incurvus (H. costellatus - H. subrufus)))))) (Sigapatella calyptraeformis (Trochita trochiformis (Calyptraea centralis ((Crucibulum auricula - Cr. quiriquinae) (Bostrycapulus aculeatus (Crepidula argentina (C. convexa (C. fornicata (C. aff. plana - C. protea))))))))))))). Length: 267, CI: 67, RI: 88. Outgroups from other caenogastropod superfamilies were used as well as some archaeogastropod groups. The main result is the monophyly of Calyptraeoidea supported by 27 synapomorphies with basal Caenogastropoda used as the outgroup (Cerithioidea, Hydrobioidea), and 21 synapomorphies when Stromboidea and Cypraeoidea were used as outgroups. Calyptraeoidea includes, succes-sively along the tree, the following monophyletic families: Trichotropidae, Capulidae, Vanikoridae, Hipponicidae and Calyptraeidae. The hipponicid affinity of Cheilea is confirmed. Some taxonomic problems found in the sampled representatives (as mentioned above), were partially resolved.

APA, Harvard, Vancouver, ISO, and other styles

2

A'laa Taghi Al-Azawi and AliA.F.AlHamadani. "The Effect of Different Absorber Configurations On The Exergy and The Energy of Parabolic Solar Dish." Wasit Journal of Engineering Sciences 7, no.3 (April11, 2020): 1–13. http://dx.doi.org/10.31185/ejuow.vol7.iss3.133.

Full text

Abstract:

Abstract— The solar energy is the most important type of energy. The parabolic dish solar collector (PDSC) is the best type among other solar collectors because it is always tracking the sun movement. The exergy and the energy performances of a PDS were analyzed experimentally and numerically. The effect of different coil geometries and different mass flow rates of heat transfer fluid (HTF) were investigated. The PDS has parabolic dish and receiver with diameter (1.5) m and (0.2) m respectively. Concentration ratio is 56.25. The parabolic polar dish was supported by a tracking system with two axes. The types of the copper absorber were used which are: (spiral –helical) coil (SHC) and spiral-conical coil (SCC). The results showed that the useful energy and thermal efficiency are varying with solar radiation variation. The useful energy varying between (480-765) W for (SHC), the thermal efficiency varying between (35.2-39.8) % for (SHC). Exergy efficiency varying between (6.9 –8.6) %. It was shown that the higher values of useful energy for (spiral – helical) absorber was 0.1L/min flow rate. REFERENCES 1. T. Taumoefolau , K. Lovegrove ," An Experimental Study of Natural Convection Heat Loss from a Solar Concentrator Cavity Receiver at Varying Orientation. ", Australian National University,, Canberra ACT 0200 AUSTRALIA.2002 2. S. PAITOONSURIKARN and K. LOVEGROVE," On the Study of Convection Loss from Open Cavity Receivers in Solar Paraboloidal Dish Applications ", Australian National University Canberra ACT 0200, AUSTRALIA, pp 154,155,2003 3. Soteris A. Kalogirou*,"Solar thermal collectors and applications", Higher Technical Institute, Progress in Energy and Combustion Science 30 (2004) 231–295, pp237, 240, 241, 2004 4. M. Prakash, S.B. Kedare, J.K. Nayak," Investigations on heat losses from a solar cavity receiver", Department of Energy Science and Engineering, Indian Institute of Technology Bombay, Mumbai 400076, India,2008. 5. Shiva Gorjian1, Barat Ghobadian1, Teymour Tavakkoli Hashjin1, and Ahmad Banak ,"Thermal performance of a Point-focus Solar Steam Generating System ", 21st Annual International Conference on Mechanical Engineering-ISME201 7-9 May, 2013, School of Mechanical Eng., K.N.Toosi University, Tehran, Iran ,1ISME2013-1195,2013 6. Kailash Karunakaran1 Hyacinth J Kennady2 ,"Thermal Analysis of Parabolic Dish Snow Melting Device " ,International Journal for Research in Technological Studies| Vol. 1, Issue 3, February 2014 | ISSN (online): 2348-1439,2014 7. Charles-Alexis Asselineau, Ehsan Abbasi, John Pye "Open cavity receiver geometry influence on radiative losses" Australian National University (ANU), Canberra, ACT 0200 Australia. Solar2014: The 52nd Annual Conference of the Australian Solar Council 2014 8. Vahid Madadi, Touraj Tavakoli and Amir Rahimi First and second thermodynamic law analyses applied to a solar dish collector" DOI 10.1515/jnet-2014-0023 | J. Non-Equilib. Thermodyn. 2014; 39 (4):183–197 9. Yaseen. H. Mahmood , Mayadah K h. Ghaffar " Design of Solar dish concentration by using MATLAB program and Calculation of geometrical concentration parameters and heat transfer" , University of Tikrit , Tikrit , Iraq, Tikrit Journal of Pure Science 20 (4) ISSN: 1813 – 1662, 2015. 10. Vanita Thakkar, Ankush Doshi, Akshaykumar Rana "Performance Analysis Methodology for Parabolic Dish Solar Concentrators for Process Heating Using Thermic Fluid IOSR", Journal of Mechanical and Civil Engineering (IOSR-JMCE) eISSN: 2278-1684,p-ISSN: 2320-334X, Volume 12, Issue 1 Ver. II (Jan- Feb. 2015), PP 101-114 11. Saša R. pavlovi, Evangelos A. bellos, Velimir P. Stefanovi, Christos Tzivanidis and Zoran M. Stamenkovi "Design, Simulation ,and Optimiztion Of A Solar Dish Collector with spiral coil absorber ", , Nis, Serbia, thermal SCIENCE, Vol. 20, No. 4, pp. 1387-1397 1387,2016 12. Flávia V. Barbosa, João L. Afonso, Filipe B. Rodrigues, and José C. F. Teixeir," Development of a solar concentrator with tracking system", University of Minho,Guimarães, 4800-058, Portugal2016 13. O. López, A. Arenas, and A. Baños"Convective Heat Loss Analysis of a Cavity Receiver for a Solar Concentrator" International Conference on Renewable Energies and Power Quality (ICREPQ’17)Malaga (Spain), 4th to 6th April, 2017 ,ISSN 2172-038 X, No.15 April 2017 RE&PQJ, Vol.1, No.15, April 2017 14. D.R.Rajendran,E.GanapathySundaram,P.Jawahar "Experimental Studies on the Thermal Performance of a Parabolic Dish Solar Receiver with the Heat Transfer Fluids Sic water Nano Fluid and Water", Journal of Thermal Science Vol.26, 15. Muhammad Shoaib, Muhammad , Jameel Kabbir Ali ,Muhammad Usman1, Abdul Hannan " Analysis of thermal performance of parabolic dish collectors having different reflective" ,NFC institute of engineering &fertilizer research ,2018 . 16. Sasa PAVLOVIC, Evangelos BELLOS, Velimir STEFANOVIC ,Christos TZIVANIDIS " EXPERIMENTAL AND NUMERICAL INVESTIGATION OF A SOLAR DISH COLLECTOR WITH SPIRAL ABSORBER" A CTA TECHNICA CORVINIENSIS – Bulletin of Engineering Tome XI [2018] .

APA, Harvard, Vancouver, ISO, and other styles

3

Yao, Xin. "Simulated Evolution and Learning." Journal of Advanced Computational Intelligence and Intelligent Informatics 4, no.2 (March20, 2000): 129. http://dx.doi.org/10.20965/jaciii.2000.p0129.

Full text

Abstract:

Evolution and learning are two fundamental forms of adaptationl,2). Simulated evolution and learning refers to the study of techniques and methods inspired by Nature for solving complex and difficult real-world problems. These techniques and methods include evolutionary algorithms3), fuzzy learning algorithms, neural learning algorithms, and various statistical learning methods such as nearest neighbor classifiers. In addition to various learning tasks, these techniques and methods have also been applied to various difficult optimization problems that cannot be solved effectively by classical methods (such as mathematical programming methods). This special issue contains six papers selected from those presented at the Second Asia-Pacific Conference on Simulated Evolution And Learning (SEAL'98), Canberra, Australia, 24-27 November 1998. However, all six papers have been rereviewed and substantially extended and revised. They represent significant improved work from their original SEA L'98 papers. The six papers can be grouped into three categories. The first two papers by He et al. and by Ishibuchi and Nakashima described novel applications of genetic algorithms to nearest neighbor classifiers. The next two papers by Kawakami et al. and by Tachibana and Furuhashi presented new fuzzy learning systems. The last two papers by Myung and Kim and by Yu and Wu discussed constrained optimization using the evolutionary approach. I would like to take this opportunity to thank Dr Bob McKay, the SEAL'98 Organizing Committee Chair, for playing a pivotal role in organizing the very successful SEAL'98, Professor Kaoru Hirota, the Editor-in-Chief of the Journal of Advanced Computational Intelligence, for encouraging me to edit this special issue, and all the authors for their high-quality work. References: 1)X. Yao, J-H. Kim, and T. Furuhashi, eds., Simulated Evolution and Learning, Vol. 1285 of Lecture Notes in Artificial Intelligence. Berlin, Germany: Springer-Verlag, 1997. 2)B. Mckay, X. Yao, C. S. Newton, J-H. kim, and T. Furuhashi, eds., Simulated Evolution and Learning, Vo1.1585 of Lecture Notes in Artificial Intelligence. Berlin, Germany: Springer-Verlag, 1999. 3)X. Yao, ed., Evolutionary Computation: Theory and Applications. Singapore: World Scientific Publishing Co., 1999.

APA, Harvard, Vancouver, ISO, and other styles

4

Oram,RexN., JaneP.Edlington, and P.AnneGardner. "Selection for resistance to salinity and waterlogging in Phalaris aquatica L." Australian Journal of Agricultural Research 53, no.4 (2002): 391. http://dx.doi.org/10.1071/ar01118.

Full text

Abstract:

Dedication: This paper is dedicated to the memory of C. M. Donald, J. F. Miles, and C. A. Neal-Smith, who collected seeds of many Mediterranean populations of phalaris; these have been invaluable for breeding modern cultivars. Because of the increasing area of southern Australia being threatened by rising saline groundwater, a search was made among 28 Mediterranean accessions and 10 Australasian cultivars of the deep-rooted, drought-resistant grass, phalaris (Phalaris aquatica L.), for genotypes that are more resistant to salinity and waterlogging than the present cultivars. In gravel medium watered with a nutrient solution containing 150 mol/m3 of NaCl and 10 mol/m3 of CaCl2, a salt concentration equal to one-quarter strength seawater, the dry weight of live tops was reduced by an average of 58% relative to the non-saline treatment, whereas the reductions in the salt-tolerant control species, tall wheatgrass [Thinopyrum ponticum (Podp.) Z.-W. Liu & R.-C. Wang] and Aegilops tauschii Coss., were 13.4% and 26.6%, respectively. Sirolan was the highest yielding phalaris population under both saline and non-saline conditions, and Grasslands Maru and cv. Australian and its relatives were some of the least affected by salt. In a second experiment, the sodium content of the herbage of 1–3 cloned plants in each of 22 phalaris accessions averaged 1.62% in the treated offsets and 0.10% in the untreated offsets. Two genotypes in one accession, CPI 19315 from Morocco, had exceptionally low sodium concentrations and Na/K ratios in plants treated with salt. The means for these traits in CPI 19315 were 4.6 g/kg DM and 0.09, respectively, compared with means in the other 21 lines of 17.7 and 0.35. CPI 19315 plants were crossed to seed-retaining, waterlogging-tolerant segregants from the backcross of P. aquatica × P. arundinacea to P. aquatica. The F2 was compared with CPI 19315 and Grasslands Maru phalaris, Dundas tall wheatgrass, and AU Triumph tall fescue (Festuca arundinaceaSchreb.) on a winter-wet, saline discharge cline east of Wagga Wagga, NSW. Seedling density, emergence score, and dry matter yield at the end of the first growing season varied significantly among grasses and positions on the salinity/waterlogging gradient. However, the genotype and salinity effects on yield disappeared when seedling density was used as a covariate. Nevertheless, except for Dundas tall wheatgrass, herbage yield was correlated with position in the gradient, the F2 and Dundas tall wheatgrass being less affected by increasing stress than Grasslands Maru, CPI 19315, and AU Triumph tall fescue. Seed was harvested from putative seed-retaining F2 plants, and seedlings were transplanted into a saline discharge area near Canberra, ACT. The families differed significantly in injury and survival. The narrow-sense heritability of freedom from leaf injury was 0.52 0.28. Seed was again harvested from seed retaining survivors, and fourth generation seedlings were grown on the same area for continued selection. The plants in 3 family groups were significantly larger than of those in any of the control cultivar groups after 5 months exposure to waterlogging and salinity. Most survived the ensuing summer and autumn. The possibility of developing a cultivar better suited to saline, winter-wet, summer-dry soils is discussed.

APA, Harvard, Vancouver, ISO, and other styles

5

Silitonga, Mirdat, Herien Puspitawati, and Istiqlaliyah Muflikhati. "MODAL SOSIAL, COPING EKONOMI, GEJALA STRES SUAMI DAN KESEJAHTERAAN SUBJEKTIF KELUARGA PADA KELUARGA TKW." JKKP (Jurnal Kesejahteraan Keluarga dan Pendidikan) 5, no.1 (April17, 2018): 20–30. http://dx.doi.org/10.21009/jkkp.051.03.

Full text

Abstract:

The achievement of family well - being is an aspiration of all families including families of migrant workers, to achieve the well - being of one of the ways that the families of migrant workers with the departure of the wife work as domestic servants in various countries. The purpose of this study was to analyze social capital, economic coping, sress symptom’s husband and family subjektive well - being of women migrant workers. This research use cross sectional studies. The location was chosen purposively in Tanggeung Village, Pagermaneuh Village, Margaluyu Village, Karangtengah Village, Tanggeung District and Pasirdalam Village Kadupandak District, Cianjur, West Java, Indonesia. Seventy five families were selected purposively among the families of women migrant workers. The finding indicates that social capital is in the moderate category, the coping economy is in the moderate category, the sress symptom’s husband is in the low category and the family well-being is in the low category. Finding in this study family subjective well-being is influenced by income per capita, sress symptom’s husband and economic coping. Keywords: economic coping, family subjective well-being, social capital, stress symptom Abstrak Kesejahteraan keluarga merupakan sesuatu yang ingin dicapai seluruh keluarga, termasuk keluarga Tenaga Kerja Wanita (TKW), untuk mencapai kesejahteraan tersebut salah satu cara yang dilakukan oleh keluarga TKW adalah mengirim istri sebagai pembantu rumah tangga di berbagai negara. Tujuan dari penelitian ini adalah untuk menganalisis modal sosial, coping ekonomi, gejala stres suami, dan kesejahteraan subjektif keluarga TKW. Penelitian ini menggunakan cross sectional studies. Lokasi dipilih dengan metode purposive di Provinsi Jawa Barat, Kabupaten Cianjur, Kecamatan Tanggeung, Desa Pagermaneuh, Desa Marguluyu, Desa Karangtengah, Desa Tanggeung, Kecamatan Kadupandak, Desa Pasirdalam. Jumlah sampel sebanyak 75 keluarga TKW dengan metode purposive sampling. Penelitian ini menemukan modal sosial berada pada kategori sedang, coping ekonomi berada pada kategori sedang, gelaja stres suami berada pada kategori rendah, dan kesejahteraan subjektif berada pada kategori rendah. Penelitian ini juga menemukan kesejahteraan keluarga berpengaruh terhadap pendapatan perkapita, gelaja stres suami, dan coping ekonomi. Kata kunci : coping ekonomi, gejala stres, kesejahteraan subjektif, modal sosial. References [BPS] Badan Pusat Statistik. 2016. Data provinsi termiskin 2016. Berita Resmi Statistik [internet]. 4 Januari 2016. [diunduh 2016 September 7]; Tersedia pada: http://www.bps.go.id. [BPS] Badan Pusat Statistik Jawa Barat. 2016. Garis Kemiskinan Menurut Kabupaten/Kota di Jawa Barat (Rp/kapita/bulan), 2005-2014. Berita Resmi Statistik [internet]. 4 Januari 2016, [diunduh 2016 September 7]; Tersedia pada: http://jabar.bps.go.id. Alfiasari. 2008. Analisis modal sosial dalam pemberdayaan ekonomi keluarga miskin di Kelurahan Kedung Jaya, Kecamatan Tanah Sareal, Kota Bogor. Vol. 1 no. 1 edisi Januari. Bogor (ID): Institut Pertanian Bogor. Borner, Shively J, Wunder G, Wyman S. 2012. How do rural households respond to economic shocks? Insights from hierarchical analysis using global data. International Association of Agricultural Economists. Casey L. 2013. Stress and wellbeing in Australia survey 2013. Australian Psychological Society Carbonell A F. 2005. Income and well-being: an empirical analysis of the comparison income effect. Journal of Public Economics: 89 (2005) 997 – 1019. Coleman J S. 1988. “Social capital in the creation of human capital.” American Journal of Sociology 94 (Supplement): S95-S120. Celia M, Lenore M. 2004. Somali Women and Well-Being: Social Networks and Social Capital among Immigrant Women in Australia. Human Organization. Vol. 63 :88 Djohan R. 2008. Leader & Social Capital : Lead to Togetherness. Jakarta: Fund Asia Education Debebe Z, Mebratie A, Sparrow R, Abebaw D, Dekker M, Alemu G, Bedi A. 2013. Coping with shocks in rural Ethiopia. Working Paper. African Studies Centre. Dercon S. 2000. Income risk, coping strategies and safety nets. Background paper World Development Report 2000/01: Centre for the Study of African Economies, Oxford University, Department of Economics Diener E, Tay L. 2013. Rising Income and the Subjective Well-Being of Nations. Journal of Personality and Social Psychology: Vol. 104, No. 2, 267–276 DOI: 10.1037/a0030487 Dwyer A, Cummings A. 2001. Stress, Self-Efficacy, Social Support, and Coping Strategies in University Students. Canadian Journal of Counselling. Vol. 35:3 Ersado L, Alderman H, Alwang J. 2014. Changes in Consumption and Saving Behavior before and after Economic Shocks: Evidence from Zimbabwe. http://www.jstor.org/stable/10.1086/380136 Fujiwara F, Kawachi I. 2008. Social Capital and Health A Study of Adult Twins in the U.S. American Journal of Preventive Medicine. Vol. 35: 2 Garcia M, McDowell T. 2010. Mapping Social Capital: A Critical Contextual Approach For Working with Low-Status Families. Journal of Marital and Family Therapy. Vol. 36 No. 1: 96. 10.1111/j.1752-0606.2009.00188.x Grootaert C. 1999. Social capital, household walfare and poverty in Indonesia. Working Paper, No.6. Washington DC, USA: The World Bank. Social Development Department. Hasanah U, Nadiroh, Neolaka A. 2017. The Influence of Couple Interaction, Roles Differences, and Social-Economic Status on Mother’s Stress Coping. American Scientific Publisher. Vol. 23 10868 – 10870. Helliwell J F, Huang H, Wang S. 2013. Social Capital and Well-Being in Times of Crisis. Journal Happiness Study: DOI 10.1007/s10902-013-9441-z Headey B, Wooden Mark. 2004. The Effects of Wealth and Income on Subjective Well-Being and Ill-Being. Melbourne Institute of Applied and Social Research: IZA DP No. 1032. Hyyppa M. T, Maki J. (2003). Social participation and health in a community rich in stock of social capital. Health Education Research, 18(6), 770–779. Hossain S. 2006. Poverty, household strategies, and coping with urban life: examining livelihood framework in Dhaka City, Bangladesh. Bangladesh e-Journal of Sociology, Vol. 2, No. 1. Jain A K, Giga S I, Cooper C L. 2013. Stress, Health and Well-Being: The Mediating Role of Employee and Organizational Commitment. International Journal of Environmental Research and Public Health: doi:10.3390/ijerph10104907 Jaya, Sumertajaya I M, 2008, Pemodelan persamaan struktural dengan partial least square. Semnas Matematika dan Pendidikan Matematika. Vol. 1 118 - 132 Jha R, Nahrajan H K, Pradhan K. 2012. Household Coping Strategies and Welfare: Does Governance Matter? NCAER Working Papers on Decentralisation and Rural Governance in India. Krantz. 2001. The Sustainable Livelihood Approach to Poverty Reduction. Swedish International Development Cooperation Agency Kawachi I. 2006 Commentary: social capital and health: making the connections one step at a time. Int J Epidemiol. Vol. 35:989 –93. Lazarus, R S, Folkman, S, 1984. Stress, Appraisal, and Coping. New York: Springer. Mohnen S, Beate V B, Flap H, Subramanian S, Groenewegen P. 2015. The Influence of Social Capital on Individual Health: Is it the Neighbourhood or the Network?. Soc Indic Res. Vol. 121:195–214 DOI 10.1007/s11205-014-0632-8 Markovic, M, Manderson, L. (2002). Crossing national boundaries: Social identity formation among recent immigrant women in Australia from former Yugoslavia. Identity: An International Journal of Theory and Research, 2, 303-316. Puspitawati H. 2012. Gender dan Keluarga. Bogor (ID): IPB Press. ____________. 2013. Ekologi Keluarga: Konsep dan Lingkungan. Bogor (ID): IPB Press. ____________. 2013. Pengantar Studi Keluarga. Bogor (ID): IPB Press. Puspitawati H, Herawati T. 2013. Metode Penelitian Keluarga. Bogor (ID): IPB Press. Rebecca P, Crnic K A, Cox M J, Mills W R. 2013. The Family Model Stress and Maternal Psychological Symptoms: Mediated Pathways From Economic Hardship to Parenting. Journal of Family Psychology: DOI: 10.1037/a0031112 Rosidah U, Hartoyo, Istiqlaliyah. 2012. Kajian strategi koping dan perilaku investasi anak pada keluarga buruh pemetik melati gambir. Jurnal Ilmu Keluarga dan Konsumen, Vol. 5, No. 1. Stevenson B, Wolfers J. 2013. Subjective Well-Being and Income: Is There Any Evidence of Satiation? American Economic Review. 103(3): 598–604 http://dx.doi.org/10.1257/aer.103.3.598 Welsh J A, Berry H L. 2009. Social capital and mental health and well-being. National Centre for Epidemiology and Population Health, The Australian National University Wills E, Orozco L, Forero C, Pardo O, Andonova V. 2011. The relationship between perceptions of insecurity, social capital and subjective well-being: Empirical evidences from areas of rural conflict in Colombia. The Journal of Socio-Economics. Vol. 40 88–96 Yip W, Subramanian S. V, Mitchell A D, Lee D, Wang J, Kawachi I. 2007. Does social capital enhance health and well-being? Evidence from rural China. Journal Social Science & Medicine: 35 – 49

APA, Harvard, Vancouver, ISO, and other styles

6

Long,H.B., C.Bai, J.Peng, and F.Y.Zeng. "First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China." Plant Disease 98, no.10 (October 2014): 1451. http://dx.doi.org/10.1094/pdis-04-14-0370-pdn.

Full text

Abstract:

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

APA, Harvard, Vancouver, ISO, and other styles

7

Rahardjo, Budi, Fachrul Rozie, and Jessika Maulina. "Parents’ Role in Children's Learning During and After the Covid-19 Pandemic." JPUD - Jurnal Pendidikan Usia Dini 16, no.1 (April30, 2022): 69–84. http://dx.doi.org/10.21009/jpud.161.05.

Full text

Abstract:

When children only see their friends in little squares via Google Meet or Zoom, can teachers really address concepts like the importance of teamwork or how to manage conflict? This is a learning phenomenon during the COVID-19 pandemic and the era after it. This study aims to see the role of parents as children's learning companions in terms of mentors and motivators when online education takes place. This research using photovoice within phenomenological methodology and have been doing with thematic analysis and collecting data through interviews and observations. The participants were eight parents and one female teacher as a homeroom teacher. The research findings show that although there are many obstacles in online learning for children, learning during the COVID-19 pandemic can still run by involving the role of parents and teachers as pillars of education for preschool-age children. For further research, it is hoped that the findings will be a way in solving learning problems for children. Keywords: early childhood education, parents’ role, online learning References: Adedoyin, O. B., & Soykan, E. (2020). Covid-19 pandemic and online learning: The challenges and opportunities. In Interactive Learning Environments. https://doi.org/10.1080/10494820.2020.1813180 Aras, S. (2016). Free play in early childhood education: A phenomenological study. Early Child Development and Care, 186(7). https://doi.org/10.1080/03004430.2015.1083558 Arkorful, V. (2021). The role of e-learning, advantages and disadvantages of its adoption in higher The role of e-learning, the advantages and disadvantages of its adoption in Higher Education . International Journal of Education and Research, 2(December 2014). Atiles, J. T., Almodóvar, M., Chavarría Vargas, A., Dias, M. J. A., & Zúñiga León, I. M. (2021). International responses to COVID-19: Challenges faced by early childhood professionals. European Early Childhood Education Research Journal, 29(1). https://doi.org/10.1080/1350293X.2021.1872674 Barnett, W. S., Grafwallner, R., & Weisenfeld, G. G. (2021). Corona pandemic in the United States shapes new normal for young children and their families. In European Early Childhood Education Research Journal (Vol. 29, Issue 1). https://doi.org/10.1080/1350293X.2021.1872670 Basham, J. D., Blackorby, J., & Marino, M. T. (2020). Opportunity in Crisis: The Role of Universal Design for Learning in Educational Redesign. In Learning Disabilities: A Contemporary Journal (Vol. 18, Issue 1). Beatriks Novianti Bunga, R. Pasifikus Christa Wijaya & Indra Yohanes Kiling (2021) Studying at Home: Experience of Parents and Their Young Children in an Underdeveloped Area of Indonesia, Journal of Research in Childhood Education, DOI: 10.1080/02568543.2021.1977436 Buheji, M., Hassani, A., Ebrahim, A., da Costa Cunha, K., Jahrami, H., Baloshi, M., & Hubail, S. (2020). Children and Coping During COVID-19: A Scoping Review of Bio-Psycho-Social Factors. International Journal of Applied Psychology, 10(1). https://doi.org/10.5923/j.ijap.20201001.02 Celik, M. Y. (2021). The dual role of nurses as mothers during the pandemic period: Qualitative study. Early Child Development and Care. https://doi.org/10.1080/03004430.2021.1917561 Coulter, M., Britton, Ú., MacNamara, Á., Manninen, M., McGrane, B., & Belton, S. (2021). PE at Home: Keeping the ‘E’ in PE while home-schooling during a pandemic. Physical Education and Sport Pedagogy. https://doi.org/10.1080/17408989.2021.1963425 Creswell, J. W. (2015). Educational research: Planning, conducting, and evaluating quantitative and qualitative research (Fifth edition). Pearson. Dodd, H. F., Fitzgibbon, L., Watson, B. E., & Nesbit, R. J. (2021). Children’s play and independent mobility in 2020: Results from the british children’s play survey. International Journal of Environmental Research and Public Health, 18(8). https://doi.org/10.3390/ijerph18084334 Duran, A. (2019). A Photovoice Phenomenological Study Exploring Campus Belonging for Queer Students of Color. Journal of Student Affairs Research and Practice, 56(2). https://doi.org/10.1080/19496591.2018.1490308 Ebbeck, M., Yim, H. Y. B., Chan, Y., & Goh, M. (2016). Singaporean Parents’ Views of Their Young Children’s Access and Use of Technological Devices. Early Childhood Education Journal. https://doi.org/10.1007/s10643-015-0695-4 Ekyana, Luluk, Fauziddin Muhammad & Arifiyanti Nurul. (2021). Parents’ Perception: Early Childhood Social Behaviour During Physical Distancing in the Covid-19 Pandemic. JPUD: Jurnal Pendidikan Usia Dini, Volume 15 (2),DOI: https://doi.org/10.21009/JPUD.152.04 Eslava, M., Deaño, M., Alfonso, S., Conde, Á., & García-Señorán, M. (2016). Family context and preschool learning. Journal of Family Studies, 22(2). https://doi.org/10.1080/13229400.2015.1063445 Finn, L., & Vandermaas-Peeler, M. (2013). Young children’s engagement and learning opportunities in a cooking activity with parents and older siblings. Early Childhood Research and Practice, 15(1). Gee, E., Siyahhan, S., & Cirell, A. M. (2017). Video gaming as digital media, play, and family routine: Implications for understanding video gaming and learning in family contexts. Learning, Media, and Technology, 42(4). https://doi.org/10.1080/17439884.2016.1205600 Gelir, I., & Duzen, N. (2021). Children’s changing behaviours and routines, challenges and opportunities for parents during the COVID-19 pandemic. Education 3-13. https://doi.org/10.1080/03004279.2021.1921822 Giannini, S., Jenkins, R., & Saavedra, J. (2021). Mission: Recovering Education 2021. In UNICEF, UNESCO, and World Bank. Goodhart, F. W., Hsu, J., Baek, J. H., Coleman, A. L., Maresca, F. M., & Miller, M. B. (2006). A view through a different lens: Photovoice as a tool for student advocacy. Journal of American College Health, 55(1). https://doi.org/10.3200/JACH.55.1.53-56 Gong, S., Wang, X., Wang, Y., Qu, Y., Tang, C., Yu, Q., & Jiang, L. (2019). A descriptive qualitative study of home care experiences in parents of children with tracheostomies. Journal of Pediatric Nursing, 45. https://doi.org/10.1016/j.pedn.2018.12.005 Hamaidi, D. A., Arouri, Y. M., Noufa, R. K., & Aldrou, I. T. (2021). Parents’ Perceptions of Their Children’s Experiences with Distance Learning During the COVID-19 Pandemic. International Review of Research in Open and Distance Learning, 22(2). https://doi.org/10.19173/irrodl.v22i2.5154 Hammersley, M., & Traianou, A. (2015). Ethics in Qualitative Research: Controversies and Contexts. In Ethics in Qualitative Research: Controversies and Contexts. https://doi.org/10.4135/9781473957619 Harris, K. I. (2021). Parent Cooperative Early Childhood Settings: Empowering Family Strengths and Family Engagement for All Young Children. International Journal of Contemporary Education, 4(1). https://doi.org/10.11114/ijce.v4i1.5143 Hassinger-Das, B., Zosh, J. M., Hansen, N., Talarowski, M., Zmich, K., Golinkoff, R. M., & Hirsh-Pasek, K. (2020). Play-and-learn spaces: Leveraging library spaces to promote caregiver and child interaction. Library and Information Science Research, 42(1). https://doi.org/10.1016/j.lisr.2020.101002 Henter, R., & Nastasa, L. E. (2021). Parents’ Emotion Management for Personal Well-Being When Challenged by Their Online Work and Their Children’s Online School. Frontiers in Psychology, 12. https://doi.org/10.3389/fpsyg.2021.751153 Houston, S. (2017). Towards a critical ecology of child development in social work: Aligning the theories of Bronfenbrenner and Bourdieu. Families, Relationships and Societies, 6(1). https://doi.org/10.1332/204674315X14281321359847 Ihmeideh, F., AlFlasi, M., Al-Maadadi, F., Coughlin, C., & Al-Thani, T. (2020). Perspectives of family–school relationships in Qatar based on Epstein’s model of six types of parent involvement. Early Years, 40(2). https://doi.org/10.1080/09575146.2018.1438374 Iruka, I. U., DeKraai, M., Walther, J., Sheridan, S. M., & Abdel-Monem, T. (2020). Examining how rural ecological contexts influence children’s early learning opportunities. Early Childhood Research Quarterly, 52. https://doi.org/10.1016/j.ecresq.2019.09.005 Jiles, T. (2015). Knock, knock, may I come in? An integrative perspective on professional development concerns for home visits conducted by teachers. Contemporary Issues in Early Childhood, 16(1). https://doi.org/10.1177/1463949114567274 Kartini, K. (2021). Analisis Pembelajaran Online Anak Usia Dini Masa Pandemi COVID -19 Kota dan Perdalaman. Jurnal Obsesi : Jurnal Pendidikan Anak Usia Dini, 6(2). https://doi.org/10.31004/obsesi.v6i2.880 Kurniati, E., Nur Alfaeni, D. K., & Andriani, F. (2020). Analisis Peran Orang Tua dalam Mendampingi Anak di Masa Pandemi Covid-19. Jurnal Obsesi : Jurnal Pendidikan Anak Usia Dini, 5(1). https://doi.org/10.31004/obsesi.v5i1.541 La Paro, K. M., & Gloeckler, L. (2016). The Context of Child Care for Toddlers: The “Experience Expectable Environment”. Early Childhood Education Journal, 44(2). https://doi.org/10.1007/s10643-015-0699-0 Lau, E. Y. H., & Lee, K. (2021). Parents’ Views on Young Children’s Distance Learning and Screen Time During COVID-19 Class Suspension in Hong Kong. Early Education and Development, 32(6). https://doi.org/10.1080/10409289.2020.1843925 Lau, E. Y. H., Li, J. Bin, & Lee, K. (2021). Online Learning and Parent Satisfaction during COVID-19: Child Competence in Independent Learning as a Moderator. Early Education and Development, 32(6). https://doi.org/10.1080/10409289.2021.1950451 Lilawati, A. (2020). Peran Orang Tua dalam Mendukung Kegiatan Pembelajaran di Rumah pada Masa Pandemi. Jurnal Obsesi: Jurnal Pendidikan Anak Usia Dini. https://doi.org/10.31004/obsesi.v5i1.630 Lim, K. F. (2020). Emergency remote teaching and learning in the time of COVID-19. Chemistry in Australia, August. Lin, X., & Li, H. (2018). Parents’ play beliefs and engagement in young children’s play at home. European Early Childhood Education Research Journal, 26(2). https://doi.org/10.1080/1350293X.2018.1441979 Michele L. Stites, Susan Sonneschein & Samantha H. Galczyk (2021) Preschool Parents’ Views of Distance Learning during COVID-19, Early Education and Development, 32:7, 923-939, DOI: 10.1080/10409289.2021.1930936 Muhdi, Nurkolis, & Yuliejantiningsih, Y. (2020). The Implementation of Online Learning in Early Childhood Education During the Covid-19 Pandemic. JPUD - Jurnal Pendidikan Usia Dini, 14(2). https://doi.org/10.21009/jpud.142.04 Ortlipp, M. (2015). Keeping and Using Reflective Journals in the Qualitative Research Process. The Qualitative Report. https://doi.org/10.46743/2160-3715/2008.1579 Paat, Y. F. (2013). Working with Immigrant Children and Their Families: An Application of Bronfenbrenner’s Ecological Systems Theory. Journal of Human Behavior in the Social Environment, 23(8). https://doi.org/10.1080/10911359.2013.800007 Plowman, L., Stephen, C., & McPake, J. (2010). Supporting young children’s learning with technology at home and in preschool. Research Papers in Education, 25(1). https://doi.org/10.1080/02671520802584061 Rona Novick, Suzanne Brooks & Jenny Isaacs (2021) Parental Report of Preschoolers’ Jewish Day School Engagement and Adjustment During the Covid-19 Shutdown, Journal of Jewish Education, 87:4, 301-315, DOI: 10.1080/15244113.2021.1977098 Sandi Ferdiansyah, S. S., & Angin, R. (2020). Pengalaman Mahasiswa Thailand dalam Pembelajaran Daring di Universitas di Indonesia pada Masa Pandemi COVID-19. Journal of International Students, 10(S3). Sonnenschein, S., Stites, M., & Dowling, R. (2021). Learning at home: What preschool children’s parents do and what they want to learn from their children’s teachers. Journal of Early Childhood Research, 19(3). https://doi.org/10.1177/1476718X20971321 Sri Indah Pujiastuti, Sofia Hartati & Jun Wang (2022) Socioemotional Competencies of Indonesian Preschoolers: Comparisons between the Pre-Pandemic and Pandemic Periods and among DKI Jakarta, DI Yogyakarta and West Java Provinces, Early Education and Development, DOI: 10.1080/10409289.2021.2024061 Stone, K., Burgess, C., Daniel, B., Smith, J., & Stephen, C. (2017). Nurture corners in preschool settings: Involving and nurturing children and parents. Emotional and Behavioural Difficulties, 22(4). https://doi.org/10.1080/13632752.2017.1309791 Suzanne M. Egan & Chloé Beatty (2021) To school through the screens: the use of screen devices to support young children's education and learning during the COVID-19 pandemic, Irish Educational Studies, 40:2, 275-283, DOI: 10.1080/03323315.2021.1932551 Thomson, S. (2007). Do’s and don’ts: Children’s experiences of the primary school playground. Environmental Education Research, 13(4). https://doi.org/10.1080/13504620701581588 Vallejo-Ruiz, M., & Torres-Soto, A. (2020). Teachers’ conceptions on the quality of the teaching and learning process in early childhood education. Revista Electronica Educare, 24(3). https://doi.org/10.15359/REE.24-3.13 Widodo, H. P. (2014). Methodological considerations in interview data transcription. International Journal of Innovation in English Language, 3(1). Wijaya, Candra., Dalimunthe, Rasyid Anwar., & Muslim. Parents’ Perspective on The Online Learning Using Zoom Application in Early Childhood Education. JPUD: Jurnal Pendidikan Usia Dini, Volume 15 Number 2. DOI: https://doi.org/10.21009/JPUD.152.06 Winship, M., Standish, H., Trawick-Smith, J., & Perry, C. (2021). Reflections on practice: Providing authentic experiences with families in early childhood teacher education. In Journal of Early Childhood Teacher Education (Vol. 42, Issue 3). https://doi.org/10.1080/10901027.2020.1736695

APA, Harvard, Vancouver, ISO, and other styles

8

Robiatul Adawiah, Laila, and Yeni Rachmawati. "Parenting Program to Protect Children's Privacy: The Phenomenon of Sharenting Children on social media." JPUD - Jurnal Pendidikan Usia Dini 15, no.1 (April30, 2021): 162–80. http://dx.doi.org/10.21009/jpud.151.09.

Full text

Abstract:

Sharenting is a habit of using social media to share content that disseminates pictures, videos, information, and parenting styles for their children. The purpose of this article is to describe the sharenting phenomenon that occurs among young parents, and the importance of parenting programs, rather than protecting children's privacy. Writing articles use a qualitative approach as a literature review method that utilizes various scientific articles describing the sharenting phenomenon in various countries. The findings show that sharenting behaviour can create the spread of children's identity openly on social media and tends not to protect children's privacy and even seems to exploit children. Apart from that, sharenting can also create pressure on the children themselves and can even have an impact on online crime. This article is expected to provide benefits to parents regarding the importance of maintaining attitudes and behaviour when sharing and maintaining children's privacy and rights on social media. Keywords: Sharenting on social media, Children's Privacy, Parenting Program References: Åberg, E., & Huvila, J. (2019). Hip children, good mothers – children’s clothing as capital investment? Young Consumers, 20(3), 153–166. https://doi.org/10.1108/YC-06-2018-00816 Altafim, E. R. P., & Linhares, M. B. M. (2016). Universal violence and child maltreatment prevention programs for parents: A systematic review. Psychosocial Intervention, 25(1), 27–38. https://doi.org/10.1016/j.psi.2015.10.003 Archer, C., & Kao, K.-T. (2018). Mother, baby, and Facebook makes three: Does social media provide social support for new mothers? Media International Australia, 168(1), 122–139. https://doi.org/10.1177/1329878X18783016 Bartholomew, M. K., Schoppe-Sullivan, S. J., Glassman, M., Kamp Dush, C. M., & Sullivan, J. M. (2012). New Parents’ Facebook Use at the Transition to Parenthood. Family Relations, 61(3), 455–469. https://doi.org/10.1111/j.1741-3729.2012.00708.x Belk, R. W. (1988). Possessions and the Extended Self. Journal of Consumer Research, 15(2), 139. https://doi.org/10.1086/209154 Belk, R. W. (2013). Extended Self in a Digital World: Table 1. Journal of Consumer Research, 40(3), 477–500. https://doi.org/10.1086/671052 Benedetto, L., & Ingrassia, M. (2021). Digital Parenting: Raising and Protecting Children in Media World. In L. Benedetto & M. Ingrassia (Eds.), Parenting. IntechOpen. https://doi.org/10.5772/intechopen.92579 Berns, R. (2016). Child, family, school, community. Socialization and support. Stanford. United States of America, 5(64), 93–98. Bessant, C. (2017). Parental sharenting and the privacy of children. Northumbria University Faculty of Business and Law, Faculty and Doctoral Conference, 28th - 29th June 2017, Newcastle, UK. Bessant, C. (2018). Sharenting: Balancing the Conflicting Rights of Parents and Children. Communications Law, 23(1), 7–24. Bessant, C., & Nottingham, E. (2020). Sharenting in a socially distanced world. Parenting for a Digital Future., 1–2. Biglan, A., Flay, B. R., Embry, D. D., & Sandier, I. N. (2012). The Critical Role of Nurturing Environments for Promoting Human Weil-Being. American Psychologist, 16. Blum-Ross, A., & Livingstone, S. (2017). “Sharenting,” parent blogging, and the boundaries of the digital self. Popular Communication, 15(2), 110–125. https://doi.org/10.1080/15405702.2016.1223300 Brooks, J. (2008). The Process of Parenting. In The Process of Parenting (pp. 116–117). Pustaka Belajar. Brosch, A. (2016). When the child is born into the internet: Sharenting as a growing trend among parents on Facebook. New Educational Review, 43(1), 224–235. https://doi.org/10.15804/tner.2016.43.1.19 Brosch, A. (2018). Sharenting – Why do parents violate their children’s privacy? New Educational Review, 54(4), 75–85. https://doi.org/10.15804/tner.2018.54.4.06 Byrne, S., Rodrigo, M. J., & Máiquez, M. L. (2014). Patterns of individual change in a parenting program for child maltreatment and their relation to family and professional environments. Child Abuse & Neglect, 38(3), 457–467. https://doi.org/10.1016/j.chiabu.2013.12.008 Centers for Disease Control and Prevention. (2014). Understanding Child Maltreatment 2014 (p. 2). http://www.cdc.gov/violenceprevention/pdf/cm-factsheet-a.pdf Children’s Online Privacy Protection Act (COPPA). (2002). Protecting Children’s Privacy Under COPPA: A Survey on Compliance. Federal Trade Commission. http://www.ftc.gov/ogc/coppa1.htm Choi, G. Y., & Lewallen, J. (2018). “Say Instagram, Kids!”: Examining Sharenting and Children’s Digital Representations on Instagram. Howard Journal of Communications, 29(2), 144–164. https://doi.org/10.1080/10646175.2017.1327380 Collins English Dictionary. (2014). Opinion—Definition of opinion by The Free Dictionary. 12th Edition. http://dictionary.reference.com/browse/database Comer, J. S., & Barlow, D. H. (2014). The occasional case against broad dissemination and implementation: Retaining a role for specialty care in the delivery of psychological treatments. American Psychologist, 69(1), 1–18. https://doi.org/10.1037/a0033582 Durkin, K. F., & Bryant, C. D. (1999). Propagandizing pederasty: A thematic analysis of the on-line exculpatory accounts of unrepentant pedophiles. Deviant Behavior, 20(2), 103–127. https://doi.org/10.1080/016396299266524 Fitri, S. (2017). Dampak Foditif dan Negatif Sosial Media terhadap Sosial Anak. NATURALISTIC: Jurnal Kajian Penelitian Pendidikan Dan Pembelajaran, 1(2), 118–123. https://doi.org/10.35568/naturalistic.v1i2.5 Fox, A. K., & Hoy, M. G. (2019). Smart Devices, Smart Decisions? Implications of Parents’ Sharenting for Children’s Online Privacy: An Investigation of Mothers. Journal of Public Policy & Marketing, 38(4), 414–432. https://doi.org/10.1177/0743915619858290 Fridha, M., & Irawan, R. E. (2020). Eksploitasi Anak Melalui Akun Instagram (Analisis Wacana Kritis Praktek Sharenting oleh Selebgram Ashanty & Rachel Venya). Komuniti: Jurnal Komunikasi dan Teknologi Informasi, 12(1), 68–80. https://doi.org/10.23917/komuniti.v12i1.10703 Friedman, S. J. (2000). Children and the World Wide Web. University Press of America. Hammond, S. I., Müller, U., Carpendale, J. I. M., Bibok, M. B., & Liebermann-Finestone, D. P. (2012). The effects of parental scaffolding on preschoolers’ executive function. Developmental Psychology, 48(1), 271–281. https://doi.org/10.1037/a0025519 Holzer, P. J., Higgins, J., Bromfield, L., Richardson, N., & Higgins, D. (2006). The effectiveness of parent education and home visiting child maltreatment prevention programs. Australian Institute of Family Studies. Koetse, M. (2019). ‘Sharenting’ on Chinese Social Media: When Parents Are Posting Too Many Baby Pics on WeChat. What’s on Weibo Reporting Social Trends in China. Krisnawati, E. (2016). Mempertanyakan Privasi di Era Selebgram: Masih Adakah? Jurnal IIlmu Komunikasi, 13(2), 179. https://doi.org/10.24002/jik.v13i2.682 Latipah, E., Adi Kistoro, H. C., Hasanah, F. F., & Putranta, H. (2020). Elaborating motive and psychological impact of sharenting in millennial parents. Universal Journal of Educational Research, 8(10), 4807–4817. https://doi.org/10.13189/ujer.2020.081052 Leaver, T. (2020). Balancing privacy: Sharenting, intimate surveillance, and the right to be forgotten. In The Routledge Companion to Digital Media and Children. https://doi.org/10.33767/osf.io/fwmr2 Lee, S. J., Ward, K. P., Chang, O. D., & Downing, K. M. (2021). Parenting activities and the transition to home-based education during the COVID-19 pandemic. Children and Youth Services Review, 122, 105585. https://doi.org/10.1016/j.childyouth.2020.105585 Lundahl, B., Risser, H., & Lovejoy, M. (2006). A meta-analysis of parent training: Moderators and follow-up effects. Clinical Psychology Review, 26(1), 86–104. https://doi.org/10.1016/j.cpr.2005.07.004 Lwin, M., Stanaland, A., & Miyazaki, A. (2008). Protecting children’s privacy online: How parental mediation strategies affect website safeguard effectiveness. Journal of Retailing, 84(2), 205–217. https://doi.org/10.1016/j.jretai.2008.04.004 Manganello, J. A., Falisi, A. L., Roberts, K. J., Smith, K. C., & McKenzie, L. B. (2016). Pediatric injury information seeking for mothers with young children: The role of health literacy and ehealth literacy. Journal of Communication in Healthcare, 9(3), 223–231. https://doi.org/10.1080/17538068.2016.1192757 Manotipya, P., & Ghazinour, K. (2020). Children’s Online Privacy from Parents’ Perspective. Procedia Computer Science, 177, 178–185. https://doi.org/10.1016/j.procs.2020.10.026 Marasli, M., Sühendan, E., Yilmazturk, N. H., & Cok, F. (2016). Parents’ shares on social networking sites about their children: Sharenting. Anthropologist, 24(2), 399–406. https://doi.org/10.1080/09720073.2016.11892031 Mikton, C., & Butchart, A. (2009). Child maltreatment prevention: A systematic review of reviews. Bulletin of the World Health Organization, 87(5), 353–361. https://doi.org/10.2471/BLT.08.057075 Miyazaki, A. D. (2008). Online Privacy and the Disclosure of Cookie Use: Effects on Consumer Trust and Anticipated Patronage. Journal of Public Policy & Marketing, 27(1), 19–33. https://doi.org/10.1509/jppm.27.1.19 Morris, A. S., Robinson, L. R., Hays-Grudo, J., Claussen, A. H., Hartwig, S. A., & Treat, A. E. (2017). Targeting Parenting in Early Childhood: A Public Health Approach to Improve Outcomes for Children Living in Poverty. Child Development, 88(2), 388–397. https://doi.org/10.1111/cdev.12743 Moser, C., Chen, T., & Schoenebeck, S. Y. (2017). Parents? And Children?s Preferences about Parents Sharing about Children on Social Media. Proceedings of the 2017 CHI Conference on Human Factors in Computing Systems, 5221–5225. https://doi.org/10.1145/3025453.3025587 Nooraeni, R. (2017). Implementasi Program Parenting Dalam Menumbuhkan Perilaku Pengasuhan Positif Orang Tua Di PAUD Tulip Tarogong Kaler Garut. Jurnal Pendidikan Luar Sekolah, 13(2). Nottingham, E. (2013). ‘Dad! Cut that Part Out!’ Children’s Rights to Privacy in the Age of ‘Generation Tagged’: Sharenting, digital kidnapping and the child micro-celebrity. In Journal of Chemical Information and Modeling. O’Keeffe, G. S., Clarke-Pearson, K., & Council on Communications and Media. (2011). The Impact of Social Media on Children, Adolescents, and Families. PEDIATRICS, 127(4), 800–804. https://doi.org/10.1542/peds.2011-0054 Pan, X., & Yu, H. (2018). Different Effects of Cognitive Shifting and Intelligence on Creativity. The Journal of Creative Behavior, 52(3), 212–225. https://doi.org/10.1002/jocb.144 Prasetyo, Dimas., Syahnas, A. N. R., Fajriani, A., Nugraha, H. G., & Suryani, S. (2019). “Saya hanya mengunggah foto dan video anak saya ”. Intenational Conference on ECEP. Putra, A. M., & Febrina, A. (2019). Fenomena Selebgram Anak: Memahami Motif Orang tua. Jurnal ASPIKOM, 3(6), 1093–1108. https://doi.org/10.24329/aspikom.v3i6.396 Sakashita, M., & Kimura, J. (2011). Daughter as Mother’s Extended Self. In European advances in consumer research (In A. Bradshaw, C. Hackley, P. Maclaran (Eds.), Vol. 9, pp. 283–289). Association for Consumer Research. Salleh, A. S., & Noor, N. A. Mohd. (2019). Sharenting: Implikasinya dari Persepektif Perundangan Malaysia. Jurnal Undangundang Malaysia, 31(1), 121–156. Sanders, M. (2012). Development, evaluation, and multinational dissemination of the triple P-Positive Parenting Program. Annual Review of Clinical Psychology, 8, 345–379. Santini, P. M., & Williams, L. C. (2016). Parenting Programs to Prevent Corporal Punishment: A Systematic Review. Paidéia (Ribeirão Preto), 26(63), 121–129. https://doi.org/10.1590/1982-43272663201614 Sarkadi, A., Dahlberg, A., Fängström, K., & Warner, G. (2020). Children want parents to ask for permission before ‘sharenting’. Journal of Paediatrics and Child Health, 56(6), 981–983. https://doi.org/10.1111/jpc.14945 Shumaker, C., Loranger, D., & Dorie, A. (2017). Dressing for the Internet: A study of female self-presentation via dress on Instagram. Fashion, Style & Popular Culture, 4(3), 365–382. https://doi.org/10.1386/fspc.4.3.365_1 Siibak, A., & Traks, K. (2019). Viewpoints The dark sides of sharenting. Catalan Journal of Communication & Cultural Studies, 11(1), 115–121. https://doi.org/10.1386/cjcs.11.1.115 Sobur, A. (2001). Pers, Hak Privasi, dan Hak Publik. Mediator, 2(1), 81–91. http://dx.doi.org/10.24329/aspikom.v3i6.396 Steinberg, S. B. (2017). Sharenting: Children’s Privacy in the Age of social media. EMORY LAW JOURNAL, 66, 47. Traube, D. E., Hsiao, H.-Y., Rau, A., Hunt-O’Brien, D., Lu, L., & Islam, N. (2020). Advancing Home Based Parenting Programs through the Use of Telehealth Technology. Journal of Child and Family Studies, 29(1), 44–53. https://doi.org/10.1007/s10826-019-01458-w Trivette, C. M., & Dunst, C. J. (2009). Community-Based Parent Support Programs. 7. van der Velden, M., & El Emam, K. (2013). “Not all my friends need to know”: A qualitative study of teenage patients, privacy, and social media. Journal of the American Medical Informatics Association, 20(1), 16–24. https://doi.org/10.1136/amiajnl-2012-000949 Verswijvel, K., Walrave, M., Hardies, K., & Heirman, W. (2019). Sharenting, is it a good or a bad thing? Understanding how adolescents think and feel about sharenting on social network sites. Children and Youth Services Review, 104, 104401. https://doi.org/10.1016/j.childyouth.2019.104401 Wagner, A., & Gasche, L. A. (2018). Sharenting: Making decisions about other’s privacy on social networking sites. MKWI 2018 - Multikonferenz Wirtschaftsinformatik. World Health Organization (WHO). (2016). INSPIRE seven strategies for ending violence against children. World Health Organization. Wyatt Kaminski, J., Valle, L. A., Filene, J. H., & Boyle, C. L. (2008). A Meta-analytic Review of Components Associated with Parent Training Program Effectiveness. Journal of Abnormal Child Psychology, 36(4), 567–589. https://doi.org/10.1007/s10802-007-9201-9 Zeeuw, A. De, Media, M. A. N., & Culture, D. (2018). Exposing Childhoods Online (Issue June).

APA, Harvard, Vancouver, ISO, and other styles

9

Gauthier, Nathália Byrro, and Marcelo Carneiro de Freitas. "Programa Ciência sem Fronteiras: um relato de experiência por estudantes de Engenharia de Pesca (The Science without Borders program: a case study of students from the Fishing Engineering course)." Revista Eletrônica de Educação 14 (July27, 2020): 3633105. http://dx.doi.org/10.14244/198271993633.

Full text

Abstract:

The aim of this study was to describe the international academic mobility experienced by the Fishing Engineering students in other countries. The data was collected through an electronic semi-structured questionnaire hosted on an electronic platform by Google. A total of nine students answered the questionnaire, in which they chose countries such as France, Spain, Ireland, Canada, the United States and Australia to study abroad in. The student’s satisfaction with the Science without Borders Program (SwB) was extremely positive, where all the interviewees stated that they had learned the language from the hosting country. In relation to the negative aspects, 67% of the interviewees pointed out that they struggled to understand the language in the beginning of the academic mobility, and 78% of the students said that they missed their families during the student mobility period. In conclusion, the academic mobility performed by students from the Fishing Engineering course was rated as excellent, and as a unique and an enriching opportunity, both in professional and personal aspects.ResumoO trabalho teve como objetivo discutir sobre a mobilidade acadêmica vivenciada por estudantes de Engenharia de Pesca em outros países. A coleta de dados foi feita através de um questionário eletrônico semiestruturado, hospedado em uma plataforma eletrônica de formulários da Google. Um total de nove discentes respondeu ao questionário, realizando a mobilidade na França, Espanha, Irlanda, Canadá, Estados Unidos e Austrália. A satisfação dos estudantes com o Programa Ciência sem Fronteiras (CsF) foi positiva, todos os entrevistados afirmaram terem aprendido o idioma do país que escolheram. Em relação aos aspectos negativos, 67% dos entrevistados apontaram que tiveram dificuldades no entendimento do idioma do país no início da mobilidade acadêmica e 78% sentiram saudade da família no período da mobilidade. Concluindo, a mobilidade acadêmica realizada por discentes do Curso de Engenharia de Pesca foi classificada como excelente, sendo uma experiência única e enriquecedora tanto pelo lado profissional, quanto pessoal.Palavras-chave: Educação, Aprendizado, Internacionalização, Programa Ciência sem Fronteiras.Keywords: Education, Learning, Internationalization.ReferencesALTBACH, P. G. Comparative Higher Education: Knowledge, the University, and Development. Hong Kong: University of Hong Kong, p. 240, 1998.ANDRADE, B. P. S. O “Ciência sem Fronteiras” pelo olhar da comunidade acadêmica: O caso da Unifal-mg e da Unifei. 2018. 185f. Dissertação (Mestrado em Divulgação Científica e Cultural). Universidade Estadual de Campinas, Instituto de Estudos de Linguagem, Campinas, SP, 2018. AVEIRO, T. M. M. O programa Ciência sem Fronteiras como ferramenta de acesso à mobilidade internacional. Tear: Revista de Educação Ciência e Tecnologia, Canoas, v.3, n.2, 2014.BEINE, M.; NOEL, R.; RAGOT, L. Determinants of the international mobility of students. Economics of Education Review, mar. 2014. BETT, D. B. Jovens universitários e intercâmbio acadêmico. 2012. 34f. Monografia (Especialização em Psicologia terminalidade em Terapia Cognitiva e Comportamental). Universidade Federal do Rio Grande do Sul, Instituto de Psicologia, Porto Alegre, 2012.BRASIL. Decreto n.° 7.642, de 13 de dezembro de 2011, Institui o Programa Ciência sem Fronteiras. Diário Oficial da República Federativa do Brasil, Brasília, DF, n. 239, p. 7, seção1, 14 dez. 2011a.BRASIL. Ministério da Ciência, Tecnologia e Inovação. Ministério da Educação. Conselho Nacional de Desenvolvimento Científico e Tecnológico Coordenação de Aperfeiçoamento de Pessoal de Nível Superior. Programa Ciência sem Fronteiras: um programa especial de mobilidade internacional em ciência, tecnologia e inovação. Documento Conjunto CAPES-CNPq. Julho, 2011b. 67p. Disponível em: http://www.capes.gov.br/images/stories/download/ Ciencia-sem Fronteiras_DocumentoCompleto_julho2011.pdfBRASIL. Ministério Da Ciência Tecnologia e Inovação. Estratégia Nacional de Ciência, Tecnologia e Inovação 2012 – 2015: Balanço das Atividades Estruturantes de 2011. Brasília, DF, 2012. Disponível em: https://livroaberto.ibict.br/218981.pdf . Acesso em: 25 abr. 2018.BRASIL. Programa Ciência sem Fronteiras. Dados Chamadas Graduação Sanduíche 2011-2014. Brasília, 2014. Disponível em: http://www.cienciasemfronteiras.gov.br/web/csf/dados-chamadas-graduacao-sanduiche. Acesso em: 21 abr. 2018.BRASIL. Programa Ciência sem Fronteiras. Painel de Controle do Programa 2016. Disponível em: http://www.cienciasemfronteiras.gov.br/web/csf/painel-de-controle . Acesso em: 18 jul. 2018.BRUNO, R. C. et al. Mobilidade internacional para educação superior: perfil sociodemográfico e educacional de imigrantes. Almanaque Multidisciplinar de Pesquisa, Universidade Unigranrio, ano III, v.1, n.1, 2016.COMISSÃO DE CIÊNCIA E TECNOLOGIA, COMUNICAÇÃO E INFORMÁTICA. Senado Federal. Relatório. Brasília. 2015. Disponível em: http://legis.senado.leg.br/sdleg-getter/documento/download/9f8bccb3-c880-408c-9667-96582f07fa84 Acesso em: 20 maio 2018.CORREIA-LIMA, M. C.; RIEGEL, V. Mobilidade acadêmica made in South: refletindo sobre as motivações de estudantes brasileiros e colombianos. Magis Revista Internacional de Investigación en Educación, v.8, n.16, p.109-132, 2015. DOI: http://dx.doi.org/10.11144/Javeriana.m8-16.mamsCRUZ, V. X. A. PROGRAMA CIÊNCIA SEM FRONTEIRAS: Uma avaliação da política pública de internacionalização do ensino superior sob a perspectiva do Paradigma Multidimensional. Dissertação (Mestrado em Administração Pública). 2016. 209f. Universidade Federal de Goiás, Faculdade de Ciências e Tecnologia – FCT, Goiânia, GO, 2016.CUTTI, L. et al. Programa Ciência sem Fronteiras: relato de experiências. Revista Eletrônica de Educação, v.11, n.3, p.1020-1033, set./dez., 2017. DOI: http://dx.doi.org/10.14244/198271991897 DALMOLIN, I. S. et al. Intercâmbio acadêmico cultural internacional: uma experiência de crescimento pessoal e científico. Rev Bras Enferm, Brasília, v. 66, n.33. p. 442-447, 2013.FERREIRA, I.G.; CARREIRA, L. B.; BOTELHO, N. M. Mobilidade internacional na graduação em medicina: relato de experiência. ABCS Health Sci., v. 42, n.2, p.115-119, 2017. DOI: http://dx.doi.org/10.7322/abcshs.v42i2.1013INSTITUTE FOR INTERNATIONAL EDUCATION – IIE. Open Doors Report 2015: Fast Facts New York, 2015. Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Fact-Sheets-and-Infographics/Fast-Facts. Acesso em: 15 nov. de 2017.INSTITUTE OF INTERNATIONAL EDUCATION – IIE. International student totals by place of origin, 2012/13 – 2015/16. Open Doors Report on International Educational Exchange, 2016. Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Data/International-Students/Places-of-Origin. Acesso em: 15 nov. de 2017.INSTITUTE OF INTERNATIONAL EDUCATION – IIE. Open Doors Report 2017: Fast Facts Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Fact-Sheets-and-Infographics/Fast-Facts. Acesso em: 01 ago. 2018.INTERNATIONAL TRADE ADMINISTRATION – ITA. 2016 Top Markets Report Education: Brazil Country Case Study. Disponível em: https://www.trade.gov/topmarkets/pdf/Education_Brazil.pdf. Acesso em: 15 nov. de 2017.KNIGHT, J. Internationalization remodeled: definition, approaches, and rationales. Journal of Studies in International Education, v. 1, p. 5-31, 2004.LIMA, M. C.; RIEGEL, V. A influência da mobilidade acadêmica sobre a formação dos jovens. UniRitter, Negócios e Talentos, v.2 , n.11, 2013.MAJID, S. et al. Motivations for studying abroad and adjustment challenges faced by international students in Singapore. Acad. J. Educ. Res., v.5, n.8, p. 223-235, 2017. DOI: http://dx.doi.org/10.15413/ajer.2017.0712MANÇOS, G. R.; COELHO, F. S. Internacionalização da Ciência Brasileira: subsídios para avaliação do programa Ciência sem Fronteiras. Revista Brasileira de Políticas Públicas e Internacionais, p.73, 2017.MARANHÃO, C. M. S.; DUTRA, C. I.; MARANHÃO, R. K. Internacionalização do ensino superior: um estudo sobre barreiras e possibilidades. Administração: Ensino e Pesquisa, Rio de Janeiro, v. 18, n. 1, p. 09–38, jan-abr 2017. DOI: http://dx.doi.org/10.13058/raep.2017.v18n1.458MARQUES, F. Experiência encerrada. Revista Pesquisa Fapesp, ed. 256, 27-29, jun. 2017. Disponível em http://revistapesquisa.fapesp.br/2017/06/19/experiencia-encerrada . Acesso em: 21 nov. 2017.MARTINS, V.; MONTAGUE, A.; SILVA, P. B. Cooperação internacional para mobilidade estudantil: o caso da Umesp e da Zuyd. Revista de Educação do Cogeime, ano 26, n. 50, jan/jun 2017.MOROSINI, M. C.; AMARAL, G. M. Avaliação da mobilidade acadêmica universitária: A perspectiva dos alunos intercambistas. In: SIMPÓSIO AVALIAÇÃO DA EDUCAÇÃO SUPERIOR, 2015, Porto Alegre. Anais... Porto Alegre, 17 e 18 set. 2015. OLIVEIRA, A. L.; FREITAS, M. E. Motivações para mobilidade acadêmica internacional: a visão de alunos e professores universitários. Educação em Revista, Belo Horizonte, v.32, n.03, p. 217-246, jul/set 2016. DOI: http://dx.doi.org/10.1590/0102-4698148237PEREIRA, V. Relatos de uma viagem: uma análise feita pelos bolsistas sobre o programa Ciência Sem Fronteiras. Revista Perspectivas do Desenvolvimento: um enfoque multidimensional, v. 03, no 4, jul. 2015.PROLO, I.; VIEIRA, R. C. O programa Ciência sem Fronteiras e as Universidades Brasileiras: Uma política pública a celebrar? In: Seminários em Administração (SEMEAD), XX, 2017, LOCAL. Anais..., nov. 2017. ISSN 2177-3866.SÁ, C. M. The Rise and Fall of Brazil’s Science Without Borders. International Higher Education, n.85, p.17-18, 2016. STALLIVIERI, L. As dinâmicas de uma nova linguagem intercultural na mobilidade acadêmica internacional. 2009. 235f. Tese (Doutorado em Línguas Modernas). Universidade Del Salvador, Buenos Aires, Argentina, 2009.SANTOS, S. R. et al. Turismo e intercâmbio: contribuições para a formação discente nos cursos de graduação das instituições de ensino superior de São Luís, Maranhão. Cultur, ano 08, n. 2, jul. 2014.SEHNEM, P. R.; LUNA, J. M. F. Os egressos do Programa Ciência sem Fronteiras pela percepção dos seus professores. Revista Eletrônica de Educação, v. 12, n. 1, p. 104-119, jan./abr., 2018. DOI: http://dx.doi.org/10.14244/198271991919UNITED NATIONS ORGANIZATION FOR EDUCATION, SCIENCE AND CULTURE (UNESCO). Recueil des donneés mondiales sur l'éducation: statistiques comparées sur l'éducation dans le monde. Montreal: Unesco, 2009. Dispo­nível em: http://www.uis.unesco.org/Library/Documents/ged09-fr.pdf Acesso em: 01 abri 2019.e3633105

APA, Harvard, Vancouver, ISO, and other styles

10

Jim, Danny, Loretta Joseph Case, Rubon Rubon, Connie Joel, Tommy Almet, and Demetria Malachi. "Kanne Lobal: A conceptual framework relating education and leadership partnerships in the Marshall Islands." Waikato Journal of Education 26 (July5, 2021): 135–47. http://dx.doi.org/10.15663/wje.v26i1.785.

Full text

Abstract:

Education in Oceania continues to reflect the embedded implicit and explicit colonial practices and processes from the past. This paper conceptualises a cultural approach to education and leadership appropriate and relevant to the Republic of the Marshall Islands. As elementary school leaders, we highlight Kanne Lobal, a traditional Marshallese navigation practice based on indigenous language, values and practices. We conceptualise and develop Kanne Lobal in this paper as a framework for understanding the usefulness of our indigenous knowledge in leadership and educational practices within formal education. Through bwebwenato, a method of talk story, our key learnings and reflexivities were captured. We argue that realising the value of Marshallese indigenous knowledge and practices for school leaders requires purposeful training of the ways in which our knowledge can be made useful in our professional educational responsibilities. Drawing from our Marshallese knowledge is an intentional effort to inspire, empower and express what education and leadership partnership means for Marshallese people, as articulated by Marshallese themselves. Introduction As noted in the call for papers within the Waikato Journal of Education (WJE) for this special issue, bodies of knowledge and histories in Oceania have long sustained generations across geographic boundaries to ensure cultural survival. For Marshallese people, we cannot really know ourselves “until we know how we came to be where we are today” (Walsh, Heine, Bigler & Stege, 2012). Jitdam Kapeel is a popular Marshallese concept and ideal associated with inquiring into relationships within the family and community. In a similar way, the practice of relating is about connecting the present and future to the past. Education and leadership partnerships are linked and we look back to the past, our history, to make sense and feel inspired to transform practices that will benefit our people. In this paper and in light of our next generation, we reconnect with our navigation stories to inspire and empower education and leadership. Kanne lobal is part of our navigation stories, a conceptual framework centred on cultural practices, values, and concepts that embrace collective partnerships. Our link to this talanoa vā with others in the special issue is to attempt to make sense of connections given the global COVID-19 context by providing a Marshallese approach to address the physical and relational “distance” between education and leadership partnerships in Oceania. Like the majority of developing small island nations in Oceania, the Republic of the Marshall Islands (RMI) has had its share of educational challenges through colonial legacies of the past which continues to drive education systems in the region (Heine, 2002). The historical administration and education in the RMI is one of colonisation. Successive administrations by the Spanish, German, Japanese, and now the US, has resulted in education and learning that privileges western knowledge and forms of learning. This paper foregrounds understandings of education and learning as told by the voices of elementary school leaders from the RMI. The move to re-think education and leadership from Marshallese perspectives is an act of shifting the focus of bwebwenato or conversations that centres on Marshallese language and worldviews. The concept of jelalokjen was conceptualised as traditional education framed mainly within the community context. In the past, jelalokjen was practiced and transmitted to the younger generation for cultural continuity. During the arrival of colonial administrations into the RMI, jelalokjen was likened to the western notions of education and schooling (Kupferman, 2004). Today, the primary function of jelalokjen, as traditional and formal education, it is for “survival in a hostile [and challenging] environment” (Kupferman, 2004, p. 43). Because western approaches to learning in the RMI have not always resulted in positive outcomes for those engaged within the education system, as school leaders who value our cultural knowledge and practices, and aspire to maintain our language with the next generation, we turn to Kanne Lobal, a practice embedded in our navigation stories, collective aspirations, and leadership. The significance in the development of Kanne Lobal, as an appropriate framework for education and leadership, resulted in us coming together and working together. Not only were we able to share our leadership concerns, however, the engagement strengthened our connections with each other as school leaders, our communities, and the Public Schooling System (PSS). Prior to that, many of us were in competition for resources. Educational Leadership: IQBE and GCSL Leadership is a valued practice in the RMI. Before the IQBE programme started in 2018, the majority of the school leaders on the main island of Majuro had not engaged in collaborative partnerships with each other before. Our main educational purpose was to achieve accreditation from the Western Association of Schools and Colleges (WASC), an accreditation commission for schools in the United States. The WASC accreditation dictated our work and relationships and many school leaders on Majuro felt the pressure of competition against each other. We, the authors in this paper, share our collective bwebwenato, highlighting our school leadership experiences and how we gained strength from our own ancestral knowledge to empower “us”, to collaborate with each other, our teachers, communities, as well as with PSS; a collaborative partnership we had not realised in the past. The paucity of literature that captures Kajin Majol (Marshallese language) and education in general in the RMI is what we intend to fill by sharing our reflections and experiences. To move our educational practices forward we highlight Kanne Lobal, a cultural approach that focuses on our strengths, collective social responsibilities and wellbeing. For a long time, there was no formal training in place for elementary school leaders. School principals and vice principals were appointed primarily on their academic merit through having an undergraduate qualification. As part of the first cohort of fifteen school leaders, we engaged in the professional training programme, the Graduate Certificate in School Leadership (GCSL), refitted to our context after its initial development in the Solomon Islands. GCSL was coordinated by the Institute of Education (IOE) at the University of the South Pacific (USP). GCSL was seen as a relevant and appropriate training programme for school leaders in the RMI as part of an Asia Development Bank (ADB) funded programme which aimed at “Improving Quality Basic Education” (IQBE) in parts of the northern Pacific. GCSL was managed on Majuro, RMI’s main island, by the director at the time Dr Irene Taafaki, coordinator Yolanda McKay, and administrators at the University of the South Pacific’s (USP) RMI campus. Through the provision of GCSL, as school leaders we were encouraged to re-think and draw-from our own cultural repository and connect to our ancestral knowledge that have always provided strength for us. This kind of thinking and practice was encouraged by our educational leaders (Heine, 2002). We argue that a culturally-affirming and culturally-contextual framework that reflects the lived experiences of Marshallese people is much needed and enables the disruption of inherent colonial processes left behind by Western and Eastern administrations which have influenced our education system in the RMI (Heine, 2002). Kanne Lobal, an approach utilising a traditional navigation has warranted its need to provide solutions for today’s educational challenges for us in the RMI. Education in the Pacific Education in the Pacific cannot be understood without contextualising it in its history and culture. It is the same for us in the RMI (Heine, 2002; Walsh et al., 2012). The RMI is located in the Pacific Ocean and is part of Micronesia. It was named after a British captain, John Marshall in the 1700s. The atolls in the RMI were explored by the Spanish in the 16th century. Germany unsuccessfully attempted to colonize the islands in 1885. Japan took control in 1914, but after several battles during World War II, the US seized the RMI from them. In 1947, the United Nations made the island group, along with the Mariana and Caroline archipelagos, a U.S. trust territory (Walsh et al, 2012). Education in the RMI reflects the colonial administrations of Germany, Japan, and now the US. Before the turn of the century, formal education in the Pacific reflected western values, practices, and standards. Prior to that, education was informal and not binded to formal learning institutions (Thaman, 1997) and oral traditions was used as the medium for transmitting learning about customs and practices living with parents, grandparents, great grandparents. As alluded to by Jiba B. Kabua (2004), any “discussion about education is necessarily a discussion of culture, and any policy on education is also a policy of culture” (p. 181). It is impossible to promote one without the other, and it is not logical to understand one without the other. Re-thinking how education should look like, the pedagogical strategies that are relevant in our classrooms, the ways to engage with our parents and communities - such re-thinking sits within our cultural approaches and frameworks. Our collective attempts to provide a cultural framework that is relevant and appropriate for education in our context, sits within the political endeavour to decolonize. This means that what we are providing will not only be useful, but it can be used as a tool to question and identify whether things in place restrict and prevent our culture or whether they promote and foreground cultural ideas and concepts, a significant discussion of culture linked to education (Kabua, 2004). Donor funded development aid programmes were provided to support the challenges within education systems. Concerned with the persistent low educational outcomes of Pacific students, despite the prevalence of aid programmes in the region, in 2000 Pacific educators and leaders with support from New Zealand Aid (NZ Aid) decided to intervene (Heine, 2002; Taufe’ulungaki, 2014). In April 2001, a group of Pacific educators and leaders across the region were invited to a colloquium funded by the New Zealand Overseas Development Agency held in Suva Fiji at the University of the South Pacific. The main purpose of the colloquium was to enable “Pacific educators to re-think the values, assumptions and beliefs underlying [formal] schooling in Oceania” (Benson, 2002). Leadership, in general, is a valued practice in the RMI (Heine, 2002). Despite education leadership being identified as a significant factor in school improvement (Sanga & Chu, 2009), the limited formal training opportunities of school principals in the region was a persistent concern. As part of an Asia Development Bank (ADB) funded project, the Improve Quality Basic Education (IQBE) intervention was developed and implemented in the RMI in 2017. Mentoring is a process associated with the continuity and sustainability of leadership knowledge and practices (Sanga & Chu, 2009). It is a key aspect of building capacity and capabilities within human resources in education (ibid). Indigenous knowledges and education research According to Hilda Heine, the relationship between education and leadership is about understanding Marshallese history and culture (cited in Walsh et al., 2012). It is about sharing indigenous knowledge and histories that “details for future generations a story of survival and resilience and the pride we possess as a people” (Heine, cited in Walsh et al., 2012, p. v). This paper is fuelled by postcolonial aspirations yet is grounded in Pacific indigenous research. This means that our intentions are driven by postcolonial pursuits and discourses linked to challenging the colonial systems and schooling in the Pacific region that privileges western knowledge and learning and marginalises the education practices and processes of local people (Thiong’o, 1986). A point of difference and orientation from postcolonialism is a desire to foreground indigenous Pacific language, specifically Majin Majol, through Marshallese concepts. Our collective bwebwenato and conversation honours and values kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness) (Taafaki & Fowler, 2019). Pacific leaders developed the Rethinking Pacific Education Initiative for and by Pacific People (RPEIPP) in 2002 to take control of the ways in which education research was conducted by donor funded organisations (Taufe’ulungaki, 2014). Our former president, Dr Hilda Heine was part of the group of leaders who sought to counter the ways in which our educational and leadership stories were controlled and told by non-Marshallese (Heine, 2002). As a former minister of education in the RMI, Hilda Heine continues to inspire and encourage the next generation of educators, school leaders, and researchers to re-think and de-construct the way learning and education is conceptualised for Marshallese people. The conceptualisation of Kanne Lobal acknowledges its origin, grounded in Marshallese navigation knowledge and practice. Our decision to unpack and deconstruct Kanne Lobal within the context of formal education and leadership responds to the need to not only draw from indigenous Marshallese ideas and practice but to consider that the next generation will continue to be educated using western processes and initiatives particularly from the US where we get a lot of our funding from. According to indigenous researchers Dawn Bessarab and Bridget Ng’andu (2010), doing research that considers “culturally appropriate processes to engage with indigenous groups and individuals is particularly pertinent in today’s research environment” (p. 37). Pacific indigenous educators and researchers have turned to their own ancestral knowledge and practices for inspiration and empowerment. Within western research contexts, the often stringent ideals and processes are not always encouraging of indigenous methods and practices. However, many were able to ground and articulate their use of indigenous methods as being relevant and appropriate to capturing the realities of their communities (Nabobo-Baba, 2008; Sualii-Sauni & Fulu-Aiolupotea, 2014; Thaman, 1997). At the same time, utilising Pacific indigenous methods and approaches enabled research engagement with their communities that honoured and respected them and their communities. For example, Tongan, Samoan, and Fijian researchers used the talanoa method as a way to capture the stories, lived realities, and worldviews of their communities within education in the diaspora (Fa’avae, Jones, & Manu’atu, 2016; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014; Vaioleti, 2005). Tok stori was used by Solomon Islander educators and school leaders to highlight the unique circles of conversational practice and storytelling that leads to more positive engagement with their community members, capturing rich and meaningful narratives as a result (Sanga & Houma, 2004). The Indigenous Aborigine in Australia utilise yarning as a “relaxed discussion through which both the researcher and participant journey together visiting places and topics of interest relevant” (Bessarab & Ng’andu, 2010, p. 38). Despite the diverse forms of discussions and storytelling by indigenous peoples, of significance are the cultural protocols, ethics, and language for conducting and guiding the engagement (Bessarab & Ng’andu, 2010; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014). Through the ethics, values, protocols, and language, these are what makes indigenous methods or frameworks unique compared to western methods like in-depth interviews or semi-structured interviews. This is why it is important for us as Marshallese educators to frame, ground, and articulate how our own methods and frameworks of learning could be realised in western education (Heine, 2002; Jetnil-Kijiner, 2014). In this paper, we utilise bwebwenato as an appropriate method linked to “talk story”, capturing our collective stories and experiences during GCSL and how we sought to build partnerships and collaboration with each other, our communities, and the PSS. Bwebwenato and drawing from Kajin Majel Legends and stories that reflect Marshallese society and its cultural values have survived through our oral traditions. The practice of weaving also holds knowledge about our “valuable and earliest sources of knowledge” (Taafaki & Fowler, 2019, p. 2). The skilful navigation of Marshallese wayfarers on the walap (large canoes) in the ocean is testament of their leadership and the value they place on ensuring the survival and continuity of Marshallese people (Taafaki & Fowler, 2019; Walsh et al., 2012). During her graduate study in 2014, Kathy Jetnil-Kijiner conceptualised bwebwenato as being the most “well-known form of Marshallese orality” (p. 38). The Marshallese-English dictionary defined bwebwenato as talk, conversation, story, history, article, episode, lore, myth, or tale (cited in Jetnil Kijiner, 2014). Three years later in 2017, bwebwenato was utilised in a doctoral project by Natalie Nimmer as a research method to gather “talk stories” about the experiences of 10 Marshallese experts in knowledge and skills ranging from sewing to linguistics, canoe-making and business. Our collective bwebwenato in this paper centres on Marshallese ideas and language. The philosophy of Marshallese knowledge is rooted in our “Kajin Majel”, or Marshallese language and is shared and transmitted through our oral traditions. For instance, through our historical stories and myths. Marshallese philosophy, that is, the knowledge systems inherent in our beliefs, values, customs, and practices are shared. They are inherently relational, meaning that knowledge systems and philosophies within our world are connected, in mind, body, and spirit (Jetnil-Kijiner, 2014; Nimmer, 2017). Although some Marshallese believe that our knowledge is disappearing as more and more elders pass away, it is therefore important work together, and learn from each other about the knowledges shared not only by the living but through their lamentations and stories of those who are no longer with us (Jetnil-Kijiner, 2014). As a Marshallese practice, weaving has been passed-down from generation to generation. Although the art of weaving is no longer as common as it used to be, the artefacts such as the “jaki-ed” (clothing mats) continue to embody significant Marshallese values and traditions. For our weavers, the jouj (check spelling) is the centre of the mat and it is where the weaving starts. When the jouj is correct and weaved well, the remainder and every other part of the mat will be right. The jouj is symbolic of the “heart” and if the heart is prepared well, trained well, then life or all other parts of the body will be well (Taafaki & Fowler, 2019). In that light, we have applied the same to this paper. Conceptualising and drawing from cultural practices that are close and dear to our hearts embodies a significant ontological attempt to prioritize our own knowledge and language, a sense of endearment to who we are and what we believe education to be like for us and the next generation. The application of the phrase “Majolizing '' was used by the Ministry of Education when Hilda Heine was minister, to weave cultural ideas and language into the way that teachers understand the curriculum, develop lesson plans and execute them in the classroom. Despite this, there were still concerns with the embedded colonized practices where teachers defaulted to eurocentric methods of doing things, like the strategies provided in the textbooks given to us. In some ways, our education was slow to adjust to the “Majolizing '' intention by our former minister. In this paper, we provide Kanne Lobal as a way to contribute to the “Majolizing intention” and perhaps speed up yet still be collectively responsible to all involved in education. Kajin Wa and Kanne Lobal “Wa” is the Marshallese concept for canoe. Kajin wa, as in canoe language, has a lot of symbolic meaning linked to deeply-held Marshallese values and practices. The canoe was the foundational practice that supported the livelihood of harsh atoll island living which reflects the Marshallese social world. The experts of Kajin wa often refer to “wa” as being the vessel of life, a means and source of sustaining life (Kelen, 2009, cited in Miller, 2010). “Jouj” means kindness and is the lower part of the main hull of the canoe. It is often referred to by some canoe builders in the RMI as the heart of the canoe and is linked to love. The jouj is one of the first parts of the canoe that is built and is “used to do all other measurements, and then the rest of the canoe is built on top of it” (Miller, 2010, p. 67). The significance of the jouj is that when the canoe is in the water, the jouj is the part of the hull that is underwater and ensures that all the cargo and passengers are safe. For Marshallese, jouj or kindness is what living is about and is associated with selflessly carrying the responsibility of keeping the family and community safe. The parts of the canoe reflect Marshallese culture, legend, family, lineage, and kinship. They embody social responsibilities that guide, direct, and sustain Marshallese families’ wellbeing, from atoll to atoll. For example, the rojak (boom), rojak maan (upper boom), rojak kōrā (lower boom), and they support the edges of the ujelā/ujele (sail) (see figure 1). The literal meaning of rojak maan is male boom and rojak kōrā means female boom which together strengthens the sail and ensures the canoe propels forward in a strong yet safe way. Figuratively, the rojak maan and rojak kōrā symbolise the mother and father relationship which when strong, through the jouj (kindness and love), it can strengthen families and sustain them into the future. Figure 1. Parts of the canoe Source: https://www.canoesmarshallislands.com/2014/09/names-of-canoe-parts/ From a socio-cultural, communal, and leadership view, the canoe (wa) provides understanding of the relationships required to inspire and sustain Marshallese peoples’ education and learning. We draw from Kajin wa because they provide cultural ideas and practices that enable understanding of education and leadership necessary for sustaining Marshallese people and realities in Oceania. When building a canoe, the women are tasked with the weaving of the ujelā/ujele (sail) and to ensure that it is strong enough to withstand long journeys and the fierce winds and waters of the ocean. The Kanne Lobal relates to the front part of the ujelā/ujele (sail) where the rojak maan and rojak kōrā meet and connect (see the red lines in figure 1). Kanne Lobal is linked to the strategic use of the ujelā/ujele by navigators, when there is no wind north wind to propel them forward, to find ways to capture the winds so that their journey can continue. As a proverbial saying, Kanne Lobal is used to ignite thinking and inspire and transform practice particularly when the journey is rough and tough. In this paper we draw from Kanne Lobal to ignite, inspire, and transform our educational and leadership practices, a move to explore what has always been meaningful to Marshallese people when we are faced with challenges. The Kanne Lobal utilises our language, and cultural practices and values by sourcing from the concepts of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). A key Marshallese proverb, “Enra bwe jen lale rara”, is the cultural practice where families enact compassion through the sharing of food in all occurrences. The term “enra” is a small basket weaved from the coconut leaves, and often used by Marshallese as a plate to share and distribute food amongst each other. Bwe-jen-lale-rara is about noticing and providing for the needs of others, and “enra” the basket will help support and provide for all that are in need. “Enra-bwe-jen-lale-rara” is symbolic of cultural exchange and reciprocity and the cultural values associated with building and maintaining relationships, and constantly honouring each other. As a Marshallese practice, in this article we share our understanding and knowledge about the challenges as well as possible solutions for education concerns in our nation. In addition, we highlight another proverb, “wa kuk wa jimor”, which relates to having one canoe, and despite its capacity to feed and provide for the individual, but within the canoe all people can benefit from what it can provide. In the same way, we provide in this paper a cultural framework that will enable all educators to benefit from. It is a framework that is far-reaching and relevant to the lived realities of Marshallese people today. Kumit relates to people united to build strength, all co-operating and working together, living in peace, harmony, and good health. Kanne Lobal: conceptual framework for education and leadership An education framework is a conceptual structure that can be used to capture ideas and thinking related to aspects of learning. Kanne Lobal is conceptualised and framed in this paper as an educational framework. Kanne Lobal highlights the significance of education as a collective partnership whereby leadership is an important aspect. Kanne Lobal draws-from indigenous Marshallese concepts like kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness, heart). The role of a leader, including an education leader, is to prioritise collective learning and partnerships that benefits Marshallese people and the continuity and survival of the next generation (Heine, 2002; Thaman, 1995). As described by Ejnar Aerōk, an expert canoe builder in the RMI, he stated: “jerbal ippān doon bwe en maron maan wa e” (cited in Miller, 2010, p. 69). His description emphasises the significance of partnerships and working together when navigating and journeying together in order to move the canoe forward. The kubaak, the outrigger of the wa (canoe) is about “partnerships”. For us as elementary school leaders on Majuro, kubaak encourages us to value collaborative partnerships with each other as well as our communities, PSS, and other stakeholders. Partnerships is an important part of the Kanne Lobal education and leadership framework. It requires ongoing bwebwenato – the inspiring as well as confronting and challenging conversations that should be mediated and negotiated if we and our education stakeholders are to journey together to ensure that the educational services we provide benefits our next generation of young people in the RMI. Navigating ahead the partnerships, mediation, and negotiation are the core values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). As an organic conceptual framework grounded in indigenous values, inspired through our lived experiences, Kanne Lobal provides ideas and concepts for re-thinking education and leadership practices that are conducive to learning and teaching in the schooling context in the RMI. By no means does it provide the solution to the education ills in our nation. However, we argue that Kanne Lobal is a more relevant approach which is much needed for the negatively stigmatised system as a consequence of the various colonial administrations that have and continue to shape and reframe our ideas about what education should be like for us in the RMI. Moreover, Kannel Lobal is our attempt to decolonize the framing of education and leadership, moving our bwebwenato to re-framing conversations of teaching and learning so that our cultural knowledge and values are foregrounded, appreciated, and realised within our education system. Bwebwenato: sharing our stories In this section, we use bwebwenato as a method of gathering and capturing our stories as data. Below we capture our stories and ongoing conversations about the richness in Marshallese cultural knowledge in the outer islands and on Majuro and the potentialities in Kanne Lobal. Danny Jim When I was in third grade (9-10 years of age), during my grandfather’s speech in Arno, an atoll near Majuro, during a time when a wa (canoe) was being blessed and ready to put the canoe into the ocean. My grandfather told me the canoe was a blessing for the family. “Without a canoe, a family cannot provide for them”, he said. The canoe allows for travelling between places to gather food and other sources to provide for the family. My grandfather’s stories about people’s roles within the canoe reminded me that everyone within the family has a responsibility to each other. Our women, mothers and daughters too have a significant responsibility in the journey, in fact, they hold us, care for us, and given strength to their husbands, brothers, and sons. The wise man or elder sits in the middle of the canoe, directing the young man who help to steer. The young man, he does all the work, directed by the older man. They take advice and seek the wisdom of the elder. In front of the canoe, a young boy is placed there and because of his strong and youthful vision, he is able to help the elder as well as the young man on the canoe. The story can be linked to the roles that school leaders, teachers, and students have in schooling. Without each person knowing intricately their role and responsibility, the sight and vision ahead for the collective aspirations of the school and the community is difficult to comprehend. For me, the canoe is symbolic of our educational journey within our education system. As the school leader, a central, trusted, and respected figure in the school, they provide support for teachers who are at the helm, pedagogically striving to provide for their students. For without strong direction from the school leaders and teachers at the helm, the students, like the young boy, cannot foresee their futures, or envisage how education can benefit them. This is why Kanne Lobal is a significant framework for us in the Marshall Islands because within the practice we are able to take heed and empower each other so that all benefit from the process. Kanne Lobal is linked to our culture, an essential part of who we are. We must rely on our own local approaches, rather than relying on others that are not relevant to what we know and how we live in today’s society. One of the things I can tell is that in Majuro, compared to the outer islands, it’s different. In the outer islands, parents bring children together and tell them legends and stories. The elders tell them about the legends and stories – the bwebwenato. Children from outer islands know a lot more about Marshallese legends compared to children from the Majuro atoll. They usually stay close to their parents, observe how to prepare food and all types of Marshallese skills. Loretta Joseph Case There is little Western influence in the outer islands. They grow up learning their own culture with their parents, not having tv. They are closely knit, making their own food, learning to weave. They use fire for cooking food. They are more connected because there are few of them, doing their own culture. For example, if they’re building a house, the ladies will come together and make food to take to the males that are building the house, encouraging them to keep on working - “jemjem maal” (sharpening tools i.e. axe, like encouraging workers to empower them). It’s when they bring food and entertainment. Rubon Rubon Togetherness, work together, sharing of food, these are important practices as a school leader. Jemjem maal – the whole village works together, men working and the women encourage them with food and entertainment. All the young children are involved in all of the cultural practices, cultural transmission is consistently part of their everyday life. These are stronger in the outer islands. Kanne Lobal has the potential to provide solutions using our own knowledge and practices. Connie Joel When new teachers become a teacher, they learn more about their culture in teaching. Teaching raises the question, who are we? A popular saying amongst our people, “Aelon kein ad ej aelon in manit”, means that “Our islands are cultural islands”. Therefore, when we are teaching, and managing the school, we must do this culturally. When we live and breathe, we must do this culturally. There is more socialising with family and extended family. Respect the elderly. When they’re doing things the ladies all get together, in groups and do it. Cut the breadfruit, and preserve the breadfruit and pandanus. They come together and do it. Same as fishing, building houses, building canoes. They use and speak the language often spoken by the older people. There are words that people in the outer islands use and understand language regularly applied by the elderly. Respect elderly and leaders more i.e., chiefs (iroj), commoners (alap), and the workers on the land (ri-jerbal) (social layer under the commoners). All the kids, they gather with their families, and go and visit the chiefs and alap, and take gifts from their land, first produce/food from the plantation (eojōk). Tommy Almet The people are more connected to the culture in the outer islands because they help one another. They don’t have to always buy things by themselves, everyone contributes to the occasion. For instance, for birthdays, boys go fishing, others contribute and all share with everyone. Kanne Lobal is a practice that can bring people together – leaders, teachers, stakeholders. We want our colleagues to keep strong and work together to fix problems like students and teachers’ absenteeism which is a big problem for us in schools. Demetria Malachi The culture in the outer islands are more accessible and exposed to children. In Majuro, there is a mixedness of cultures and knowledges, influenced by Western thinking and practices. Kanne Lobal is an idea that can enhance quality educational purposes for the RMI. We, the school leaders who did GCSL, we want to merge and use this idea because it will help benefit students’ learning and teachers’ teaching. Kanne Lobal will help students to learn and teachers to teach though traditional skills and knowledge. We want to revitalize our ways of life through teaching because it is slowly fading away. Also, we want to have our own Marshallese learning process because it is in our own language making it easier to use and understand. Essentially, we want to proudly use our own ways of teaching from our ancestors showing the appreciation and blessings given to us. Way Forward To think of ways forward is about reflecting on the past and current learnings. Instead of a traditional discussion within a research publication, we have opted to continue our bwebwenato by sharing what we have learnt through the Graduate Certificate in School Leadership (GCSL) programme. Our bwebwenato does not end in this article and this opportunity to collaborate and partner together in this piece of writing has been a meaningful experience to conceptualise and unpack the Kanne Lobal framework. Our collaborative bwebwenato has enabled us to dig deep into our own wise knowledges for guidance through mediating and negotiating the challenges in education and leadership (Sanga & Houma, 2004). For example, bwe-jen-lale-rara reminds us to inquire, pay attention, and focus on supporting the needs of others. Through enra-bwe-jen-lale-rara, it reminds us to value cultural exchange and reciprocity which will strengthen the development and maintaining of relationships based on ways we continue to honour each other (Nimmer, 2017). We not only continue to support each other, but also help mentor the next generation of school leaders within our education system (Heine, 2002). Education and leadership are all about collaborative partnerships (Sanga & Chu, 2009; Thaman, 1997). Developing partnerships through the GCSL was useful learning for us. It encouraged us to work together, share knowledge, respect each other, and be kind. The values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity) are meaningful in being and becoming and educational leader in the RMI (Jetnil-Kijiner, 2014; Miller, 2010; Nimmer, 2017). These values are meaningful for us practice particularly given the drive by PSS for schools to become accredited. The workshops and meetings delivered during the GCSL in the RMI from 2018 to 2019 about Kanne Lobal has given us strength to share our stories and experiences from the meeting with the stakeholders. But before we met with the stakeholders, we were encouraged to share and speak in our language within our courses: EDP05 (Professional Development and Learning), EDP06 (School Leadership), EDP07 (School Management), EDP08 (Teaching and Learning), and EDP09 (Community Partnerships). In groups, we shared our presentations with our peers, the 15 school leaders in the GCSL programme. We also invited USP RMI staff. They liked the way we presented Kannel Lobal. They provided us with feedback, for example: how the use of the sail on the canoe, the parts and their functions can be conceptualised in education and how they are related to the way that we teach our own young people. Engaging stakeholders in the conceptualisation and design stages of Kanne Lobal strengthened our understanding of leadership and collaborative partnerships. Based on various meetings with the RMI Pacific Resources for Education and Learning (PREL) team, PSS general assembly, teachers from the outer islands, and the PSS executive committee, we were able to share and receive feedback on the Kanne Lobal framework. The coordinators of the PREL programme in the RMI were excited by the possibilities around using Kanne Lobal, as a way to teach culture in an inspirational way to Marshallese students. Our Marshallese knowledge, particularly through the proverbial meaning of Kanne Lobal provided so much inspiration and insight for the groups during the presentation which gave us hope and confidence to develop the framework. Kanne Lobal is an organic and indigenous approach, grounded in Marshallese ways of doing things (Heine, 2002; Taafaki & Fowler, 2019). Given the persistent presence of colonial processes within the education system and the constant reference to practices and initiatives from the US, Kanne Lobal for us provides a refreshing yet fulfilling experience and makes us feel warm inside because it is something that belongs to all Marshallese people. Conclusion Marshallese indigenous knowledge and practices provide meaningful educational and leadership understanding and learnings. They ignite, inspire, and transform thinking and practice. The Kanne Lobal conceptual framework emphasises key concepts and values necessary for collaborative partnerships within education and leadership practices in the RMI. The bwebwenato or talk stories have been insightful and have highlighted the strengths and benefits that our Marshallese ideas and practices possess when looking for appropriate and relevant ways to understand education and leadership. Acknowledgements We want to acknowledge our GCSL cohort of school leaders who have supported us in the development of Kanne Lobal as a conceptual framework. A huge kommol tata to our friends: Joana, Rosana, Loretta, Jellan, Alvin, Ellice, Rolando, Stephen, and Alan. References Benson, C. (2002). Preface. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (p. iv). Suva, Fiji: University of the South Pacific, Institute of Education. Bessarab, D., Ng’andu, B. (2010). Yarning about yarning as a legitimate method in indigenous research. International Journal of Critical Indigenous Studies, 3(1), 37-50. Fa’avae, D., Jones, A., & Manu’atu, L. (2016). Talanoa’i ‘a e talanoa - talking about talanoa: Some dilemmas of a novice researcher. AlterNative: An Indigenous Journal of Indigenous Peoples,12(2),138-150. Heine, H. C. (2002). A Marshall Islands perspective. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (pp. 84 – 90). Suva, Fiji: University of the South Pacific, Institute of Education. Infoplease Staff (2017, February 28). Marshall Islands, retrieved from https://www.infoplease.com/world/countries/marshall-islands Jetnil-Kijiner, K. (2014). Iep Jaltok: A history of Marshallese literature. (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Kabua, J. B. (2004). We are the land, the land is us: The moral responsibility of our education and sustainability. In A.L. Loeak, V.C. Kiluwe and L. Crowl (Eds.), Life in the Republic of the Marshall Islands, pp. 180 – 191. Suva, Fiji: University of the South Pacific. Kupferman, D. (2004). Jelalokjen in flux: Pitfalls and prospects of contextualising teacher training programmes in the Marshall Islands. Directions: Journal of Educational Studies, 26(1), 42 – 54. http://directions.usp.ac.fj/collect/direct/index/assoc/D1175062.dir/doc.pdf Miller, R. L. (2010). Wa kuk wa jimor: Outrigger canoes, social change, and modern life in the Marshall Islands (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Nabobo-Baba, U. (2008). Decolonising framings in Pacific research: Indigenous Fijian vanua research framework as an organic response. AlterNative: An Indigenous Journal of Indigenous Peoples, 4(2), 141-154. Nimmer, N. E. (2017). Documenting a Marshallese indigenous learning framework (Unpublished doctoral thesis). Honolulu, HW: University of Hawaii. Sanga, K., & Houma, S. (2004). Solomon Islands principalship: Roles perceived, performed, preferred, and expected. Directions: Journal of Educational Studies, 26(1), 55-69. Sanga, K., & Chu, C. (2009). Introduction. In K. Sanga & C. Chu (Eds.), Living and Leaving a Legacy of Hope: Stories by New Generation Pacific Leaders (pp. 10-12). NZ: He Parekereke & Victoria University of Wellington. Suaalii-Sauni, T., & Fulu-Aiolupotea, S. M. (2014). Decolonising Pacific research, building Pacific research communities, and developing Pacific research tools: The case of the talanoa and the faafaletui in Samoa. Asia Pacific Viewpoint, 55(3), 331-344. Taafaki, I., & Fowler, M. K. (2019). Clothing mats of the Marshall Islands: The history, the culture, and the weavers. US: Kindle Direct. Taufe’ulungaki, A. M. (2014). Look back to look forward: A reflective Pacific journey. In M. ‘Otunuku, U. Nabobo-Baba, S. Johansson Fua (Eds.), Of Waves, Winds, and Wonderful Things: A Decade of Rethinking Pacific Education (pp. 1-15). Fiji: USP Press. Thaman, K. H. (1995). Concepts of learning, knowledge and wisdom in Tonga, and their relevance to modern education. Prospects, 25(4), 723-733. Thaman, K. H. (1997). Reclaiming a place: Towards a Pacific concept of education for cultural development. The Journal of the Polynesian Society, 106(2), 119-130. Thiong’o, N. W. (1986). Decolonising the mind: The politics of language in African literature. Kenya: East African Educational Publishers. Vaioleti, T. (2006). Talanoa research methodology: A developing position on Pacific research. Waikato Journal of Education, 12, 21-34. Walsh, J. M., Heine, H. C., Bigler, C. M., & Stege, M. (2012). Etto nan raan kein: A Marshall Islands history (First Edition). China: Bess Press.

APA, Harvard, Vancouver, ISO, and other styles

11

Brien, Donna Lee. "Bringing a Taste of Abroad to Australian Readers: Australian Wines & Food Quarterly 1956–1960." M/C Journal 19, no.5 (October13, 2016). http://dx.doi.org/10.5204/mcj.1145.

Full text

Abstract:

IntroductionFood Studies is a relatively recent area of research enquiry in Australia and Magazine Studies is even newer (Le Masurier and Johinke), with the consequence that Australian culinary magazines are only just beginning to be investigated. Moreover, although many major libraries have not thought such popular magazines worthy of sustained collection (Fox and Sornil), considering these publications is important. As de Certeau argues, it can be of considerable consequence to identify and analyse everyday practices (such as producing and reading popular magazines) that seem so minor and insignificant as to be unworthy of notice, as these practices have the ability to affect our lives. It is important in this case as these publications were part of the post-war gastronomic environment in Australia in which national tastes in domestic cookery became radically internationalised (Santich). To further investigate Australian magazines, as well as suggesting how these cosmopolitan eating habits became more widely embraced, this article will survey the various ways in which the idea of “abroad” is expressed in one Australian culinary serial from the post-war period, Australian Wines & Food Quarterly magazine, which was published from 1956 to 1960. The methodological approach taken is an historically-informed content analysis (Krippendorff) of relevant material from these magazines combined with germane media data (Hodder). All issues in the serial’s print run have been considered.Australian Post-War Culinary PublishingTo date, studies of 1950s writing in Australia have largely focused on literary and popular fiction (Johnson-Wood; Webby) and literary criticism (Bird; Dixon; Lee). There have been far fewer studies of non-fiction writing of any kind, although some serial publications from this time have attracted some attention (Bell; Lindesay; Ross; Sheridan; Warner-Smith; White; White). In line with studies internationally, groundbreaking work in Australian food history has focused on cookbooks, and includes work by Supski, who notes that despite the fact that buying cookbooks was “regarded as a luxury in the 1950s” (87), such publications were an important information source in terms of “developing, consolidating and extending foodmaking knowledge” at that time (85).It is widely believed that changes to Australian foodways were brought about by significant post-war immigration and the recipes and dishes these immigrants shared with neighbours, friends, and work colleagues and more widely afield when they opened cafes and restaurants (Newton; Newton; Manfredi). Although these immigrants did bring new culinary flavours and habits with them, the overarching rhetoric guiding population policy at this time was assimilation, with migrants expected to abandon their culture, language, and habits in favour of the dominant British-influenced ways of living (Postiglione). While migrants often did retain their foodways (Risson), the relationship between such food habits and the increasingly cosmopolitan Australian food culture is much more complex than the dominant cultural narrative would have us believe. It has been pointed out, for example, that while the haute cuisine of countries such as France, Italy, and Germany was much admired in Australia and emulated in expensive dining (Brien and Vincent), migrants’ own preference for their own dishes instead of Anglo-Australian choices, was not understood (Postiglione). Duruz has added how individual diets are eclectic, “multi-layered and hybrid” (377), incorporating foods from both that person’s own background with others available for a range of reasons including availability, cost, taste, and fashion. In such an environment, popular culinary publishing, in terms of cookbooks, specialist magazines, and recipe and other food-related columns in general magazines and newspapers, can be posited to be another element contributing to this change.Australian Wines & Food QuarterlyAustralian Wines & Food Quarterly (AWFQ) is, as yet, a completely unexamined publication, and there appears to be only three complete sets of this magazine held in public collections. It is important to note that, at the time it was launched in the mid-1950s, food writing played a much less significant part in Australian popular publishing than it does today, with far fewer cookbooks released than today, and women’s magazines and the women’s pages of newspapers containing only small recipe sections. In this environment, a new specialist culinary magazine could be seen to be timely, an audacious gamble, or both.All issues of this magazine were produced and printed in, and distributed from, Melbourne, Australia. Although no sales or distribution figures are available, production was obviously a struggle, with only 15 issues published before the magazine folded at the end of 1960. The title of the magazine changed over this time, and issue release dates are erratic, as is the method in which volumes and issues are numbered. Although the number of pages varied from 32 up to 52, and then less once again, across the magazine’s life, the price was steadily reduced, ending up at less than half the original cover price. All issues were produced and edited by Donald Wallace, who also wrote much of the content, with contributions from family members, including his wife, Mollie Wallace, to write, illustrate, and produce photographs for the magazine.When considering the content of the magazine, most is quite familiar in culinary serials today, although AWFQ’s approach was radically innovative in Australia at this time when cookbooks, women’s magazines, and newspaper cookery sections focused on recipes, many of which were of cakes, biscuits, and other sweet baking (Bannerman). AWFQ not only featured many discursive essays and savory meals, it also featured much wine writing and review-style content as well as information about restaurant dining in each issue.Wine-Related ContentWine is certainly the most prominent of the content areas, with most issues of the magazine containing more wine-related content than any other. Moreover, in the early issues, most of the food content is about preparing dishes and/or meals that could be consumed alongside wines, although the proportion of food content increases as the magazine is published. This wine-related content takes a clearly international perspective on this topic. While many articles and advertisements, for example, narrate the long history of Australian wine growing—which goes back to early 19th century—these articles argue that Australia's vineyards and wineries measure up to international, and especially French, examples. In one such example, the author states that: “from the earliest times Australia’s wines have matched up to world standard” (“Wine” 25). This contest can be situated in Australia, where a leading restaurant (Caprice in Sydney) could be seen to not only “match up to” but also, indeed to, “challenge world standards” by serving Australian wines instead of imports (“Sydney” 33). So good, indeed, are Australian wines that when foreigners are surprised by their quality, this becomes newsworthy. This is evidenced in the following excerpt: “Nearly every English businessman who has come out to Australia in the last ten years … has diverted from his main discussion to comment on the high quality of Australian wine” (Seppelt, 3). In a similar nationalist vein, many articles feature overseas experts’ praise of Australian wines. Thus, visiting Italian violinist Giaconda de Vita shows a “keen appreciation of Australian wines” (“Violinist” 30), British actor Robert Speaight finds Grange Hermitage “an ideal wine” (“High Praise” 13), and the Swedish ambassador becomes their advocate (Ludbrook, “Advocate”).This competition could also be located overseas including when Australian wines are served at prestigious overseas events such as a dinner for members of the Overseas Press Club in New York (Australian Wines); sold from Seppelt’s new London cellars (Melbourne), or the equally new Australian Wine Centre in Soho (Australia Will); or, featured in exhibitions and promotions such as the Lausanne Trade Fair (Australia is Guest;“Wines at Lausanne), or the International Wine Fair in Yugoslavia (Australia Wins).Australia’s first Wine Festival was held in Melbourne in 1959 (Seppelt, “Wine Week”), the joint focus of which was the entertainment and instruction of the some 15,000 to 20,000 attendees who were expected. At its centre was a series of free wine tastings aiming to promote Australian wines to the “professional people of the community, as well as the general public and the housewife” (“Melbourne” 8), although admission had to be recommended by a wine retailer. These tastings were intended to build up the prestige of Australian wine when compared to international examples: “It is the high quality of our wines that we are proud of. That is the story to pass on—that Australian wine, at its best, is at least as good as any in the world and better than most” (“Melbourne” 8).There is also a focus on promoting wine drinking as a quotidian habit enjoyed abroad: “We have come a long way in less than twenty years […] An enormous number of husbands and wives look forward to a glass of sherry when the husband arrives home from work and before dinner, and a surprising number of ordinary people drink table wine quite un-selfconsciously” (Seppelt, “Advance” 3). However, despite an acknowledged increase in wine appreciation and drinking, there is also acknowledgement that this there was still some way to go in this aim as, for example, in the statement: “There is no reason why the enjoyment of table wines should not become an Australian custom” (Seppelt, “Advance” 4).The authority of European experts and European habits is drawn upon throughout the publication whether in philosophically-inflected treatises on wine drinking as a core part of civilised behaviour, or practically-focused articles about wine handling and serving (Keown; Seabrook; “Your Own”). Interestingly, a number of Australian experts are also quoted as stressing that these are guidelines, not strict rules: Crosby, for instance, states: “There is no ‘right wine.’ The wine to drink is the one you like, when and how you like it” (19), while the then-manager of Lindemans Wines is similarly reassuring in his guide to entertaining, stating that “strict adherence to the rules is not invariably wise” (Mackay 3). Tingey openly acknowledges that while the international-style of regularly drinking wine had “given more dignity and sophistication to the Australian way of life” (35), it should not be shrouded in snobbery.Food-Related ContentThe magazine’s cookery articles all feature international dishes, and certain foreign foods, recipes, and ways of eating and dining are clearly identified as “gourmet”. Cheese is certainly the most frequently mentioned “gourmet” food in the magazine, and is featured in every issue. These articles can be grouped into the following categories: understanding cheese (how it is made and the different varieties enjoyed internationally), how to consume cheese (in relation to other food and specific wines, and in which particular parts of a meal, again drawing on international practices), and cooking with cheese (mostly in what can be identified as “foreign” recipes).Some of this content is produced by Kraft Foods, a major advertiser in the magazine, and these articles and recipes generally focus on urging people to eat more, and varied international kinds of cheese, beyond the ubiquitous Australian cheddar. In terms of advertorials, both Kraft cheeses (as well as other advertisers) are mentioned by brand in recipes, while the companies are also profiled in adjacent articles. In the fourth issue, for instance, a full-page, infomercial-style advertisement, noting the different varieties of Kraft cheese and how to serve them, is published in the midst of a feature on cooking with various cheeses (“Cooking with Cheese”). This includes recipes for Swiss Cheese fondue and two pasta recipes: spaghetti and spicy tomato sauce, and a so-called Italian spaghetti with anchovies.Kraft’s company history states that in 1950, it was the first business in Australia to manufacture and market rindless cheese. Through these AWFQ advertisements and recipes, Kraft aggressively marketed this innovation, as well as its other new products as they were launched: mayonnaise, cheddar cheese portions, and Cracker Barrel Cheese in 1954; Philadelphia Cream Cheese, the first cream cheese to be produced commercially in Australia, in 1956; and, Coon Cheese in 1957. Not all Kraft products were seen, however, as “gourmet” enough for such a magazine. Kraft’s release of sliced Swiss Cheese in 1957, and processed cheese slices in 1959, for instance, both passed unremarked in either the magazine’s advertorial or recipes.An article by the Australian Dairy Produce Board urging consumers to “Be adventurous with Cheese” presented general consumer information including the “origin, characteristics and mode of serving” cheese accompanied by a recipe for a rich and exotic-sounding “Wine French Dressing with Blue Cheese” (Kennedy 18). This was followed in the next issue by an article discussing both now familiar and not-so familiar European cheese varieties: “Monterey, Tambo, Feta, Carraway, Samsoe, Taffel, Swiss, Edam, Mozzarella, Pecorino-Romano, Red Malling, Cacio Cavallo, Blue-Vein, Roman, Parmigiano, Kasseri, Ricotta and Pepato” (“Australia’s Natural” 23). Recipes for cheese fondues recur through the magazine, sometimes even multiple times in the same issue (see, for instance, “Cooking With Cheese”; “Cooking With Wine”; Pain). In comparison, butter, although used in many AWFQ’s recipes, was such a common local ingredient at this time that it was only granted one article over the entire run of the magazine, and this was largely about the much more unusual European-style unsalted butter (“An Expert”).Other international recipes that were repeated often include those for pasta (always spaghetti) as well as mayonnaise made with olive oil. Recurring sweets and desserts include sorbets and zabaglione from Italy, and flambéd crepes suzettes from France. While tabletop cooking is the epitome of sophistication and described as an international technique, baked Alaska (ice cream nestled on liquor-soaked cake, and baked in a meringue shell), hailing from America, is the most featured recipe in the magazine. Asian-inspired cuisine was rarely represented and even curry—long an Anglo-Australian staple—was mentioned only once in the magazine, in an article reprinted from the South African The National Hotelier, and which included a recipe alongside discussion of blending spices (“Curry”).Coffee was regularly featured in both articles and advertisements as a staple of the international gourmet kitchen (see, for example, Bancroft). Articles on the history, growing, marketing, blending, roasting, purchase, percolating and brewing, and serving of coffee were common during the magazine’s run, and are accompanied with advertisements for Bushell’s, Robert Timms’s and Masterfoods’s coffee ranges. AWFQ believed Australia’s growing coffee consumption was the result of increased participation in quality internationally-influenced dining experiences, whether in restaurants, the “scores of colourful coffee shops opening their doors to a new generation” (“Coffee” 39), or at home (Adams). Tea, traditionally the Australian hot drink of choice, is not mentioned once in the magazine (Brien).International Gourmet InnovationsAlso featured in the magazine are innovations in the Australian food world: new places to eat; new ways to cook, including a series of sometimes quite unusual appliances; and new ways to shop, with a profile of the first American-style supermarkets to open in Australia in this period. These are all seen as overseas innovations, but highly suited to Australia. The laws then controlling the service of alcohol are also much discussed, with many calls to relax the licensing laws which were seen as inhibiting civilised dining and drinking practices. The terms this was often couched in—most commonly in relation to the Olympic Games (held in Melbourne in 1956), but also in relation to tourism in general—are that these restrictive regulations were an embarrassment for Melbourne when considered in relation to international practices (see, for example, Ludbrook, “Present”). This was at a time when the nightly hotel closing time of 6.00 pm (and the performance of the notorious “six o’clock swill” in terms of drinking behaviour) was only repealed in Victoria in 1966 (Luckins).Embracing scientific approaches in the kitchen was largely seen to be an American habit. The promotion of the use of electricity in the kitchen, and the adoption of new electric appliances (Gas and Fuel; Gilbert “Striving”), was described not only as a “revolution that is being wrought in our homes”, but one that allowed increased levels of personal expression and fulfillment, in “increas[ing] the time and resources available to the housewife for the expression of her own personality in the management of her home” (Gilbert, “The Woman’s”). This mirrors the marketing of these modes of cooking and appliances in other media at this time, including in newspapers, radio, and other magazines. This included features on freezing food, however AWFQ introduced an international angle, by suggesting that recipe bases could be pre-prepared, frozen, and then defrosted to use in a range of international cookery (“Fresh”; “How to”; Kelvinator Australia). The then-new marvel of television—another American innovation—is also mentioned in the magazine ("Changing concepts"), although other nationalities are also invoked. The history of the French guild the Confrerie de la Chaine des Roitisseurs in 1248 is, for instance, used to promote an electric spit roaster that was part of a state-of-the-art gas stove (“Always”), and there are also advertisements for such appliances as the Gaggia expresso machine (“Lets”) which draw on both Italian historical antecedence and modern science.Supermarket and other forms of self-service shopping are identified as American-modern, with Australia’s first shopping mall lauded as the epitome of utopian progressiveness in terms of consumer practice. Judged to mark “a new era in Australian retailing” (“Regional” 12), the opening of Chadstone Regional Shopping Centre in suburban Melbourne on 4 October 1960, with its 83 tenants including “giant” supermarket Dickens, and free parking for 2,500 cars, was not only “one of the most up to date in the world” but “big even by American standards” (“Regional” 12, italics added), and was hailed as a step in Australia “catching up” with the United States in terms of mall shopping (“Regional” 12). This shopping centre featured international-styled dining options including Bistro Shiraz, an outdoor terrace restaurant that planned to operate as a bistro-snack bar by day and full-scale restaurant at night, and which was said to offer diners a “Persian flavor” (“Bistro”).ConclusionAustralian Wines & Food Quarterly was the first of a small number of culinary-focused Australian publications in the 1950s and 1960s which assisted in introducing a generation of readers to information about what were then seen as foreign foods and beverages only to be accessed and consumed abroad as well as a range of innovative international ideas regarding cookery and dining. For this reason, it can be posited that the magazine, although modest in the claims it made, marked a revolutionary moment in Australian culinary publishing. As yet, only slight traces can be found of its editor and publisher, Donald Wallace. The influence of AWFQ is, however, clearly evident in the two longer-lived magazines that were launched in the decade after AWFQ folded: Australian Gourmet Magazine and The Epicurean. Although these serials had a wider reach, an analysis of the 15 issues of AWFQ adds to an understanding of how ideas of foods, beverages, and culinary ideas and trends, imported from abroad were presented to an Australian readership in the 1950s, and contributed to how national foodways were beginning to change during that decade.ReferencesAdams, Jillian. “Australia’s American Coffee Culture.” Australian Journal of Popular Culture 2.1 (2012): 23–36.“Always to Roast on a Turning Spit.” The Magazine of Good Living: Australian Wines and Food 4.2 (1960): 17.“An Expert on Butter.” The Magazine of Good Living: The Australian Wine & Food 4.1 (1960): 11.“Australia Is Guest Nation at Lausanne.” The Magazine of Good Living: Australian Wines and Food 4.2 (1960): 18–19.“Australia’s Natural Cheeses.” The Magazine of Good Living: The Australian Wine & Food 4.1 (1960): 23.“Australia Will Be There.” The Magazine of Good Living: Australian Wines and Food 4.2 (1960): 14.“Australian Wines Served at New York Dinner.” Australian Wines & Food Quarterly 1.5 (1958): 16.“Australia Wins Six Gold Medals.” Australian Wines & Food: The Magazine of Good Living 2.11 (1959/1960): 3.Bancroft, P.A. “Let’s Make Some Coffee.” The Magazine of Good Living: The Australian Wine & Food 4.1 (1960): 10. Bannerman, Colin. Seed Cake and Honey Prawns: Fashion and Fad in Australian Food. Canberra: National Library of Australia, 2008.Bell, Johnny. “Putting Dad in the Picture: Fatherhood in the Popular Women’s Magazines of 1950s Australia.” Women's History Review 22.6 (2013): 904–929.Bird, Delys, Robert Dixon, and Christopher Lee. Eds. Authority and Influence: Australian Literary Criticism 1950-2000. Brisbane: U of Queensland P, 2001.“Bistro at Chadstone.” The Magazine of Good Living 4.3 (1960): 3.Brien, Donna Lee. “Powdered, Essence or Brewed? Making and Cooking with Coffee in Australia in the 1950s and 1960s.” M/C Journal 15.2 (2012). 20 July 2016 <http://journal.media-culture.org.au/index.php/mcjournal/article/view/475>.Brien, Donna Lee, and Alison Vincent. “Oh, for a French Wife? Australian Women and Culinary Francophilia in Post-War Australia.” Lilith: A Feminist History Journal 22 (2016): 78–90.De Certeau, Michel. The Practice of Everyday Life. Berkeley: U of California P, 1998.“Changing Concepts of Cooking.” Australian Wines & Food 2.11 (1958/1959): 18-19.“Coffee Beginnings.” Australian Wines & Food Quarterly 1.4 (1957/1958): 37–39.“Cooking with Cheese.” Australian Wines & Food Quarterly 1.4 (1957/1958): 25–28.“Cooking with Wine.” Australian Wines & Food: The Magazine of Good Living 2.11 (1959/1960): 24–30.Crosby, R.D. “Wine Etiquette.” Australian Wines & Food Quarterly 1.4 (1957/1958): 19–21.“Curry and How to Make It.” Australian Wines & Food Quarterly 1.2 (1957): 32.Duruz, Jean. “Rewriting the Village: Geographies of Food and Belonging in Clovelly, Australia.” Cultural Geographies 9 (2002): 373–388.Fox, Edward A., and Ohm Sornil. “Digital Libraries.” Encyclopedia of Computer Science. 4th ed. Eds. Anthony Ralston, Edwin D. Reilly, and David Hemmendinger. London: Nature Publishing Group, 2000. 576–581.“Fresh Frozen Food.” Australian Wines & Food: The Magazine of Good Living 2.8 (1959): 8.Gas and Fuel Corporation of Victoria. “Wine Makes the Recipe: Gas Makes the Dish.” Advertisement. Australian Wines & Food Quarterly 1.3 (1957): 34.Gilbert, V.J. “Striving for Perfection.” The Magazine of Good Living: The Australian Wine & Food 4.1 (1960): 6.———. “The Woman’s Workshop.” The Magazine of Good Living: The Australian Wines & Food 4.2 (1960): 22.“High Praise for Penfolds Claret.” The Magazine of Good Living: The Australian Wine & Food 4.1 (1960): 13.Hodder, Ian. The Interpretation of Documents and Material Culture. Thousand Oaks, CA.: Sage, 1994.“How to Cook Frozen Meats.” Australian Wines & Food: The Magazine of Good Living 2.8 (1959): 19, 26.Johnson-Woods, Toni. Pulp: A Collector’s Book of Australian Pulp Fiction Covers. Canberra: National Library of Australia, 2004.Kelvinator Australia. “Try Cooking the Frozen ‘Starter’ Way.” Australian Wines & Food: The Magazine of Good Living 2.9 (1959): 10–12.Kennedy, H.E. “Be Adventurous with Cheese.” The Magazine of Good Living: The Australian Wine & Food 3.12 (1960): 18–19.Keown, K.C. “Some Notes on Wine.” The Magazine of Good Living: The Australian Wine & Food 4.1 (1960): 32–33.Krippendorff, Klaus. Content Analysis: An Introduction to Its Methodology. 2nd ed. Thousand Oaks, CA: Sage, 2004.“Let’s Make Some Coffee.” The Magazine of Good Living: The Australian Wines and Food 4.2: 23.Lindesay, Vance. The Way We Were: Australian Popular Magazines 1856–1969. Melbourne: Oxford UP, 1983.Luckins, Tanja. “Pigs, Hogs and Aussie Blokes: The Emergence of the Term “Six O’clock Swill.”’ History Australia 4.1 (2007): 8.1–8.17.Ludbrook, Jack. “Advocate for Australian Wines.” The Magazine of Good Living: Australian Wines and Food 4.2 (1960): 3–4.Ludbrook, Jack. “Present Mixed Licensing Laws Harm Tourist Trade.” Australian Wines & Food: The Magazine of Good Living 2.9 (1959): 14, 31.Kelvinator Australia. “Try Cooking the Frozen ‘Starter’ Way.” Australian Wines & Food: The Magazine of Good Living 2.9 (1959): 10–12.Mackay, Colin. “Entertaining with Wine.” Australian Wines &Foods Quarterly 1.5 (1958): 3–5.Le Masurier, Megan, and Rebecca Johinke. “Magazine Studies: Pedagogy and Practice in a Nascent Field.” TEXT Special Issue 25 (2014). 20 July 2016 <http://www.textjournal.com.au/speciss/issue25/LeMasurier&Johinke.pdf>.“Melbourne Stages Australia’s First Wine Festival.” Australian Wines & Food: The Magazine of Good Living 2.10 (1959): 8–9.Newton, John, and Stefano Manfredi. “Gottolengo to Bonegilla: From an Italian Childhood to an Australian Restaurant.” Convivium 2.1 (1994): 62–63.Newton, John. Wogfood: An Oral History with Recipes. Sydney: Random House, 1996.Pain, John Bowen. “Cooking with Wine.” Australian Wines & Food Quarterly 1.3 (1957): 39–48.Postiglione, Nadia.“‘It Was Just Horrible’: The Food Experience of Immigrants in 1950s Australia.” History Australia 7.1 (2010): 09.1–09.16.“Regional Shopping Centre.” The Magazine of Good Living: Australian Wines and Food 4.2 (1960): 12–13.Risson, Toni. Aphrodite and the Mixed Grill: Greek Cafés in Twentieth-Century Australia. Ipswich, Qld.: T. Risson, 2007.Ross, Laurie. “Fantasy Worlds: The Depiction of Women and the Mating Game in Men’s Magazines in the 1950s.” Journal of Australian Studies 22.56 (1998): 116–124.Santich, Barbara. Bold Palates: Australia’s Gastronomic Heritage. Kent Town: Wakefield P, 2012.Seabrook, Douglas. “Stocking Your Cellar.” Australian Wines & Foods Quarterly 1.3 (1957): 19–20.Seppelt, John. “Advance Australian Wine.” Australian Wines & Foods Quarterly 1.3 (1957): 3–4.Seppelt, R.L. “Wine Week: 1959.” Australian Wines & Food: The Magazine of Good Living 2.10 (1959): 3.Sheridan, Susan, Barbara Baird, Kate Borrett, and Lyndall Ryan. (2002) Who Was That Woman? The Australian Women’s Weekly in the Postwar Years. Sydney: UNSW P, 2002.Supski, Sian. “'We Still Mourn That Book’: Cookbooks, Recipes and Foodmaking Knowledge in 1950s Australia.” Journal of Australian Studies 28 (2005): 85–94.“Sydney Restaurant Challenges World Standards.” Australian Wines & Food Quarterly 1.4 (1957/1958): 33.Tingey, Peter. “Wineman Rode a Hobby Horse.” Australian Wines & Food: The Magazine of Good Living 2.9 (1959): 35.“Violinist Loves Bach—and Birds.” The Magazine of Good Living: The Australian Wine & Food 3.12 (1960): 30.Wallace, Donald. Ed. Australian Wines & Food Quarterly. Magazine. Melbourne: 1956–1960.Warner-Smith, Penny. “Travel, Young Women and ‘The Weekly’, 1959–1968.” Annals of Leisure Research 3.1 (2000): 33–46.Webby, Elizabeth. The Cambridge Companion to Australian Literature. Cambridge: Cambridge UP, 2000.White, Richard. “The Importance of Being Man.” Australian Popular Culture. Eds. Peter Spearritt and David Walker. Sydney: Allen & Unwin, 1979. 145–169.White, Richard. “The Retreat from Adventure: Popular Travel Writing in the 1950s.” Australian Historical Studies 109 (1997): 101–103.“Wine: The Drink for the Home.” Australian Wines & Food Quarterly 2.10 (1959): 24–25.“Wines at the Lausanne Trade Fair.” The Magazine of Good Living: Australian Wines and Food 4.2 (1960): 15.“Your Own Wine Cellar” Australian Wines & Food Quarterly 1.2 (1957): 19–20.

APA, Harvard, Vancouver, ISO, and other styles

12

Lambert, Anthony. "Rainbow Blindness: Same-Sex Partnerships in Post-Coalitional Australia." M/C Journal 13, no.6 (November17, 2010). http://dx.doi.org/10.5204/mcj.318.

Full text

Abstract:

In Australia the “intimacy” of citizenship (Berlant 2), is often used to reinforce subscription to heteronormative romantic and familial structures. Because this framing promotes discourses of moral failure, recent political attention to sexuality and same-sex couples can be filtered through insights into coalitional affiliations. This paper uses contemporary shifts in Australian politics and culture to think through the concept of coalition, and in particular to analyse connections between sexuality and governmentality (or more specifically normative bias and same-sex relationships) in what I’m calling post-coalitional Australia. Against the unpredictability of changing parties and governments, allegiances and alliances, this paper suggests the continuing adherence to a heteronormatively arranged public sphere. After the current Australian Prime Minister Julia Gillard deposed the previous leader, Kevin Rudd, she clung to power with the help of independents and the Greens, and clichés of a “rainbow coalition” and a “new paradigm” were invoked to describe the confused electorate and governmental configuration. Yet in 2007, a less confused Australia decisively threw out the Howard–led Liberal and National Party coalition government after eleven years, in favour of Rudd’s own rainbow coalition: a seemingly invigorated party focussed on gender equity, Indigenous Australians, multi-cultural visibility, workplace relations, Austral-Asian relations, humane refugee processing, the environment, and the rights and obligations of same-sex couples. A post-coalitional Australia invokes something akin to “aftermath culture” (Lambert and Simpson), referring not just to Rudd’s fall or Howard’s election loss, but to the broader shifting contexts within which most Australian citizens live, and within which they make sense of the terms “Australia” and “Australian”. Contemporary Australia is marked everywhere by cracks in coalitions and shifts in allegiances and belief systems – the Coalition of the Willing falling apart, the coalition government crushed by defeat, deposed leaders, and unlikely political shifts and (re)alignments in the face of a hung parliament and renewed pushes toward moral and cultural change. These breakdowns in allegiances are followed by swift symbolically charged manoeuvres. Gillard moved quickly to repair relations with mining companies damaged by Rudd’s plans for a mining tax and to water down frustration with the lack of a sustainable Emissions Trading Scheme. And one of the first things Kevin Rudd did as Prime Minister was to change the fittings and furnishings in the Prime Ministerial office, of which Wright observed that “Mr Howard is gone and Prime Minister Kevin Rudd has moved in, the Parliament House bureaucracy has ensured all signs of the old-style gentlemen's club… have been banished” (The Age, 5 Dec. 2007). Some of these signs were soon replaced by Ms. Gillard herself, who filled the office in turn with memorabilia from her beloved Footscray, an Australian Rules football team. In post-coalitional Australia the exile of the old Menzies’ desk and a pair of Chesterfield sofas works alongside the withdrawal of troops from Iraq and renewed pledges for military presence in Afghanistan, apologising to stolen generations of Indigenous Australians, the first female Governor General, deputy Prime Minister and then Prime Minister (the last two both Gillard), the repealing of disadvantageous workplace reform, a focus on climate change and global warming (with limited success as stated), a public, mandatory paid maternity leave scheme, changes to the processing and visas of refugees, and the amendments to more than one hundred laws that discriminate against same sex couples by the pre-Gillard, Rudd-led Labor government. The context for these changes was encapsulated in an announcement from Rudd, made in March 2008: Our core organising principle as a Government is equality of opportunity. And advancing people and their opportunities in life, we are a Government which prides itself on being blind to gender, blind to economic background, blind to social background, blind to race, blind to sexuality. (Rudd, “International”) Noting the political possibilities and the political convenience of blindness, this paper navigates the confusing context of post-coalitional Australia, whilst proffering an understanding of some of the cultural forces at work in this age of shifting and unstable alliances. I begin by interrogating the coalitional impulse post 9/11. I do this by connecting public coalitional shifts to the steady withdrawal of support for John Howard’s coalition, and movement away from George Bush’s Coalition of the Willing and the War on Terror. I then draw out a relationship between the rise and fall of such affiliations and recent shifts within government policy affecting same-sex couples, from former Prime Minister Howard’s amendments to The Marriage Act 1961 to the Rudd-Gillard administration’s attention to the discrimination in many Australian laws. Sexual Citizenship and Coalitions Rights and entitlements have always been constructed and managed in ways that live out understandings of biopower and social death (Foucault History; Discipline). The disciplining of bodies, identities and pleasures is so deeply entrenched in government and law that any non-normative claim to rights requires the negotiation of existing structures. Sexual citizenship destabilises the post-coalitional paradigm of Australian politics (one of “equal opportunity” and consensus) by foregrounding the normative biases that similarly transcend partisan politics. Sexual citizenship has been well excavated in critical work from Evans, Berlant, Weeks, Richardson, and Bell and Binnie’s The Sexual Citizen which argues that “many of the current modes of the political articulation of sexual citizenship are marked by compromise; this is inherent in the very notion itself… the twinning of rights with responsibilities in the logic of citizenship is another way of expressing compromise… Every entitlement is freighted with a duty” (2-3). This logic extends to political and economic contexts, where “natural” coalition refers primarily to parties, and in particular those “who have powerful shared interests… make highly valuable trades, or who, as a unit, can extract significant value from others without much risk of being split” (Lax and Sebinius 158). Though the term is always in some way politicised, it need not refer only to partisan, multiparty or multilateral configurations. The subscription to the norms (or normativity) of a certain familial, social, religious, ethnic, or leisure groups is clearly coalitional (as in a home or a front, a club or a team, a committee or a congregation). Although coalition is interrogated in political and social sciences, it is examined frequently in mathematical game theory and behavioural psychology. In the former, as in Axelrod’s The Evolution of Cooperation, it refers to people (or players) who collaborate to successfully pursue their own self-interests, often in the absence of central authority. In behavioural psychology the focus is on group formations and their attendant strategies, biases and discriminations. Experimental psychologists have found “categorizing individuals into two social groups predisposes humans to discriminate… against the outgroup in both allocation of resources and evaluation of conduct” (Kurzban, Tooby and Cosmides 15387). The actions of social organisation (and not unseen individual, supposedly innate impulses) reflect the cultural norms in coalitional attachments – evidenced by the relationship between resources and conduct that unquestioningly grants and protects the rights and entitlements of the larger, heteronormatively aligned “ingroup”. Terror Management Particular attention has been paid to coalitional formations and discriminatory practices in America and the West since September 11, 2001. Terror Management Theory or TMT (Greenberg, Pyszczynski and Solomon) has been the main framework used to explain the post-9/11 reassertion of large group identities along ideological, religious, ethnic and violently nationalistic lines. Psychologists have used “death-related stimuli” to explain coalitional mentalities within the recent contexts of globalised terror. The fear of death that results in discriminatory excesses is referred to as “mortality salience”, with respect to the highly visible aspects of terror that expose people to the possibility of their own death or suffering. Naverette and Fessler find “participants… asked to contemplate their own deaths exhibit increases in positive evaluations of people whose attitudes and values are similar to their own, and derogation of those holding dissimilar views” (299). It was within the climate of post 9/11 “mortality salience” that then Prime Minister John Howard set out to change The Marriage Act 1961 and the Family Law Act 1975. In 2004, the Government modified the Marriage Act to eliminate flexibility with respect to the definition of marriage. Agitation for gay marriage was not as noticeable in Australia as it was in the U.S where Bush publicly rejected it, and the UK where the Civil Union Act 2004 had just been passed. Following Bush, Howard’s “queer moral panic” seemed the perfect decoy for the increased scrutiny of Australia’s involvement in the Iraq war. Howard’s changes included outlawing adoption for same-sex couples, and no recognition for legal same-sex marriages performed in other countries. The centrepiece was the wording of The Marriage Amendment Act 2004, with marriage now defined as a union “between a man and a woman to the exclusion of all others”. The legislation was referred to by the Australian Greens Senator Bob Brown as “hateful”, “the marriage discrimination act” and the “straight Australia policy” (Commonwealth 26556). The Labor Party, in opposition, allowed the changes to pass (in spite of vocal protests from one member) by concluding the legal status of same-sex relations was in no way affected, seemingly missing (in addition to the obvious symbolic and physical discrimination) the equation of same-sex recognition with terror, terrorism and death. Non-normative sexual citizenship was deployed as yet another form of “mortality salience”, made explicit in Howard’s description of the changes as necessary in protecting the sanctity of the “bedrock institution” of marriage and, wait for it, “providing for the survival of the species” (Knight, 5 Aug. 2003). So two things seem to be happening here: the first is that when confronted with the possibility of their own death (either through terrorism or gay marriage) people value those who are most like them, joining to devalue those who aren’t; the second is that the worldview (the larger religious, political, social perspectives to which people subscribe) becomes protection from the potential death that terror/queerness represents. Coalition of the (Un)willing Yet, if contemporary coalitions are formed through fear of death or species survival, how, for example, might these explain the various forms of risk-taking behaviours exhibited within Western democracies targeted by such terrors? Navarette and Fessler (309) argue that “affiliation defences are triggered by a wider variety of threats” than “existential anxiety” and that worldviews are “in turn are reliant on ‘normative conformity’” (308) or “normative bias” for social benefits and social inclusions, because “a normative orientation” demonstrates allegiance to the ingroup (308-9). Coalitions are founded in conformity to particular sets of norms, values, codes or belief systems. They are responses to adaptive challenges, particularly since September 11, not simply to death but more broadly to change. In troubled times, coalitions restore a shared sense of predictability. In Howard’s case, he seemed to say, “the War in Iraq is tricky but we have a bigger (same-sex) threat to deal with right now. So trust me on both fronts”. Coalitional change as reflective of adaptive responses thus serves the critical location of subsequent shifts in public support. Before and since September 11 Australians were beginning to distinguish between moderation and extremism, between Christian fundamentalism and productive forms of nationalism. Howard’s unwavering commitment to the American-led war in Iraq saw Australia become a member of another coalition: the Coalition of the Willing, a post 1990s term used to describe militaristic or humanitarian interventions in certain parts of the world by groups of countries. Howard (in Pauly and Lansford 70) committed Australia to America’s fight but also to “civilization's fight… of all who believe in progress and pluralism, tolerance and freedom”. Although Bush claimed an international balance of power and influence within the coalition (94), some countries refused to participate, many quickly withdrew, and many who signed did not even have troops. In Australia, the war was never particularly popular. In 2003, forty-two legal experts found the war contravened International Law as well as United Nations and Geneva conventions (Sydney Morning Herald 26 Feb. 2003). After the immeasurable loss of Iraqi life, and as the bodies of young American soldiers (and the occasional non-American) began to pile up, the official term “coalition of the willing” was quietly abandoned by the White House in January of 2005, replaced by a “smaller roster of 28 countries with troops in Iraq” (ABC News Online 22 Jan. 2005). The coalition and its larger war on terror placed John Howard within the context of coalitional confusion, that when combined with the domestic effects of economic and social policy, proved politically fatal. The problem was the unclear constitution of available coalitional configurations. Howard’s continued support of Bush and the war in Iraq compounded with rising interest rates, industrial relations reform and a seriously uncool approach to the environment and social inclusion, to shift perceptions of him from father of the nation to dangerous, dithery and disconnected old man. Post-Coalitional Change In contrast, before being elected Kevin Rudd sought to reframe Australian coalitional relationships. In 2006, he positions the Australian-United States alliance outside of the notion of military action and Western territorial integrity. In Rudd-speak the Howard-Bush-Blair “coalition of the willing” becomes F. Scott Fitzgerald’s “willingness of the heart”. The term coalition was replaced by terms such as dialogue and affiliation (Rudd, “Friends”). Since the 2007 election, Rudd moved quickly to distance himself from the agenda of the coalition government that preceded him, proposing changes in the spirit of “blindness” toward marginality and sexuality. “Fix-it-all” Rudd as he was christened (Sydney Morning Herald 29 Sep. 2008) and his Labor government began to confront the legacies of colonial history, industrial relations, refugee detention and climate change – by apologising to Aboriginal people, timetabling the withdrawal from Iraq, abolishing the employee bargaining system Workchoices, giving instant visas and lessening detention time for refugees, and signing the Kyoto Protocol agreeing (at least in principle) to reduce green house gas emissions. As stated earlier, post-coalitional Australia is not simply talking about sudden change but an extension and a confusion of what has gone on before (so that the term resembles postcolonial, poststructural and postmodern because it carries the practices and effects of the original term within it). The post-coalitional is still coalitional to the extent that we must ask: what remains the same in the midst of such visible changes? An American focus in international affairs, a Christian platform for social policy, an absence of financial compensation for the Aboriginal Australians who received such an eloquent apology, the lack of coherent and productive outcomes in the areas of asylum and climate change, and an impenetrable resistance to the idea of same-sex marriage are just some of the ways in which these new governments continue on from the previous one. The Rudd-Gillard government’s dealings with gay law reform and gay marriage exemplify the post-coalitional condition. Emulating Christ’s relationship to “the marginalised and the oppressed”, and with Gillard at his side, Rudd understandings of the Christian Gospel as a “social gospel” (Rudd, “Faith”; see also Randell-Moon) to table changes to laws discriminating against gay couples – guaranteeing hospital visits, social security benefits and access to superannuation, resembling de-facto hetero relationships but modelled on the administering and registration of relationships, or on tax laws that speak primarily to relations of financial dependence – with particular reference to children. The changes are based on the report, Same Sex, Same Entitlements (HREOC) that argues for the social competence of queer folk, with respect to money, property and reproduction. They speak the language of an equitable economics; one that still leaves healthy and childless couples with limited recognition and advantage but increased financial obligation. Unable to marry in Australia, same-sex couples are no longer single for taxation purposes, but are now simultaneously subject to forms of tax/income auditing and governmental revenue collection should either same-sex partner require assistance from social security as if they were married. Heteronormative Coalition Queer citizens can quietly stake their economic claims and in most states discreetly sign their names on a register before becoming invisible again. Mardi Gras happens but once a year after all. On the topic of gay marriage Rudd and Gillard have deferred to past policy and to the immoveable nature of the law (and to Howard’s particular changes to marriage law). That same respect is not extended to laws passed by Howard on industrial relations or border control. In spite of finding no gospel references to Jesus the Nazarene “expressly preaching against homosexuality” (Rudd, “Faith”), and pre-election promises that territories could govern themselves with respect to same sex partnerships, the Rudd-Gillard government in 2008 pressured the ACT to reduce its proposed partnership legislation to that of a relationship register like the ones in Tasmania and Victoria, and explicitly demanded that there be absolutely no ceremony – no mimicking of the real deal, of the larger, heterosexual citizens’ “ingroup”. Likewise, with respect to the reintroduction of same-sex marriage legislation by Greens senator Sarah Hanson Young in September 2010, Gillard has so far refused a conscience vote on the issue and restated the “marriage is between a man and a woman” rhetoric of her predecessors (Topsfield, 30 Sep. 2010). At the same time, she has agreed to conscience votes on euthanasia and openly declared bi-partisan (with the federal opposition) support for the war in Afghanistan. We see now, from Howard to Rudd and now Gillard, that there are some coalitions that override political differences. As psychologists have noted, “if the social benefits of norm adherence are the ultimate cause of the individual’s subscription to worldviews, then the focus and salience of a given individual’s ideology can be expected to vary as a function of their need to ally themselves with relevant others” (Navarette and Fessler 307). Where Howard invoked the “Judaeo-Christian tradition”, Rudd chose to cite a “Christian ethical framework” (Rudd, “Faith”), that saw him and Gillard end up in exactly the same place: same sex relationships should be reduced to that of medical care or financial dependence; that a public ceremony marking relationship recognition somehow equates to “mimicking” the already performative and symbolic heterosexual institution of marriage and the associated romantic and familial arrangements. Conclusion Post-coalitional Australia refers to the state of confusion borne of a new politics of equality and change. The shift in Australia from conservative to mildly socialist government(s) is not as sudden as Howard’s 2007 federal loss or as short-lived as Gillard’s hung parliament might respectively suggest. Whilst allegiance shifts, political parties find support is reliant on persistence as much as it is on change – they decide how to buffer and bolster the same coalitions (ones that continue to privilege white settlement, Christian belief systems, heteronormative familial and symbolic practices), but also how to practice policy and social responsibility in a different way. Rudd’s and Gillard’s arguments against the mimicry of heterosexual symbolism and the ceremonial validation of same-sex partnerships imply there is one originary form of conduct and an associated sacred set of symbols reserved for that larger ingroup. Like Howard before them, these post-coalitional leaders fail to recognise, as Butler eloquently argues, “gay is to straight not as copy is to original, but as copy is to copy” (31). To make claims to status and entitlements that invoke the messiness of non-normative sex acts and romantic attachments necessarily requires the negotiation of heteronormative coalitional bias (and in some ways a reinforcement of this social power). As Bell and Binnie have rightly observed, “that’s what the hard choices facing the sexual citizen are: the push towards rights claims that make dissident sexualities fit into heterosexual culture, by demanding equality and recognition, versus the demand to reject settling for heteronormativity” (141). The new Australian political “blindness” toward discrimination produces positive outcomes whilst it explicitly reanimates the histories of oppression it seeks to redress. The New South Wales parliament recently voted to allow same-sex adoption with the proviso that concerned parties could choose not to adopt to gay couples. The Tasmanian government voted to recognise same-sex marriages and unions from outside Australia, in the absence of same-sex marriage beyond the current registration arrangements in its own state. In post-coalitional Australia the issue of same-sex partnership recognition pits parties and allegiances against each other and against themselves from within (inside Gillard’s “rainbow coalition” the Rainbow ALP group now unites gay people within the government’s own party). Gillard has hinted any new proposed legislation regarding same-sex marriage may not even come before parliament for debate, as it deals with real business. Perhaps the answer lies over the rainbow (coalition). As the saying goes, “there are none so blind as those that will not see”. References ABC News Online. “Whitehouse Scraps Coalition of the Willing List.” 22 Jan. 2005. 1 July 2007 ‹http://www.abc.net.au/news/newsitems/200501/s1286872.htm›. Axelrod, Robert. The Evolution of Cooperation. New York: Basic Books, 1984. Berlant, Lauren. The Queen of America Goes to Washington City: Essays on Sex and Citizenship. Durham: Duke University Press, 1997. Bell, David, and John Binnie. The Sexual Citizen: Queer Politics and Beyond. Cambridge, England: Polity, 2000. Butler, Judith. Gender Trouble: Feminism and the Subversion of Identity. New York: Routledge, 1990. Commonwealth of Australia. Parliamentary Debates. House of Representatives 12 Aug. 2004: 26556. (Bob Brown, Senator, Tasmania.) Evans, David T. Sexual Citizenship: The Material Construction of Sexualities. London: Routledge, 1993. Foucault, Michel. Discipline and Punish: The Birth of the Prison. Trans. A. Sheridan. London: Penguin, 1991. ———. The Will to Knowledge: The History of Sexuality. Vol. 1. Trans. Robert Hurley. London: Penguin, 1998. Greenberg, Jeff, Tom Pyszczynski, and Sheldon Solomon. “The Causes and Consequences of the Need for Self-Esteem: A Terror Management Theory.” Public Self, Private Self. Ed. Roy F. Baumeister. New York: Springer-Verlag, 1986. 189-212. Human Rights and Equal Opportunity Commission. Same-Sex: Same Entitlements Report. 2007. 21 Aug. 2007 ‹http://www.hreoc.gov.au/human_rights/samesex/report/index.html›. Kaplan, Morris. Sexual Justice: Democratic Citizenship and the Politics of Desire. New York: Routledge, 1997. Knight, Ben. “Howard and Costello Reject Gay Marriage.” ABC Online 5 Aug. 2003. Kurzban, Robert, John Tooby, and Leda Cosmides. "Can Race Be Erased? Coalitional Computation and Social Categorization." Proceedings of the National Academy of Sciences 98.26 (2001): 15387–15392. Lambert, Anthony, and Catherine Simpson. "Jindabyne’s Haunted Alpine Country: Producing (an) Australian Badland." M/C Journal 11.5 (2008). 20 Oct. 2010 ‹http://journal.media-culture.org.au/index.php/mcjournal/article/view/81›. Lax, David A., and James K. Lebinius. “Thinking Coalitionally: Party Arithmetic Process Opportunism, and Strategic Sequencing.” Negotiation Analysis. Ed. H. Peyton Young. Michigan: University of Michigan Press, 1991. 153-194. Naverette, Carlos, and Daniel Fessler. “Normative Bias and Adaptive Challenges: A Relational Approach to Coalitional Psychology and a Critique of Terror Management Theory.” Evolutionary Psychology 3 (2005): 297-325. Pauly, Robert J., and Tom Lansford. Strategic Preemption: US Foreign Policy and Second Iraq War. Aldershot: Ashgate, 2005. Randall-Moon, Holly. "Neoliberal Governmentality with a Christian Twist: Religion and Social Security under the Howard-Led Australian Government." Eds. Michael Bailey and Guy Redden. Mediating Faiths: Religion and Socio- Cultural Change in the Twenty-First Century. Farnham: Ashgate, in press. Richardson, Diane. Rethinking Sexuality. London: Sage, 2000. Rudd, Kevin. “Faith in Politics.” The Monthly 17 (2006). 31 July 2007 ‹http://www.themonthly.com.au/monthly-essays-kevin-rudd-faith-politics--300›. Rudd, Kevin. “Friends of Australia, Friends of America, and Friends of the Alliance That Unites Us All.” Address to the 15th Australian-American Leadership Dialogue. The Australian, 24 Aug. 2007. 13 Mar. 2008 ‹http://www.theaustralian.com.au/national-affairs/climate/kevin-rudds-address/story-e6frg6xf-1111114253042›. Rudd, Kevin. “Address to International Women’s Day Morning Tea.” Old Parliament House, Canberra, 11 Mar. 2008. 1 Oct. 2010 ‹http://pmrudd.archive.dpmc.gov.au/node/5900›. Sydney Morning Herald. “Coalition of the Willing? Make That War Criminals.” 26 Feb. 2003. 1 July 2007 ‹http://www.smh.com.au/articles/2003/02/25/1046064028608.html›. Topsfield, Jewel. “Gillard Rules Out Conscience Vote on Gay Marriage.” The Age 30 Sep. 2010. 1 Oct. 2010 ‹http://www.theage.com.au/national/gillard-rules-out-conscience-vote-on-gay-marriage-20100929-15xgj.html›. Weeks, Jeffrey. "The Sexual Citizen." Theory, Culture and Society 15.3-4 (1998): 35-52. Wright, Tony. “Suite Revenge on Chesterfield.” The Age 5 Dec. 2007. 4 April 2008 ‹http://www.theage.com.au/news/national/suite-revenge-on-chesterfield/2007/12/04/1196530678384.html›.

APA, Harvard, Vancouver, ISO, and other styles

13

Due, Clemence. "Laying Claim to "Country": Native Title and Ownership in the Mainstream Australian Media." M/C Journal 11, no.5 (August15, 2008). http://dx.doi.org/10.5204/mcj.62.

Full text

Abstract:

Australia in Maps is a compilation of cartography taken from the collection of over 600,000 maps held at the Australian National Library. Included in this collection are military maps, coastal maps and modern-day maps for tourists. The map of the eastern coast of ‘New Holland’ drawn by James Cook when he ‘discovered’ Australia in 1770 is included. Also published is Eddie Koiki Mabo’s map drawn on a hole-punched piece of paper showing traditional land holdings in the Murray Islands in the Torres Strait. This map became a key document in Eddie Mabo’s fight for native title recognition, a fight which became the precursor to native title rights as they are known today. The inclusion of these two drawings in a collection of maps defining Australia as a country illustrates the dichotomies and contradictions which exist in a colonial nation. It is now fifteen years since the Native Title Act 1994 (Commonwealth) was developed in response to the Mabo cases in order to recognise Indigenous customary law and traditional relationships to the land over certain (restricted) parts of Australia. It is 220 years since the First Fleet arrived and Indigenous land was (and remains) illegally possessed through the process of colonisation (Moreton-Robinson Australia). Questions surrounding ‘country’ – who owns it, has rights to use it, to live on it, to develop or protect it – are still contested and contentious today. In part, this contention arises out of the radically different conceptions of ‘country’ held by, in its simplest sense, Indigenous nations and colonisers. For Indigenous Australians the land has a spiritual significance that I, as a non-Indigenous person, cannot properly understand as a result of the different ways in which relationships to land are made available. The ways of understanding the world through which my identity as a non-Indigenous person are made intelligible, by contrast, see ‘country’ as there to be ‘developed’ and exploited. Within colonial logic, discourses of development and the productive use of resources function as what Wetherell and Potter term “rhetorically self-sufficient” in that they are principles which are considered to be beyond question (177). As Vincent Tucker states; “The myth of development is elevated to the status of natural law, objective reality and evolutionary necessity. In the process all other world views are devalued and dismissed as ‘primitive’, ‘backward’, ‘irrational’ or ‘naïve’” (1). It was this precise way of thinking which was able to justify colonisation in the first place. Australia was seen as terra nullius; an empty and un-developed land not recognized as inhabited. Indigenous people were incorrectly perceived as individuals who did not use the land in an efficient manner, rather than as individual nations who engaged with the land in ways that were not intelligible to the colonial eye. This paper considers the tensions inherent in definitions of ‘country’ and the way these tensions are played out through native title claims as white, colonial Australia attempts to recognise (and limit) Indigenous rights to land. It examines such tensions as they appear in the media as an example of how native title issues are made intelligible to the non-Indigenous general public who may otherwise have little knowledge or experience of native title issues. It has been well-documented that the news media play an important role in further disseminating those discourses which dominate in a society, and therefore frequently supports the interests of those in positions of power (Fowler; Hall et. al.). As Stuart Hall argues, this means that the media often reproduces a conservative status quo which in many cases is simply reflective of the positions held by other powerful institutions in society, in this case government, and mining and other commercial interests. This has been found to be the case in past analysis of media coverage of native title, such as work completed by Meadows (which found that media coverage of native title issues focused largely on non-Indigenous perspectives) and Hartley and McKee (who found that media coverage of native title negotiations frequently focused on bureaucratic issues rather than the rights of Indigenous peoples to oppose ‘developments’ on their land). This paper aims to build on this work, and to map the way in which native title, an ongoing issue for many Indigenous groups, figures in a mainstream newspaper at a time when there has not been much mainstream public interest in the process. In order to do this, this paper considered articles which appeared in Australia’s only national newspaper – The Australian – over the six months preceding the start of July 2008. Several main themes ran through these articles, examples of which are provided in the relevant sections. These included: economic interests in native title issues, discourses of white ownership and control of the land, and rhetorical devices which reinforced the battle-like nature of native title negotiations rather than emphasised the rights of Indigenous Australians to their lands. Native Title: Some Definitions and Some Problems The concept of native title itself can be a difficult one to grasp and therefore a brief definition is called for here. According to the National Native Title Tribunal (NNTT) website (www.nntt.gov.au), native title is the recognition by Australian law that some Indigenous people have rights and interests to their land that come from their traditional laws and customs. The native title rights and interests held by particular Indigenous people will depend on both their traditional laws and customs and what interests are held by others in the area concerned. Generally speaking, native title must give way to the rights held by others. Native title is therefore recognised as existing on the basis of certain laws and customs which have been maintained over an area of land despite the disruption caused by colonisation. As such, if native title is to be recognised over an area of country, Indigenous communities have to argue that their cultures and connection with the land have survived colonisation. As the Maori Land Court Chief Judge Joe Williams argues: In Australia the surviving title approach […] requires the Indigenous community to prove in a court or tribunal that colonisation caused them no material injury. This is necessary because, the greater the injury, the smaller the surviving bundle of rights. Communities who were forced off their land lose it. Those whose traditions and languages were beaten out of them at state sponsored mission schools lose all of the resources owned within the matrix of that language and those traditions. This is a perverse result. In reality, of course, colonisation was the greatest calamity in the history of these people on this land. Surviving title asks aboriginal people to pretend that it was not. To prove in court that colonisation caused them no material injury. Communities who were forced off their land are the same communities who are more likely to lose it. As found in previous research (Meadows), these inherent difficulties of the native title process were widely overlooked in recent media reports of native title issues published in The Australian. Due to recent suggestions made by Indigenous Affairs Minister Jenny Macklin for changes to be made to the native title system, The Australian did include reports on the need to ensure that traditional owners share the economic profits of the mining boom. This was seen in an article by Karvelas and Murphy entitled “Labor to Overhaul Native Title Law”. The article states that: Fifteen years after the passage of the historic Mabo legislation, the Rudd Government has flagged sweeping changes to native title to ensure the benefits of the mining boom flow to Aboriginal communities and are not locked up in trusts or frittered away. Indigenous Affairs Minister Jenny Macklin, delivering the third annual Eddie Mabo Lecture in Townsville, said yesterday that native title legislation was too complex and had failed to deliver money to remote Aboriginal communities, despite lucrative agreements with mining companies. (1) Whilst this passage appears supportive of Indigenous Australians in that it argues for their right to share in economic gains made through ‘developments’ on their country, the use of phrases such as ‘frittered away’ imply that Indigenous Australians have made poor use of their ‘lucrative agreements’, and therefore require further intervention in their lives in order to better manage their financial situations. Such an argument further implies that the fact that many remote Indigenous communities continue to live in poverty is the fault of Indigenous Australians’ mismanagement of funds from native title agreements rather than from governmental neglect, thereby locating the blame once more in the hands of Indigenous people rather than in a colonial system of dispossession and regulation. Whilst the extract does continue to state that native title legislation is too complex and has ‘failed to deliver money to remote Aboriginal communities’, the article does not go on to consider other areas in which native title is failing Indigenous people, such as reporting the protection of sacred and ceremonial sites, and provisions for Indigenous peoples to be consulted about developments on their land to which they may be opposed. Whilst native title agreements with companies may contain provisions for these issues, it is rare that there is any regulation for whether or not these provisions are met after an agreement is made (Faircheallaigh). These issues almost never appeared in the media which instead focused on the economic benefits (or lack thereof) stemming from the land rather than the sovereign rights of traditional owners to their country. There are many other difficulties inherent in the native title legislation for Indigenous peoples. It is worth discussing some of these difficulties as they provide an image of the ways in which ‘country’ is conceived of at the intersection of a Western legal system attempting to encompass Indigenous relations to land. The first of these difficulties relates to the way in which Indigenous people are required to delineate the boundaries of the country which they are claiming. Applications for native title over an area of land require strict outlining of boundaries for land under consideration, in accordance with a Western system of mapping country. The creation of such boundaries requires Indigenous peoples to define their country in Western terms rather than Indigenous ones, and in many cases proves quite difficult as areas of traditional lands may be unavailable to claim (Neate). Such differences in understandings of country mean that “for Indigenous peoples, the recognition of their indigenous title, should it be afforded, may bear little resemblance to, or reflect minimally on, their own conceptualisation of their relations to country” (Glaskin 67). Instead, existing as it does within a Western legal system and subject to Western determinations, native title forces Indigenous people to define themselves and their land within white conceptions of country (Moreton-Robinson Possessive). In fact, the entire concept of native title has been criticized by many Indigenous commentators as a denial of Indigenous sovereignty over the land, with the result of the Mabo case meaning that “Indigenous people did not lose their native title rights but were stripped of their sovereign rights to manage their own affairs, to live according to their own laws, and to own and control the resources on their lands” (Falk and Martin 38). As such, Falk and Martin argue that The Native Title Act amounts to a complete denial of Aboriginal sovereignty so that Indigenous people are forced to live under a colonial regime which is able to control and regulate their lives and access to country. This is commented upon by Aileen Moreton-Robinson, who writes that: What Indigenous people have been given, by way of white benevolence, is a white-constructed from of ‘Indigenous’ proprietary rights that are not epistemologically and ontologically grounded in Indigenous conceptions of sovereignty. Indigenous land ownership, under these legislative regimes, amounts to little more than a mode of land tenure that enables a circumscribed form of autonomy and governance with minimum control and ownership of resources, on or below the ground, thus entrenching economic dependence on the nation state. (Moreton-Robinson Sovereign Subjects 4) The native title laws in place in Australia restrict Indigenous peoples to existing within white frameworks of knowledge. Within the space of The Native Title Act there is no room for recognition of Indigenous sovereignty whereby Indigenous peoples can make decisions for themselves and control their own lands (Falk and Martin). These tensions within definitions of ‘country’ and sovereignty over land were reflected in the media articles examined, primarily in terms of the way in which ‘country’ was related to and used. This was evident in an article entitled “An Economic Vision” with a tag-line “Native Title Reforms offer Communities a Fresh Start”: Central to such a success story is the determination of indigenous people to help themselves. Such a business-like, forward-thinking approach is also evident in Kimberley Land Council executive director Wayne Bergmann's negotiations with some of the world's biggest resource companies […] With at least 45 per cent of Kimberley land subject to native title, Mr Bergmann, a qualified lawyer, is acutely aware of the royalties and employment potential. Communities are also benefitting from the largesse of Australia’s richest man, miner Andrew “Twiggy” Forrest, whose job training courses and other initiatives are designed to help the local people, in his words, become “wonderful participating Australians.” (15) Again, this article focuses on the economic benefits to be made from native title agreements with mining companies rather than other concerns with the use of Indigenous areas of country. The use of the quote from Forrest serves to imply that Indigenous peoples are not “wonderful participating Australians” unless they are able to contribute in an economic sense, and overlooks many contributions made by Indigenous peoples in other areas such as environmental protection. Such definitions also measure ‘success’ in Western terms rather than Indigenous ones and force Indigenous peoples into a relationship to country based on Western notions of resource extraction and profit rather than Indigenous notions of custodianship and sustainability. This construction of Indigenous economic involvement as only rendered valid on particular terms echoes findings from previous work on constructions of Indigenous people in the media, such as that by LeCouteur, Rapley and Augoustinos. Theorising ‘Country’ The examples provided above illustrate the fact that the rhetoric and dichotomies of ‘country’ are at the very heart of the native title process. The process of recognising Indigenous rights to land through native title invites the question of how ‘country’ is conceived in the first place. Goodall writes that there are tensions within definitions of ‘country’ which indicate the ongoing presence of Indigenous people’s connections to their land despite colonisation. She writes that the word ‘country’: may seem a self-evident description of rural economy and society, with associations of middle-class gentility as well as being the antonym of the city. Yet in Australia there is another dimension altogether. Aboriginal land-owners traditionally identify themselves by the name of the land for which they were the custodians. These lands are often called, in today’s Aboriginal English, their ‘country’. This gives the word a tense and resonating echo each time it is used to describe rural-settler society and land. (162) Yet the distinctions usually drawn between those defined as ‘country’ people or ‘locals’ and the traditional Indigenous people of the area suggest that, as Schlunke states, in many cases Indigenous people are “too local to be ‘local’” (43). In other words, if white belonging and rights to an area of country are to be normalised, the prior claims of traditional owners are not able to be considered. As such, Indigenous belonging becomes too confronting as it disrupts the ways in which other ‘country’ people relate to their land as legitimately theirs. In the media, constructions of ‘country’ frequently fell within a colonial definition of country which overlooked Indigenous peoples. In many of these articles land was normatively constructed as belonging to the crown or the state. This was evidenced in phrases such as, “The proceedings [of the Noongar native title claim over the South Western corner of Australia] have been watched closely by other states in the expectation they might encounter similar claims over their capital cities” (Buckley-Carr 2). Use of the word their implies that the states (which are divisions of land created by colonisation) have prior claim to ‘their’ capital cities and that they rightfully belong to the government rather than to traditional owners. Such definitions of ‘country’ reflect European rather than Indigenous notions of boundaries and possession. This is also reflected in media reports of native title in the widespread use of European names for areas of land and landmarks as opposed to their traditional Indigenous names. When the media reported on a native title claim over an area of land the European name for the country was used rather than, for example, the Indigenous name followed by a geographical description of where that land is situated. Customs such as this reflect a country which is still bound up in European definitions of land rather than Indigenous ones (Goodall 167; Schlunke 47-48), and also indicate that the media is reporting for a white audience rather than for an Indigenous one whom it would affect the most. Native title debates have also “shown the depth of belief within much of rural and regional Australia that rural space is most rightfully agricultural space” (Lockie 27). This construction of rural Australia is reflective of the broader national imagining of the country as a nation (Anderson), in which Australia is considered rich in resources from which to derive profit. Within these discourses the future of the nation is seen as lying in the ‘development’ of natural resources. As such, native title agreements with industry have often been depicted in the media as obstacles to be overcome by companies rather than a way of allowing Indigenous people control over their own lands. This often appears in the media in the form of metaphors of ‘war’ for agreements for use of Indigenous land, such as development being “frustrated” by native title (Bromby) and companies being “embattled” by native title issues (Wilson). Such metaphors illustrate the adversarial nature of native title claims both for recognition of the land in the first place and often in subsequent dealings with resource companies. This was also seen in reports of company progress which would include native title claims in a list of other factors affecting stock prices (such as weak drilling results and the price of metals), as if Indigenous claims to land were just another hurdle to profit-making (“Pilbara Lures”). Conclusion As far as the native title process is concerned, the answers to the questions considered at the start of this paper remain within Western definitions. Native title exists firmly within a Western system of law which requires Indigenous people to define and depict their land within non-Indigenous definitions and understandings of ‘country’. These debates are also frequently played out in the media in ways which reflect colonial values of using and harvesting country rather than Indigenous ones of protecting it. The media rarely consider the complexities of a system which requires Indigenous peoples to conceive of their land through boundaries and definitions not congruent with their own understandings. The issues surrounding native title draw attention to the need for alternative definitions of ‘country’ to enter the mainstream Australian consciousness. These need to encompass Indigenous understandings of ‘country’ and to acknowledge the violence of Australia’s colonial history. Similarly, the concept of native title needs to reflect Indigenous notions of country and allow traditional owners to define their land for themselves. In order to achieve these goals and overcome some of the obstacles to recognising Indigenous sovereignty over Australia the media needs to play a part in reorienting concepts of country from only those definitions which fit within a white framework of experiencing the world and prioritise Indigenous relations and experiences of country. If discourses of resource extraction were replaced with discourses of sustainability, if discourses of economic gains were replaced with respect for the land, and if discourses of white control over Indigenous lives in the form of native title reform were replaced with discourses of Indigenous sovereignty, then perhaps some ground could be made to creating an Australia which is not still in the process of colonising and denying the rights of its First Nations peoples. The tensions which exist in definitions and understandings of ‘country’ echo the tensions which exist in Australia’s historical narratives and memories. The denied knowledge of the violence of colonisation and the rights of Indigenous peoples to remain on their land all haunt a native title system which requires Indigenous Australians to minimise the effect this violence had on their lives, their families and communities and their values and customs. As Katrina Schlunke writes when she confronts the realisation that her family’s land could be the same land on which Indigenous people were massacred: “The irony of fears of losing one’s backyard to a Native Title claim are achingly rich. Isn’t something already lost to the idea of ‘Freehold Title’ when you live over unremembered graves? What is free? What are you to hold?” (151). If the rights of Indigenous Australians to their country are truly to be recognised, mainstream Australia needs to seriously consider such questions and whether or not the concept of ‘native title’ as it exists today is able to answer them. Acknowledgments I would like to thank Damien Riggs and Andrew Gorman-Murray for all their help and support with this paper, and Braden Schiller for his encouragement and help with proof-reading. I would also like to thank the anonymous referees for their insightful comments. References Anderson, Benedict. Imagined Communities. London: Verso, 1983. “An Economic Vision.” The Australian 23 May 2008. Bromby, Robin. “Areva deal fails to lift Murchison.” The Australian 30 June 2008: 33. Buckley-Carr, Alana. “Ruling on Native Title Overturned.” The Australian 24 April 2008: 2. Faircheallaigh, Ciaran. “Native Title and Agreement Making in the Mining Industry: Focusing on Outcomes for Indigenous Peoples.” Land, Rights, Laws: Issues of Native Title 2, (2004). 20 June 2008 http://ntru.aiatsis.gov.au/ntpapers/ipv2n25.pdf Falk, Philip and Gary Martin. “Misconstruing Indigenous Sovereignty: Maintaining the Fabric of Australian Law.” Sovereign Subjects: Indigenous Sovereignty Matters. Ed. Aileen Moreton-Robinson. Allen and Unwin, 2007. 33-46. Fowler, Roger. Language in the News: Discourse and Ideology in the Press. London: Routledge, 1991. Glaskin, Katie. “Native Title and the ‘Bundle of Rights’ Model: Implications for the Recognition of Aboriginal Relations to Country.” Anthropological Forum 13.1 (2003): 67-88. Goodall, Heather. “Telling Country: Memory, Modernity and Narratives in Rural Australia.” History Workshop Journal 47 (1999): 161-190. Hall, Stuart, Critcher, C., Jefferson, T., Clarke, J. and Roberts, B. Policing the Crisis: Mugging, the state, and Law and Order. London: Macmillan, 1978. Hartley, John, and Alan McKee. The Indigenous Public Sphere: The Reporting and Reception of Aboriginal Issues in the Australian Media. Oxford: Oxford UP, 2000. Karvelas, Patricia and Padraic Murphy. “Labor to Overhaul Native Title Laws.” The Australian, 22 May 2008: 1. LeCouteur, Amanda, Mark Rapley and Martha Augoustinos. “This Very Difficult Debate about Wik: Stake, Voice and the Management of Category Membership in Race Politics.” British Journal of Social Psychology 40 (2001): 35-57. Lockie, Stewart. “Crisis and Conflict: Shifting Discourses of Rural and Regional Australia.” Land of Discontent: The Dynamics of Change in Rural and Regional Australia. Ed. Bill Pritchard and Phil McManus. Kensington: UNSW P, 2000. 14-32. Meadows, Michael. “Deals and Victories: Newspaper Coverage of Native Title in Australia and Canada.” Australian Journalism Review 22.1 (2000): 81-105. Moreton-Robinson, Aileen. “I still call Australia Home: Aboriginal Belonging and Place in a White Postcolonising Nation.” Uprooting/Regrounding: Questions of Home and Migration. Eds. S Ahmed et.al. Oxford: Berg, 2003. 23-40. Moreton-Robinson, Aileen. “The Possessive Logic of Patriarchal White Sovereignty: The High Court and the Yorta Yorta Decision.” Borderlands e-Journal 3.2 (2004). 20 June 2008. http://www.borderlands.net.au/vol3no2_2004/moreton_possessive.htm Morteton-Robinson, Aileen. Ed. Sovereign Subjects: Indigenous Sovereignty Matters. Allen and Unwin, 2007. Neate, Graham. “Mapping Landscapes of the Mind: A Cadastral Conundrum in the Native Title Era.” Conference on Land Tenure and Cadastral Infrastructures for Sustainable Development, Melbourne, Australia (1999). 20 July 2008. http://www.sli.unimelb.edu.au/UNConf99/sessions/session5/neate.pdf O’Connor, Maura. Australia in Maps: Great Maps in Australia’s History from the National Library’s Collection. Canberra: National Library of Australia, 2007. “Pilbara Lures Explorer with Promise of Metal Riches.” The Australian. 28 May 2008: Finance 2. Schlunke, Katrina. Bluff Rock: An Autobiography of a Massacre. Fremantle: Curtin U Books, 2005. “The National Native Title Tribunal.” Exactly What is Native Title? 29 July 2008. http://www.nntt.gov.au/What-Is-Native-Title/Pages/What-is-Native-Title.aspx The National Native Title Tribunal Fact Sheet. What is Native Title? 29 July 2008. http://www.nntt.gov.au Path; Publications-And-Research; Publications; Fact Sheets. Tucker, Vincent. “The Myth of Development: A Critique of Eurocentric Discourse.” Critical Development Theory: Contributions to a New Paradigm. Ed. Ronaldo Munck, Denis O'Hearn. Zed Books, 1999. 1-26. Wetherell, Margaret, and Jonathan Potter. Mapping the Language of Racism: Discourse and the Legitimation of Exploitation. New York: Harvester Wheatsheaf, 1992. Williams, Joe. “Confessions of a Native Title Judge: Reflections on the Role of Transitional Justice in the Transformation of Indigeneity.” Land, Rights, Laws: Issues of Native Title 3, (2008). 20 July 2008. http://ntru.aiatsis.gov.au/publications/issue_papers.html Wilson, Nigel. “Go with the Flow.” The Australian, 29 March 2008: 1.

APA, Harvard, Vancouver, ISO, and other styles

14

Heurich, Angelika, and Jo Coghlan. "The Canberra Bubble." M/C Journal 24, no.1 (March15, 2021). http://dx.doi.org/10.5204/mcj.2749.

Full text

Abstract:

According to the ABC television program Four Corners, “Parliament House in Canberra is a hotbed of political intrigue and high tension … . It’s known as the ‘Canberra Bubble’ and it operates in an atmosphere that seems far removed from how modern Australian workplaces are expected to function.” The term “Canberra Bubble” morphed to its current definition from 2001, although it existed in other forms before this. Its use has increased since 2015, with Prime Minister Scott Morrison regularly referring to it when attempting to deflect from turmoil within, or focus on, his Coalition government (Gwynn). “Canberra Bubble” was selected as the 2018 “Word of the Year” by the Australian National Dictionary Centre, defined as “referring to the idea that federal politicians, bureaucracy, and political journalists are obsessed with the goings-on in Canberra (rather than the everyday concerns of Australians)” (Gwynn). In November 2020, Four Corners aired an investigation into the behaviour of top government ministers, including Attorney-General Christian Porter, Minister Alan Tudge, and former Deputy Prime Minister and leader of the National Party Barnaby Joyce; entitled “Inside the Canberra Bubble”. The program’s reporter, Louise Milligan, observed: there’s a strong but unofficial tradition in federal politics of what happens in Canberra, stays in Canberra. Politicians, political staff and media operate in what’s known as ‘The Canberra Bubble’. Along with the political gamesmanship, there’s a heady, permissive culture and that culture can be toxic for women. The program acknowledged that parliamentary culture included the belief that politicians’ private lives were not open to public scrutiny. However, this leaves many women working in Parliament House feeling that such silence allows inappropriate behaviour and sexism to “thrive” in the “culture of silence” (Four Corners). Former Prime Minister Malcolm Turnbull, who was interviewed for the Four Corners program, acknowledged: “there is always a power imbalance between the boss and somebody who works for them, the younger and more junior they are, the more extreme that power imbalance is. And of course, Ministers essentially have the power to hire and fire their staff, so they’ve got enormous power.” He equates this to past culture in large corporations; a culture that has seen changes in business, but not in the federal parliament. It is the latter place that is a toxic bubble for women. A Woman Problem in the Bubble Louise Milligan reported: “the Liberal Party has been grappling with what’s been described as a ‘women problem’ for several years, with accusations of endemic sexism.” The underrepresentation of women in the current government sees them holding only seven of the 30 current ministerial positions. The Liberal Party has fewer women in the House of Representatives now than it did 20 years ago, while the Labor Party has doubled the number of women in its ranks. When asked his view on the “woman problem”, Malcolm Turnbull replied: “well I think women have got a problem with the Liberal Party. It’s probably a better way of putting it … . The party does not have enough women MPs and Senators … . It is seen as being very blokey.” Current Prime Minister Scott Morrison said in March 2019: “we want to see women rise. But we don’t want to see women rise, only on the basis of others doing worse” (Four Corners); with “others” seen as a reference to men. The Liberal Party’s “woman problem” has been widely discussed in recent years, both in relation to the low numbers of women in its parliamentary representation and in its behaviour towards women. These claims were evident in an article highlighting allegations of bullying by Member of Parliament (MP) Julia Banks, which led to her resignation from the Liberal Party in 2018. Banks’s move to the crossbench as an Independent was followed by the departure from politics of senior Liberal MP and former Deputy Leader Julie Bishop and three other female Liberal MPs prior to the 2019 federal election. For resigning Liberal MP Linda Reynolds, the tumultuous change of leadership in the Liberal Party on 24 August 2018, when Scott Morrison replaced Malcolm Turnbull as Prime Minister, left her to say: “I do not recognise my party at the moment. I do not recognise the values. I do not recognise the bullying and intimidation that has gone on.” Bishop observed on 5 September: “it’s evident that there is an acceptance of a level of behaviour in Canberra that would not be tolerated in any other workplace.” And in her resignation speech on 27 November, Banks stated: “Often, when good women call out or are subjected to bad behaviour, the reprisals, backlash and commentary portrays them as the bad ones – the liar, the troublemaker, the emotionally unstable or weak, or someone who should be silenced” (Four Corners). Rachel Miller is a former senior Liberal staffer who worked for nine years in Parliament House. She admitted to having a consensual relationship with MP Alan Tudge. Both were married at the time. Her reason for “blowing the whistle” was not about the relationship itself, rather the culture built on an imbalance of power that she experienced and witnessed, particularly when endeavouring to end the relationship with Tudge. This saw her moving from Tudge’s office to that of Michaelia Cash, eventually being demoted and finally resigning. Miller refused to accept the Canberra bubble “culture of just putting your head down and not getting involved”. The Four Corners story also highlighted the historical behaviour of Attorney-General Christian Porter and his attitude towards women over several decades. Milligan reported: in the course of this investigation, Four Corners has spoken to dozens of former and currently serving staffers, politicians, and members of the legal profession. Many have worked within, or voted for, the Liberal Party. And many have volunteered examples of what they believe is inappropriate conduct by Christian Porter – including being drunk in public and making unwanted advances to women. Lawyer Josh Bornstein told Four Corners that the role of Attorney-General “occupies a unique role … as the first law officer of the country”, having a position in both the legal system and in politics. It is his view that this comes with a requirement for the Attorney-General “to be impeccable in terms of personal and political behaviour”. Milligan asserts that Porter’s role as “the nation’s chief law officer, includes implementing rules to protect women”. A historical review of Porter’s behaviour and attitude towards women was provided to Four Corners by barrister Kathleen Foley and debating colleague from 1987, Jo Dyer. Dyer described Porter as “very charming … very confident … Christian was quite slick … he had an air of entitlement … that I think was born of the privilege from which he came”. Foley has known Porter since she was sixteen, including at university and later when both were at the State Solicitors’ Office in Western Australia, and her impression was that Porter possessed a “dominant personality”. She said that many expected him to become a “powerful person one day” partly due to his father being “a Liberal Party powerbroker”, and that Porter had aspirations to become Prime Minister. She observed: “I’ve known him to be someone who was in my opinion, and based on what I saw, deeply sexist and actually misogynist in his treatment of women, in the way that he spoke about women.” Foley added: “for a long time, Christian has benefited from the silence around his conduct and his behaviour, and the silence has meant that his behaviour has been tolerated … . I’m here because I don’t think that his behaviour should be tolerated, and it is not acceptable.” Miller told the Four Corners program that she and others, including journalists, had observed Porter being “very intimate” with a young woman. Milligan noted that Porter “had a wife and toddler at home in Perth”, while Miller found the incident “quite confronting … in such a public space … . I was quite surprised by the behaviour and … it was definitely a step too far”. The incident was confirmed to Four Corners by “five other people, including Coalition staffers”. However, in 2017 the “Public Bar incident remained inside the Canberra bubble – it never leaked”, reports Milligan. In response to the exposure of Nationals MP Barnaby Joyce’s relationship with a member of his staff, Malcolm Turnbull changed the Code of Ministerial Standards (February 2018) for members of the Coalition Government (Liberal and National Parties). Labelled by many media as the “bonk ban”, the new code banned sexual relationships between ministers and their staff. Turnbull stopped short of asking Joyce to resign (Yaxley), however, Joyce stepped down as Leader of the National Party and Deputy Prime Minister shortly after the code was amended. Turnbull has conceded that the Joyce affair was the catalyst for implementing changes to ministerial standards (Four Corners). He was also aware of other incidents, including the behaviour of Christian Porter and claims he spoke with Porter in 2017, when concerns were raised about Porter’s behaviour. In what Turnbull acknowledges to be a stressful working environment, the ‘Canberra bubble’ is exacerbated by long hours, alcohol, and being away from family; this leads some members to a loss of standards in behaviour, particularly in relation to how women are viewed. This seems to blame the ‘bubble’ rather than acknowledge poor behaviour. Despite the allegations of improper behaviour against Porter, in 2017 Turnbull appointed Porter Attorney-General. Describing the atmosphere in the Canberra bubble, Miller concedes that not “all men are predators and [not] all women are victims”. She adds that a “work hard, play hard … gung ho mentality” in a “highly sexualised environment” sees senior men not being called out for behaviour, creating the perception that they are “almost beyond reproach [and it’s] something they can get away with”. Turnbull observes: “the attitudes to women and the lack of respect … of women in many quarters … reminds me of the corporate scene … 40 years ago. It’s just not modern Australia” (Four Corners). In a disclaimer about the program, Milligan stated: Four Corners does not suggest only Liberal politicians cross this line. But the Liberal Party is in government. And the Liberal politicians in question are Ministers of the Crown. All ministers must now abide by Ministerial Standards set down by Prime Minister Scott Morrison in 2018. They say: ‘Serving the Australian people as Ministers ... is an honour and comes with expectations to act at all times to the highest possible standards of probity.’ They also prohibit Ministers from having sexual relations with staff. Both Tudge and Porter were sent requests by Four Corners for interviews and answers to detailed questions prior to the program going to air. Tudge did not respond and Porter provided a brief statement in regards to his meeting with Malcolm Turnbull, denying that he had been questioned about allegations of his conduct as reported by Four Corners and that other matters had been discussed. Reactions to the Four Corners Program Responses to the program via mainstream media and on social media were intense, ranging from outrage at the behaviour of ministers on the program, to outrage that the program had aired the private lives of government ministers, with questions as to whether this was in the public interest. Porter himself disputed allegations of his behaviour aired in the program, labelling the claims as “totally false” and said he was considering legal options for “defamation” (Maiden). However, in a subsequent radio interview, Porter said “he did not want a legal battle to distract from his role” as a government minister (Moore). Commenting on the meeting he had with Turnbull in 2017, Porter asserted that Turnbull had not spoken to him about the alleged behaviour and that Turnbull “often summoned ministers in frustration about the amount of detail leaking from his Cabinet.” Porter also questioned the comments made by Dyer and Foley, saying he had not had contact with them “for decades” (Maiden). Yet, in a statement provided to the West Australian after the program aired, Porter admitted that Turnbull had raised the rumours of an incident and Porter had assured him they were unfounded. In a statement he again denied the allegations made in the Four Corners program, but admitted that he had “failed to be a good husband” (Moore). In a brief media release following the program, Tudge stated: “I regret my actions immensely and the hurt it caused my family. I also regret the hurt that Ms. Miller has experienced” (Grattan). Following the Four Corners story, Scott Morrison and Anne Ruston, the Minister for Families and Social Services, held a media conference to respond to the allegations raised by the program. Ruston was asked about her views of the treatment of women within the Liberal Party. However, she was cut off by Morrison who aired his grievance about the use of the term “bonk ban” by journalists, when referring to the ban on ministers having sexual relations with their staff. This interruption of a female minister responding to a question directed at her about allegations of misogyny drew world-wide attention. Ruston went on to reply that she felt “wholly supported” as a member of the party and in her Cabinet position. The video of the incident resulted in a backlash on social media. Ruston was asked about being cut off by the Prime Minister at subsequent media interviews and said she believed it to be “an entirely appropriate intervention” and reiterated her own experiences of being fully supported by other members of the Liberal Party (Maasdorp). Attempts to Silence the ABC A series of actions by government staff and ministers prior to, and following, the Four Corners program airing confirmed the assumption suggested by Milligan that “what happens in Canberra, stays in Canberra”. In the days leading to the airing of the Four Corners program, members of the federal government contacted ABC Chair Ita Buttrose, ABC Managing Director David Anderson, and other senior staff, criticising the program’s content before its release and questioning whether it was in the public interest. The Executive Producer for the program, Sally Neighbour, tweeted about the attempts to have the program cancelled on the day it was to air, and praised ABC management for not acceding to the demands. Anderson raised his concerns about the emails and calls to ABC senior staff while appearing at Senate estimates and said he found it “extraordinary” (Murphy & Davies). Buttrose also voiced her concerns and presented a lecture reinforcing the importance of “the ABC, democracy and the importance of press freedom”. As the public broadcaster, the ABC has a charter under the Australian Broadcasting Corporation Act (1983) (ABC Act), which includes its right to media independence. The attempt by the federal government to influence programming at the ABC was seen as countering this independence. Following the airing of the Four Corners program, the Morrison Government, via Communications Minister Paul Fletcher, again contacted Ita Buttrose by letter, asking how reporting allegations of inappropriate behaviour by ministers was “in the public interest”. Fletcher made the letter public via his Twitter account on the same day. The letter “posed 15 questions to the ABC board requesting an explanation within 14 days as to how the episode complied with the ABC’s code of practice and its statutory obligations to provide accurate and impartial journalism”. Fletcher also admitted that a senior member of his staff had contacted a member of the ABC board prior to the show airing but denied this was “an attempt to lobby the board”. Reportedly the ABC was “considering a response to what it believes is a further attack on its independence” (Visentin & Samios). A Case of Double Standards Liberal Senator Concetta Fierravanti-Wells told Milligan (Four Corners) that she believes “values and beliefs are very important” when standing for political office, with a responsibility to electors to “abide by those values and beliefs because ultimately we will be judged by them”. It is her view that “there is an expectation that in service of the Australian public, [politicians] abide by the highest possible conduct and integrity”. Porter has portrayed himself as being a family man, and an advocate for people affected by sexual harassment and concerned about domestic violence. Four Corners included two videos of Porter, the first from June 2020, where he stated: “no-one should have to suffer sexual harassment at work or in any other part of their lives … . The Commonwealth Government takes it very seriously”. In the second recording, from 2015, Porter spoke on the topic of domestic violence, where he advocated ensuring “that young boys understand what a respectful relationship is … what is acceptable and … go on to be good fathers and good husbands”. Tudge and Joyce hold a conservative view of traditional marriage as being between a man and a woman. They made this very evident during the plebiscite on legalising same-sex marriage in 2017. One of Tudge’s statements during the public debate was shown on the Four Corners program, where he said that he had “reservations about changing the Marriage Act to include same-sex couples” as he viewed “marriage as an institution … primarily about creating a bond for the creation, love and care of children. And … if the definition is changed … then the institution itself would potentially be weakened”. Miller responded by confirming that this was the public image Tudge portrayed, however, she was upset, surprised and believed it to be hypocrisy “to hear him … speak in parliament … and express a view that for children to have the right upbringing they need to have a mother and father and a traditional kind of family environment” (Four Corners). Following the outcome to the plebiscite in favour of marriage equality (Evershed), both Tudge and Porter voted to pass the legislation, in line with their electorates, while Joyce abstained from voting on the legislation (against the wishes of his electorate), along with nine other MPs including Scott Morrison (Henderson). Turnbull told Milligan: there’s no question that some of the most trenchant opponents of same-sex marriage, all in the name of traditional marriage, were at the same time enthusiastic practitioners of traditional adultery. As I said many times, this issue of the controversy over same-sex marriage was dripping with hypocrisy and the pools were deepest at the feet of the sanctimonious. The Bubble Threatens to Burst On 25 January 2021, the advocate for survivors of sexual assault, Grace Tame, was announced as Australian of the Year. This began a series of events that has the Canberra bubble showing signs of potentially rupturing, or perhaps even imploding, as further allegations of sexual assault emerge. Inspired by the speech of Grace Tame at the awards ceremony and the fact that the Prime Minister was standing beside her, on 15 February 2021, former Liberal staffer Brittany Higgins disclosed to journalist Samantha Maiden the allegation that she had been raped by a senior staffer in March 2019. Higgins also appeared in a television interview with Lisa Wilkinson that evening. The assault allegedly occurred after hours in the office of her boss, then Minister for Defence Industry and current Minister for Defence, Senator Linda Reynolds. Higgins said she reported what had occurred to the Minister and other staff, but felt she was being made to choose between her job and taking the matter to police. The 2019 federal election was called a few weeks later. Although Higgins wanted to continue in her “dream job” at Parliament House, she resigned prior to her disclosure in February 2021. Reynolds and Morrison were questioned extensively on the matter, in parliament and by the media, as to what they knew and when they were informed. Public outrage at the allegations was heightened by conflicting stories of these timelines and of who else knew. Although Reynolds had declared to the Senate that her office had provided full support to Higgins, it was revealed that her original response to the allegations to those in her office on the day of the media publication was to call Higgins a “lying cow”. After another public and media outcry, Reynolds apologised to Higgins (Hitch). Initially avoiding addressing the Higgins allegation directly, Morrison finally stated his empathy for Higgins in a doorstop media interview, reflecting advice he had received from his wife: Jenny and I spoke last night, and she said to me, "You have to think about this as a father first. What would you want to happen if it were our girls?" Jenny has a way of clarifying things, always has. On 3 March 2021, Grace Tame presented a powerful speech to the National Press Club. She was asked her view on the Prime Minister referring to his role as a father in the case of Brittany Higgins. Morrison’s statement had already enraged the public and certain members of the media, including many female journalists. Tame considered her response, then replied: “It shouldn’t take having children to have a conscience. [pause] And actually, on top of that, having children doesn’t guarantee a conscience.” The statement was met by applause from the gallery and received public acclaim. A further allegation of rape was made public on 27 February 2021, when friends of a deceased woman sent the Prime Minister a full statement from the woman that a current unnamed Cabinet Minister had raped her in 1988, when she was 16 years old (Yu). Morrison was asked whether he had spoken with the Minister, and stated that the Minister had denied the allegations and he saw no need to take further action, and would leave it to the police. New South Wales police subsequently announced that in light of the woman’s death last year, they could not proceed with an investigation and the matter was closed. The name of the woman has not been officially disclosed, however, on the afternoon of 3 March 2021 Attorney-General Christian Porter held a press conference naming himself as the Minister in question and vehemently denied the allegations. In light of the latest allegations, coverage by some journalists has shown the propensity to be complicit in protecting the Canberra bubble, while others (mainly women) endeavour to provide investigative journalistic coverage. The Outcome to Date Focus on the behaviour highlighted by “Inside the Canberra Bubble” in November 2020 waned quickly, with journalist Sean Kelly observing: since ABC’s Four Corners broadcast an episode exploring entrenched sexism in Parliament House, and more specifically within the Liberal Party, male politicians have said very, very, very little about it … . The episode in question was broadcast three weeks ago. It’s old news. But in this case that’s the point: every time the issue of sexism in Canberra is raised, it’s quickly rushed past, then forgotten (by men). Nothing happens. As noted earlier, Rachel Miller resigned from her position at Parliament House following the affair with Tudge. Barrister Kathleen Foley had held a position on the Victorian Bar Council, however three days after the Four Corners program went to air, Foley was voted off the council. According to Matilda Boseley from The Guardian, the change of council members was seen more broadly as an effort to remove progressives. Foley has also been vocal about gender issues within the legal profession. With the implementation of the new council, five members held their positions and 16 were replaced, seeing a change from 62 per cent female representation to 32 per cent (Boseley). No action was taken by the Prime Minister in light of the revelations by Four Corners: Christian Porter maintained his position as Attorney-General, Minister for Industrial Relations, and Leader of the House; and Alan Tudge continued as a member of the Federal Cabinet, currently as Minister for Education and Youth. Despite ongoing calls for an independent enquiry into the most recent allegations, and for Porter to stand aside, he continues as Attorney-General, although he has taken sick leave to address mental health impacts of the allegations (ABC News). Reynolds continues to hold the position of Defence Minister following the Higgins allegations, and has also taken sick leave on the advice of her specialist, now extended to after the March 2021 sitting of parliament (Doran). While Scott Morrison stands in support of Porter amid the allegations against him, he has called for an enquiry into the workplace culture of Parliament House. This appears to be in response to claims that a fourth woman was assaulted, allegedly by Higgins’s perpetrator. The enquiry, to be led by Kate Jenkins, Australia’s Sex Discrimination Commissioner, is focussed on “how to change the culture, how to change the practices, and how to ensure that, in future, we do have the best possible environment for prevention and response” (Murphy). By focussing the narrative of the enquiry on the “culture” of Parliament House, it diverts attention from the allegations of rape by Higgins and against Porter. While the enquiry is broadly welcomed, any outcomes will require more than changes to the workplace: they will require a much broader social change in attitudes towards women. The rage of women, in light of the current gendered political culture, has evolved into a call to action. An initial protest march, planned for outside Parliament House on 15 March 2021, has expanded to rallies in all capital cities and many other towns and cities in Australia. Entitled Women’s March 4 Justice, thousands of people, both women and men, have indicated their intention to participate. It is acknowledged that many residents of Canberra have objected to their entire city being encompassed in the term “Canberra Bubble”. However, the term’s relevance to this current state of affairs reflects the culture of those working in and for the Australian parliament, rather than residents of the city. It also describes the way that those who work in all things related to the federal government carry an apparent assumption that the bubble offers them immunity from the usual behaviour and accountability required of those outside the bubble. It this “bubble” that needs to burst. With a Prime Minister seemingly unable to recognise the hypocrisy of Ministers allegedly acting in ways contrary to “good character”, and for Porter, with ongoing allegations of improper behaviour, as expected for the country’s highest law officer, and in his mishandling of Higgins claims as called out by Tame, the bursting of the “Canberra bubble” may cost him government. References ABC News. “Christian Porter Denies Historical Rape Allegation.” Transcript. 4 Mar. 2021. 4 Mar. 2021 <https://www.abc.net.au/news/2021-03-03/christian-porter-press-conference-transcript/13212054>. Boseley, Matilda. “Barrister on Four Corners' Christian Porter Episode Loses Victorian Bar Council Seat.” The Guardian 11 Nov. 2020. 10 Dec. 2020 <https://www.theguardian.com/law/2020/nov/12/barrister-on-four-corners-christian-porter-episode-loses-victorian-bar-council-seat>. Buttrose, Ita. “The ABC, Democracy and the Importance of Press Freedom.” Lecture. Ramsay Centre for Western Civilisation. 12 Nov. 2020. 10 Dec. 2020 <http://about.abc.net.au/speeches/the-abc-democracy-and-the-importance-of-press-freedom/>. Doran, Matthew. “Linda Reynolds Extends Her Leave.” ABC News 7 Mar. 2021. 7 Mar. 2021 <https://www.abc.net.au/news/2021-03-07/linda-reynolds-extends-her-leave-following-rape-allegation/13224824>. Evershed, Nick. “Full Results of Australia's Vote for Same-Sex Marriage.” The Guardian 15 Nov. 2017. 10 Dec. 2020. <https://www.theguardian.com/australia-news/datablog/ng-interactive/2017/nov/15/same-sex-marriage-survey-how-australia-voted-electorate-by-electorate>. Four Corners. “Inside the Canberra Bubble.” ABC Television 9 Nov. 2020. 20 Nov. 2020 <https://www.abc.net.au/4corners/inside-the-canberra-bubble/12864676>. Grattan, Michelle. “Porter Rejects Allegations of Inappropriate Sexual Behaviour and Threatens Legal Action.” The Conversation 10 Nov. 2020. 10 Dec. 2020 <https://theconversation.com/porter-rejects-allegations-149774>. Gwynn, Mark. “Australian National Dictionary Centre’s Word of the Year 2018.” Ozwords 13 Dec. 2018. 10 Dec 2020 <http://ozwords.org/?p=8643#more-8643>. Henderson, Anna. “Same-Sex Marriage: This Is Everyone Who Didn't Vote to Support the Bill.” ABC News 8 Dec. 2017. 10 Dec. 2020 <https://www.abc.net.au/news/2017-12-08/same-sex-marriage-who-didnt-vote/9240584>. Heurich, Angelika. “Women in Australian Politics: Maintaining the Rage against the Political Machine”. M/C Journal 22.1 (2019). https://doi.org/10.5204/mcj.1498. Hitch, Georgia. “Defence Minister Linda Reynolds Apologises to Brittany Higgins.” ABC News 5 Mar. 2021. 5 Mar. 2021 <https://www.abc.net.au/news/2021-03-05/linda-reynolds-apologises-to-brittany-higgins-lying-cow/13219796>. Kelly, Sean. “Morrison Should Heed His Own Advice – and Fix His Culture Problem.” Sydney Morning Herald 29 Nov. 2020. 10 Dec. 2020 <https://www.smh.com.au/politics/federal/morrison-should-heed-his-own-advice-and-fix-his-culture-problem-20201129-p56iwn.html>. Maasdorp, James. “Scott Morrison Cops Backlash after Interrupting Anne Ruston.” ABC News 11 Nov. 2020. 10 Dec. 2020 <https://www.abc.net.au/news/2020-11-11/scott-morrison-anne-ruston-liberal-party-government/12873158>. Maiden, Samantha. “Christian Porter Hits Back at ‘Totally False’ Claims Aired on Four Corners.” The Australian 10 Nov. 2020. 10 Dec. 2020 <https://www.news.com.au/entertainment/tv/current-affairs/christian-porter-hits-back-at-totally-false-claims-aired-on-four-corners/news-story/0bc84b6268268f56d99714fdf8fa9ba2>. ———. “Young Staffer Brittany Higgins Says She Was Raped at Parliament House.” News.com.au 15 Sep. 2021. 15 Sep. 2021 <https://www.news.com.au/national/politics/parliament-house-rocked-by-brittany-higgins-alleged-rape/news-story/>. Moore, Charlie. “Embattled Minister Christian Porter Admits He Failed to Be 'a Good Husband’.” Daily Mail 11 Nov. 2020. 10 Dec. 2020 <https://www.dailymail.co.uk/news/article-8936197/>. Morrison, Scott. “Doorstop Interview – Parliament House.” Transcript. Prime Minister of Australia. 16 Feb. 2021. 1 Mar. 2021 <https://www.pm.gov.au/media/doorstop-interview-australian-parliament-house-act-160221>. Murphy, Katharine. “Sex Discrimination Commissioner Kate Jenkins to Lead Review into Parliament’s Workplace Culture.” The Guardian 5 Mar. 2021. 7 Mar. 2021 <https://www.theguardian.com/australia-news/2021/mar/05/sex-discrimination-commissioner-kate-jenkins-to-lead-review-into-parliaments-workplace-culture>. Murphy, Katharine, and Anne Davies. “Criticism of Four Corners 'Bonk Ban' Investigation before It Airs 'Extraordinary', ABC Boss Says.” The Guardian 9 Nov. 2020. 10 Dec. 2020 <https://www.theguardian.com/media/2020/nov/09/abc-under-extreme-political-pressure-over-bonk-ban-investigation-four-corners-boss-says>. Neighbour, Sally. “The Political Pressure.” Twitter 9 Nov. 2020. 9 Nov. 2020 <https://twitter.com/neighbour_s/status/1325545916107927552>. Tame, Grace. Address. National Press Club. 3 Mar. 2021. 3 Mar. 2021 <https://www.youtube.com/watch?v=LJmwOTfjn9U>. Visentin, Lisa, and Zoe Samios. “Morrison Government Asks ABC to Please Explain Controversial Four Corners Episode.” Sydney Morning Herald 1 Dec. 2020. 10 Dec. 2020 <https://www.smh.com.au/politics/federal/morrison-government-asks-abc-to-please-explain-controversial-four-corners-episode-20201201-p56jg2.html>. Wilkinson, Lisa. “Interview with Brittany Higgins.” The Project. Channel 10. 15 Sep. 2021. 16 Sep. 2021 <https://www.youtube.com/watch?v=nyjkjeoO2o4>. Yaxley, Louise. “Malcolm Turnbull Bans Ministers from Sex with Staffers.” ABC News 15 Feb. 2018. 10 Dec. 2020 <https://www.abc.net.au/news/2018-02-15/turnbull-slams-joyce-affair-changes-to-ministerial-standards/9451792>. Yu, Andi. “Rape Allegation against Cabinet Minister.” The Canberra Times 27 Feb. 2021. 1 Mar. 2021 <https://www.canberratimes.com.au/story/7145324/rape-allegation-against-cabinet-minister/>.

APA, Harvard, Vancouver, ISO, and other styles

15

Pavlidis, Adele, and David Rowe. "The Sporting Bubble as Gilded Cage." M/C Journal 24, no.1 (March15, 2021). http://dx.doi.org/10.5204/mcj.2736.

Full text

Abstract:

Introduction: Bubbles and Sport The ephemeral materiality of bubbles – beautiful, spectacular, and distracting but ultimately fragile – when applied to protect or conserve in the interests of sport-media profit, creates conditions that exacerbate existing inequalities in sport and society. Bubbles are usually something to watch, admire, and chase after in their brief yet shiny lives. There is supposed to be, technically, nothing inside them other than one or more gasses, and yet we constantly refer to people and objects being inside bubbles. The metaphor of the bubble has been used to describe the life of celebrities, politicians in purpose-built capital cities like Canberra, and even leftist, environmentally activist urban dwellers. The metaphorical and material qualities of bubbles are aligned—they cannot be easily captured and are liable to change at any time. In this article we address the metaphorical sporting bubble, which is often evoked in describing life in professional sport. This is a vernacular term used to capture and condemn the conditions of life of elite sportspeople (usually men), most commonly after there has been a sport-related scandal, especially of a sexual nature (Rowe). It is frequently paired with connotatively loaded adjectives like pampered and indulged. The sporting bubble is rarely interrogated in academic literature, the concept largely being left to the media and moral entrepreneurs. It is represented as involving a highly privileged but also pressurised life for those who live inside it. A sporting bubble is a world constructed for its most prized inhabitants that enables them to be protected from insurgents and to set the terms of their encounters with others, especially sport fans and disciplinary agents of the state. The Covid-19 pandemic both reinforced and reconfigured the operational concept of the bubble, re-arranging tensions between safety (protecting athletes) and fragility (short careers, risks of injury, etc.) for those within, while safeguarding those without from bubble contagion. Privilege and Precarity Bubble-induced social isolation, critics argue, encourages a loss of perspective among those under its protection, an entitled disconnection from the usual rules and responsibilities of everyday life. For this reason, the denizens of the sporting bubble are seen as being at risk to themselves and, more troublingly, to those allowed temporarily to penetrate it, especially young women who are first exploited by and then ejected from it (Benedict). There are many well-documented cases of professional male athletes “behaving badly” and trying to rely on institutional status and various versions of the sporting bubble for shelter (Flood and Dyson; Reel and Crouch; Wade). In the age of mobile and social media, it is increasingly difficult to keep misbehaviour in-house, resulting in a slew of media stories about, for example, drunkenness and sexual misconduct, such as when then-Sydney Roosters co-captain Mitchell Pearce was suspended and fined in 2016 after being filmed trying to force an unwanted kiss on a woman and then simulating a lewd act with her dog while drunk. There is contestation between those who condemn such behaviour as aberrant and those who regard it as the conventional expression of youthful masculinity as part of the familiar “boys will be boys” dictum. The latter naturalise an inequitable gender order, frequently treating sportsmen as victims of predatory women, and ignoring asymmetries of power between men and women, especially in homosocial environments (Toffoletti). For those in the sporting bubble (predominantly elite sportsmen and highly paid executives, also mostly men, with an array of service staff of both sexes moving in and out of it), life is reflected for those being protected via an array of screens (small screens in homes and indoor places of entertainment, and even smaller screens on theirs and others’ phones, as well as huge screens at sport events). These male sport stars are paid handsomely to use their skill and strength to perform for the sporting codes, their every facial expression and bodily action watched by the media and relayed to audiences. This is often a precarious existence, the usually brief career of an athlete worker being dependent on health, luck, age, successful competition with rivals, networks, and club and coach preferences. There is a large, aspirational reserve army of athletes vying to play at the elite level, despite risks of injury and invasive, life-changing medical interventions. Responsibility for avoiding performance and image enhancing drugs (PIEDs) also weighs heavily on their shoulders (Connor). Professional sportspeople, in their more reflective moments, know that their time in the limelight will soon be up, meaning that getting a ticket to the sporting bubble, even for a short time, can make all the difference to their post-sport lives and those of their families. The most vulnerable of the small minority of participants in sport who make a good, short-term living from it are those for whom, in the absence of quality education and prior social status, it is their sole likely means of upward social mobility (Spaaij). Elite sport performers are surrounded by minders, doctors, fitness instructors, therapists, coaches, advisors and other service personnel, all supporting athletes to stay focussed on and maximise performance quality to satisfy co-present crowds, broadcasters, sponsors, sports bodies and mass media audiences. The shield offered by the sporting bubble supports the teleological win-at-all-costs mentality of professional sport. The stakes are high, with athlete and executive salaries, sponsorships and broadcasting deals entangled in a complex web of investments in keeping the “talent” pivotal to the “attention economy” (Davenport and Beck)—the players that provide the content for sale—in top form. Yet, the bubble cannot be entirely secured and poor behaviour or performance can have devastating effects, including permanent injury or disability, mental illness and loss of reputation (Rowe, “Scandals and Sport”). Given this fragile materiality of the sporting bubble, it is striking that, in response to the sudden shutdown following the economic and health crisis caused by the 2020 global pandemic, the leaders of professional sport decided to create more of them and seek to seal the metaphorical and material space with unprecedented efficiency. The outcome was a multi-sided tale of mobility, confinement, capital, labour, and the gendering of sport and society. The Covid-19 Gilded Cage Sociologists such as Zygmunt Bauman and John Urry have analysed the socio-politics of mobilities, whereby some people in the world, such as tourists, can traverse the globe at their leisure, while others remain fixed in geographical space because they lack the means to be mobile or, in contrast, are involuntarily displaced by war, so-called “ethnic cleansing”, famine, poverty or environmental degradation. The Covid-19 global pandemic re-framed these matters of mobilities (Rowe, “Subjecting Pandemic Sport”), with conventional moving around—between houses, businesses, cities, regions and countries—suddenly subjected to the imperative to be static and, in perniciously unreflective technocratic discourse, “socially distanced” (when what was actually meant was to be “physically distanced”). The late-twentieth century analysis of the “risk society” by Ulrich Beck, in which the mysterious consequences of humans’ predation on their environment are visited upon them with terrifying force, was dramatically realised with the coming of Covid-19. In another iteration of the metaphor, it burst the bubble of twenty-first century global sport. What we today call sport was formed through the process of sportisation (Maguire), whereby hyper-local, folk physical play was reconfigured as multi-spatial industrialised sport in modernity, becoming increasingly reliant on individual athletes and teams travelling across the landscape and well over the horizon. Co-present crowds were, in turn, overshadowed in the sport economy when sport events were taken to much larger, dispersed audiences via the media, especially in broadcast mode (Nicholson, Kerr, and Sherwood). This lucrative mediation of professional sport, though, came with an unforgiving obligation to generate an uninterrupted supply of spectacular live sport content. The pandemic closed down most sports events and those that did take place lacked the crucial participation of the co-present crowd to provide the requisite event atmosphere demanded by those viewers accustomed to a sense of occasion. Instead, they received a strange spectacle of sport performers operating in empty “cathedrals”, often with a “faked” crowd presence. The mediated sport spectacle under the pandemic involved cardboard cut-out and sex doll spectators, Zoom images of fans on large screens, and sampled sounds of the crowd recycled from sport video games. Confected co-presence produced simulacra of the “real” as Baudrillardian visions came to life. The sporting bubble had become even more remote. For elite sportspeople routinely isolated from the “common people”, the live sport encounter offered some sensory experience of the social – the sounds, sights and even smells of the crowd. Now the sporting bubble closed in on an already insulated and insular existence. It exposed the irony of the bubble as a sign of both privileged mobility and incarcerated athlete work, both refuge and prison. Its logic of contagion also turned a structure intended to protect those inside from those outside into, as already observed, a mechanism to manage the threat of insiders to outsiders. In Australia, as in many other countries, the populace was enjoined by governments and health authorities to help prevent the spread of Covid-19 through isolation and immobility. There were various exceptions, principally those classified as essential workers, a heterogeneous cohort ranging from supermarket shelf stackers to pharmacists. People in the cultural, leisure and sports industries, including musicians, actors, and athletes, were not counted among this crucial labour force. Indeed, the performing arts (including dance, theatre and music) were put on ice with quite devastating effects on the livelihoods and wellbeing of those involved. So, with all major sports shut down (the exception being horse racing, which received the benefit both of government subsidies and expanding online gambling revenue), sport organisations began to represent themselves as essential services that could help sustain collective mental and even spiritual wellbeing. This case was made most aggressively by Australian Rugby League Commission Chairman, Peter V’landys, in contending that “an Australia without rugby league is not Australia”. In similar vein, prominent sport and media figure Phil Gould insisted, when describing rugby league fans in Western Sydney’s Penrith, “they’re lost, because the football’s not on … . It holds their families together. People don’t understand that … . Their life begins in the second week of March, and it ends in October”. Despite misgivings about public safety and equality before the pandemic regime, sporting bubbles were allowed to form, re-form and circulate. The indefinite shutdown of the National Rugby League (NRL) on 23 March 2020 was followed after negotiation between multiple entities by its reopening on 28 May 2020. The competition included a team from another nation-state (the Warriors from Aotearoa/New Zealand) in creating an international sporting bubble on the Central Coast of New South Wales, separating them from their families and friends across the Tasman Sea. Appeals to the mental health of fans and the importance of the NRL to myths of “Australianness” notwithstanding, the league had not prudently maintained a financial reserve and so could not afford to shut down for long. Significant gambling revenue for leagues like the NRL and Australian Football League (AFL) also influenced the push to return to sport business as usual. Sport contests were needed in order to exploit the gambling opportunities – especially online and mobile – stimulated by home “confinement”. During the coronavirus lockdowns, Australians’ weekly spending on gambling went up by 142 per cent, and the NRL earned significantly more than usual from gambling revenue—potentially $10 million above forecasts for 2020. Despite the clear financial imperative at play, including heavy reliance on gambling, sporting bubble-making involved special licence. The state of Queensland, which had pursued a hard-line approach by closing its borders for most of those wishing to cross them for biographical landmark events like family funerals and even for medical treatment in border communities, became “the nation's sporting hub”. Queensland became the home of most teams of the men’s AFL (notably the women’s AFLW season having been cancelled) following a large Covid-19 second wave in Melbourne. The women’s National Netball League was based exclusively in Queensland. This state, which for the first time hosted the AFL Grand Final, deployed sport as a tool in both national sports tourism marketing and internal pre-election politics, sponsoring a documentary, The Sporting Bubble 2020, via its Tourism and Events arm. While Queensland became the larger bubble incorporating many other sporting bubbles, both the AFL and the NRL had versions of the “fly in, fly out” labour rhythms conventionally associated with the mining industry in remote and regional areas. In this instance, though, the bubble experience did not involve long stays in miners’ camps or even the one-night hotel stopovers familiar to the popular music and sport industries. Here, the bubble moved, usually by plane, to fulfil the requirements of a live sport “gig”, whereupon it was immediately returned to its more solid bubble hub or to domestic self-isolation. In the space created between disciplined expectation and deplored non-compliance, the sporting bubble inevitably became the scrutinised object and subject of scandal. Sporting Bubble Scandals While people with a very low risk of spreading Covid-19 (coming from areas with no active cases) were denied entry to Queensland for even the most serious of reasons (for example, the death of a child), images of AFL players and their families socialising and enjoying swimming at the Royal Pines Resort sporting bubble crossed our screens. Yet, despite their (players’, officials’ and families’) relative privilege and freedom of movement under the AFL Covid-Safe Plan, some players and others inside the bubble were involved in “scandals”. Most notable was the case of a drunken brawl outside a Gold Coast strip club which led to two Richmond players being “banished”, suspended for 10 matches, and the club fined $100,000. But it was not only players who breached Covid-19 bubble protocols: Collingwood coaches Nathan Buckley and Brenton Sanderson paid the $50,000 fine imposed on the club for playing tennis in Perth outside their bubble, while Richmond was fined $45,000 after Brooke Cotchin, wife of team captain Trent, posted an image to Instagram of a Gold Coast day spa that she had visited outside the “hub” (the institutionally preferred term for bubble). She was subsequently distressed after being trolled. Also of concern was the lack of physical distancing, and the range of people allowed into the sporting bubble, including babysitters, grandparents, and swimming coaches (for children). There were other cases of players being caught leaving the bubble to attend parties and sharing videos of their “antics” on social media. Biosecurity breaches of bubbles by players occurred relatively frequently, with stern words from both the AFL and NRL leaders (and their clubs) and fines accumulating in the thousands of dollars. Some people were also caught sneaking into bubbles, with Lekahni Pearce, the girlfriend of Swans player Elijah Taylor, stating that it was easy in Perth, “no security, I didn’t see a security guard” (in Barron, Stevens, and Zaczek) (a month later, outside the bubble, they had broken up and he pled guilty to unlawfully assaulting her; Ramsey). Flouting the rules, despite stern threats from government, did not lead to any bubble being popped. The sport-media machine powering sporting bubbles continued to run, the attendant emotional or health risks accepted in the name of national cultural therapy, while sponsorship, advertising and gambling revenue continued to accumulate mostly for the benefit of men. Gendering Sporting Bubbles Designed as biosecurity structures to maintain the supply of media-sport content, keep players and other vital cogs of the machine running smoothly, and to exclude Covid-19, sporting bubbles were, in their most advanced form, exclusive luxury camps that illuminated the elevated socio-cultural status of sportsmen. The ongoing inequalities between men’s and women’s sport in Australia and around the world were clearly in evidence, as well as the politics of gender whereby women are obliged to “care” and men are enabled to be “careless” – or at least to manage carefully their “duty of care”. In Australia, the only sport for women that continued during the height of the Covid-19 lockdown was netball, which operated in a bubble that was one of sacrifice rather than privilege. With minimum salaries of only $30,000 – significantly less than the lowest-paid “rookies” in the AFL – and some being mothers of small children and/or with professional jobs juggled alongside their netball careers, these elite sportswomen wanted to continue to play despite the personal inconvenience or cost (Pavlidis). Not one breach of the netballers out of the bubble was reported, indicating that they took their responsibilities with appropriate seriousness and, perhaps, were subjected to less scrutiny than the sportsmen accustomed to attracting front-page headlines. National Netball League (also known after its Queensland-based naming rights sponsor as Suncorp Super Netball) players could be regarded as fortunate to have the opportunity to be in a bubble and to participate in their competition. The NRL Women’s (NRLW) Premiership season was also completed, but only involved four teams subject to fly in, fly out and bubble arrangements, and being played in so-called curtain-raiser games for the NRL. As noted earlier, the AFLW season was truncated, despite all the prior training and sacrifice required of its players. Similarly, because of their resource advantages, the UK men’s and boy’s top six tiers of association football were allowed to continue during lockdown, compared to only two for women and girls. In the United States, inequalities between men’s and women’s sports were clearly demonstrated by the conditions afforded to those elite sportswomen inside the Women’s National Basketball Association (WNBA) sport bubble in the IMG Academy in Florida. Players shared photos of rodent traps in their rooms, insect traps under their mattresses, inedible food and blocked plumbing in their bubble accommodation. These conditions were a far cry from the luxury usually afforded elite sportsmen, including in Florida’s Walt Disney World for the men’s NBA, and is just one of the many instances of how gendered inequality was both reproduced and exacerbated by Covid-19. Bursting the Bubble As we have seen, governments and corporate leaders in sport were able to create material and metaphorical bubbles during the Covid-19 lockdown in order to transmit stadium sport contests into home spaces. The rationale was the importance of sport to national identity, belonging and the routines and rhythms of life. But for whom? Many women, who still carry the major responsibilities of “care”, found that Covid-19 intensified the affective relations and gendered inequities of “home” as a leisure site (Fullagar and Pavlidis). Rates of domestic violence surged, and many women experienced significant anxiety and depression related to the stress of home confinement and home schooling. During the pandemic, women were also more likely to experience the stress and trauma of being first responders, witnessing virus-related sickness and death as the majority of nurses and care workers. They also bore the brunt of much of the economic and employment loss during this time. Also, as noted above, livelihoods in the arts and cultural sector did not receive the benefits of the “bubble”, despite having a comparable claim to sport in contributing significantly to societal wellbeing. This sector’s workforce is substantially female, although men dominate its senior roles. Despite these inequalities, after the late March to May hiatus, many elite male sportsmen – and some sportswomen - operated in a bubble. Moving in and out of them was not easy. Life inside could be mentally stressful (especially in long stays of up to 150 days in sports like cricket), and tabloid and social media troll punishment awaited those who were caught going “over the fence”. But, life in the sporting bubble was generally preferable to the daily realities of those afflicted by the trauma arising from forced home confinement, and for whom watching moving sports images was scant compensation for compulsory immobility. The ethical foundation of the sparkly, ephemeral fantasy of the sporting bubble is questionable when it is placed in the service of a voracious “media sports cultural complex” (Rowe, Global Media Sport) that consumes sport labour power and rolls back progress in gender relations as a default response to a global pandemic. Covid-19 dramatically highlighted social inequalities in many areas of life, including medical care, work, and sport. For the small minority of people involved in sport who are elite professionals, the only thing worse than being in a sporting bubble during the pandemic was not being in one, as being outside precluded their participation. Being inside the bubble was a privilege, albeit a dubious one. But, as in wider society, not all sporting bubbles are created equal. Some are more opulent than others, and the experiences of the supporting and the supported can be very different. The surface of the sporting bubble may be impermanent, but when its interior is opened up to scrutiny, it reveals some very durable structures of inequality. Bubbles are made to burst. They are, by nature, temporary, translucent structures created as spectacles. As a form of luminosity, bubbles “allow a thing or object to exist only as a flash, sparkle or shimmer” (Deleuze, 52). In echoing Deleuze, Angela McRobbie (54) argues that luminosity “softens and disguises the regulative dynamics of neoliberal society”. The sporting bubble was designed to discharge that function for those millions rendered immobile by home confinement legislation in Australia and around the world, who were having to deal with the associated trauma, risk and disadvantage. Hence, the gender and class inequalities exacerbated by Covid-19, and the precarious and pressured lives of elite athletes, were obscured. We contend that, in the final analysis, the sporting bubble mainly serves those inside, floating tantalisingly out of reach of most of those outside who try to grasp its elusive power. Yet, it is a small group beyond who wield that power, having created bubbles as armoured vehicles to salvage any available profit in the midst of a global pandemic. References AAP. “NRL Makes Desperate Plea to Government as It Announces Season Will Go Ahead.” 7News.com.au 15 Mar. 2020. 8 Mar. 2021 <https://7news.com.au/sport/rugby-league/nrl-makes-desperate-plea-to-government-as-it-announces-season-will-go-ahead-c-745711>. Al Jazeera English. “Sports TV: Faking Spectators and Spectacles.” The Listening Post 26 Sep. 2020 <https://www.youtube.com/watch?v=0AlD63s26sQ&feature=youtu.be&t=827>. Barron, Jackson, Kylie Stevens, and Zoe Zaczek. “WAG Who Broke into COVID-19 Bubble for an Eight-Hour Rendezvous with Her AFL Star Boyfriend Opens Up on ‘How Easy It Was’—and Apologises for ‘Really Big Mistake’ That Cost Club $50,000.” The Daily Mail 19 Aug. 2020. 8 Mar. 2021 <https://www.dailymail.co.uk/news/article-8638959/WAG-AFL-star-sacked-season-coronavirus-breach-reveals-easy-sneak-in.html>. Bauman, Zygmunt. Liquid Modernity. Cambridge: Polity Press, 2000. Beck, Ulrich. Risk Society: Towards a New Modernity. London: Sage, 1992. Benedict, Jeff. Public Heroes, Private Felons: Athletes and Crimes against Women. Boston: Northeastern Uni. Press, 1999. Benfante, Agata, Marialaura di Tella, Annunziata Romeo, and Lorys Castelli. “Traumatic Stress in Healthcare Workers during COVID-19 Pandemic: A Review of the Immediate Impact.” Frontiers in Psychology 11 (23 Oct. 2020). Blaine, Lech. “The Art of Class War.” The Monthly. 17 Aug. 2020. 8 Mar. 2021 <https://www.themonthly.com.au/issue/2020/august/1596204000/lech-blaine/art-class-war#mtr>. Brooks, Samantha K., Rebecca K. Webster, Louise E. Smith, Lisa Woodland, Simon Wessely, Neil Greenberg, and Gideon J. Rubin. “The Psychological Impact of Quarantine and How to Reduce It: Rapid Review of the Evidence.” The Lancet 26 Feb. 2020. 8 Mar. 2021 <https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30460-8/fulltext>. Caust, Jo. “Coronavirus: 3 in 4 Australians Employed in the Creative and Performing Arts Could Lose Their Jobs.” The Conversation 20 Apr. 2020. 8 Mar. 2021 <https://theconversation.com/coronavirus-3-in-4-australians-employed-in-the-creative-and-performing-arts-could-lose-their-jobs-136505>. Connor, James. “The Athlete as Widget: How Exploitation Explains Elite Sport.” Sport in Society 12.10 (2009): 1369–77. Courage, Cara. “Women in the Arts: Some Questions.” The Guardian 5 Mar. 2012. 8 Mar. 2021 <https://www.theguardian.com/culture-professionals-network/culture-professionals-blog/2012/mar/05/women-in-the-arts-introduction>. Davenport, Thomas H., and John C. Beck. The Attention Economy: Understanding the New Currency of Business. Cambridge, MA: Harvard Business Review Press, 2001. Deleuze, Gilles. Foucault. Trans. and ed. S. Hand. Minneapolis: University of Minnesota Press, 1986. Dennien, Matt, and Lydia Lynch. “Footage Shows Relaxed Scenes from AFL Hub amid Calls for Exception Overhaul.” Brisbane Times 3 Sep. 2020. 8 Mar. 2021 <https://www.brisbanetimes.com.au/national/queensland/footage-shows-relaxed-scenes-from-afl-hub-amid-calls-for-exemption-overhaul-20200903-p55s74.html>. Dobeson, Shanee. “Bailey Defends Qld Border Rules after Grieving Mother Denied Entry to Bury Son.” MyGC.com.au 12 Sep. 2020. 8 Mar. 2021 <https://www.mygc.com.au/bailey-defends-qld-border-rules-after-grieving-mother-denied-exemption-to-bury-son>. Dunn, Amelia. “Who Is Deemed an ‘Essential’ Worker under Australia’s COVID-19 Rules?” SBS News 26 Mar. 2020. 8 Mar. 2021 <https://www.youtube.com/watch?v=0AlD63s26sQ&feature=youtu.be&t=827>. Emiko. “Women’s Unpaid Care Work in Australia.” YWCA n.d. 8 Mar. 2021 <https://www.ywca.org.au/opinion/womens-unpaid-care-work-in-australia>. Fullagar, Simone, and Adele Pavlidis. “Thinking through the Disruptive Effects and Affects of the Coronavirus with Feminist New Materialism.” Leisure Sciences (2020). 8 Mar. 2021 <https://www.tandfonline.com/doi/abs/10.1080/01490400.2020.1773996?journalCode=ulsc20>. Flood, Michael, and Sue Dyson. “Sport, Athletes, and Violence against Women.” NTV Journal 4.3 (2007): 37–46. Goodwin, Sam. “AFL Boss Left Fuming over ‘Out of Control’ Quarantine Party.” Yahoo! Sport 8 Sep. 2020. 8 Mar. 2021 <https://au.sports.yahoo.com/afl-2020-uproar-out-of-control-quarantine-party-224251554.html>. Griffith News. “New Research Shows Why Musicians among the Hardest Hit by COVID-19.” 18 June 2020. 8 Mar. 2021 <https://news.griffith.edu.au/2020/06/18/new-research-shows-why-musicians-among-the-hardest-hit-by-COVID-19>. Hart, Chloe. “‘This Is the Hardest It’s Going to Get’: NZ Warriors Open Up about Relocating to Australia for NRL.” ABC News 8 Aug. 2020. 8 Mar. 2021 <https://www.abc.net.au/news/2020-08-08/nz-warriors-open-up-about-relocation-to-australia-for-nrl/12531074>. Hooper, James. “10 Broncos Hit with Fines as Club Cops Huge Sanction over Pub Bubble Breach.” Fox Sports 18 Aug. 2020. 8 Mar. 2021 <https://www.foxsports.com.au/nrl/nrl-premiership/teams/broncos/nrl-2020-brisbane-broncos-pub-covid19-bubble-breach-fine-sanctions-who-was-at-the-pub/news-story/d3bd3c559289a8b83bc3fccbceaffe78>. Hytner, Mike. “AFL Suspends Season and Cancels AFLW amid Coronavirus Crisis.” The Guardian 22 Mar. 2020. 8 Mar. 2021 <https://www.theguardian.com/sport/2020/mar/22/afl-nrl-and-a-league-press-on-despite-restrictions>. Jones, Wayne. “Ray of Hope for Medical Care across Border.” Echo Netdaily 14 Aug. 2020. 8 Mar. 2021 <https://www.echo.net.au/2020/08/ray-of-hope-for-medical-care-across-border>. Jouavel, Levi. “Women’s Football Shutdowns: ‘It’s Unfair Boys’ Academies Can Still Play’.” BBC News 10 Nov. 2020. 8 Mar. 2021 <https://www.bbc.com/news/newsbeat-54876198>. Keh, Andrew. “We Hope Your Cheers for This Article Are for Real.” The New York Times 16 June 2020. 8 Mar. 2021 <https://www.nytimes.com/2020/06/16/sports/coronavirus-stadium-fans-crowd-noise.html>. Kennedy, Else. “‘The Worst Year’: Domestic Violence Soars in Australia during COVID-19.” The Guardian 1 Dec. 2020. 8 Mar. 2021 <https://www.theguardian.com/society/2020/dec/01/the-worst-year-domestic-violence-soars-in-australia-during-COVID-19>. Keoghan, Sarah. “‘Everyone’s Concerned’: Players Cop 70% Pay Cut.” Sydney Morning Herald 28 Mar. 2020. 8 Mar. 2021 <https://www.smh.com.au/sport/netball/everyone-s-concerned-players-cop-70-per-cent-pay-cut-20200328-p54esz.html>. Knox, Malcolm. “Gambling’s Share of NRL Revenue Could Well Double: That Brings Power.” Sydney Morning Herald. 15 May 2020. 8 Mar. 2021 <https://www.smh.com.au/sport/gambling-s-share-of-nrl-revenue-could-well-double-that-brings-power-20200515-p54tbg.html>. McGrath, Pat. “Racing Victoria Got $16.6 Million in Emergency COVID Funding: Then Online Horse Racing Gambling Revenue Skyrocketed.” ABC News 3 Nov. 2020. 8 Mar. 2021 <https://www.abc.net.au/news/2020-11-03/racing-victoria-emergency-coronavirus-COVID-funding/12838012>. McRobbie, Angela. The Aftermath of Feminism: Gender, Culture and Social Change. Thousand Oaks, CA: Sage, 2009. Madden, Helena. “Lebron James’s Suite in the NBA Bubble Is Fit for a King.” Robb Report 16 Sep. 2020. 8 Mar. 2021 <https://robbreport.com/travel/hotels/lebron-james-nba-bubble-suite-1234569303>. Maguire, Joseph. “Sportization.” The Blackwell Encyclopedia of Sociology. Ed. George Ritzer. Oxford: Blackwell, 2007. 4710–11. Mathieson, Craig. “Michael Jordan Pierces the Bubble of Elite Sport in Juicy ESPN Doco.” Sydney Morning Herald. 13 May 2020. 8 Mar. 2021 <https://www.smh.com.au/culture/tv-and-radio/michael-jordan-pierces-the-bubble-of-elite-sport-in-juicy-espn-doco-20200511-p54rwc.html>. Maurice, Megan. “Australia’s Summer of Cricket during COVID Is about Money and Power—and Men”. 6 Jan. 2021. 8 Mar. 2021 <https://www.theguardian.com/sport/2021/jan/06/australias-summer-of-cricket-during-COVID-is-about-money-and-power-and-men>. Murphy, Catherine. “Cricket Australia Contributed to Circumstances Surrounding Ball-Tampering Scandal, Review Finds”. ABC News 20 Oct. 2018. 8 Mar. 2021 <https://www.abc.net.au/news/2018-10-29/scathing-report-released-into-cricket-australia-culture/10440972>. News.com.au. “How an AFL Star Wide’s Instagram Post Led to a Hefty Fine and a Journalist Being Stood Down.” NZ Herald 3 Aug. 2020. 8 Mar. 2021 <https://www.nzherald.co.nz/sport/how-an-afl-star-wifes-instagram-post-led-to-a-hefty-fine-and-a-journalist-being-stood-down/7IDR4SXQ6QW5WDFBV42BK3M7YQ>. Nicholson, Matthew, Anthony Kerr, and Merryn Sherwood. Sport and the Media: Managing the Nexus. 2nd ed. London: Routledge, 2015. Pavlidis, Adele. “Being Grateful: Materialising ‘Success’ in Women’s Contact Sport.” Emotion, Space and Society 35 (2020). 8 Mar. 2021 <https://www.sciencedirect.com/science/article/abs/pii/S1755458620300207>. Phillips, Sam. “‘The Future of the Season Is in Their Hands’: Palaszczuk’s NRL Warning.” Sydney Morning Herald 10 Aug. 2020. 8 Mar. 2021 <https://www.smh.com.au/sport/nrl/the-future-of-the-season-is-in-their-hands-palaszczuk-s-nrl-warning-20200810-p55k7j.html>. Pierik, Jon, and Ryan, Peter. “‘I Own the Consequences’: Stack, Coleman-Jones Apologise for Gold Coast Incident.” The Age 5 Sep. 2020. 8 Mar. 2021 <https://www.theage.com.au/sport/afl/i-own-the-consequences-stack-apologises-for-gold-coast-incident-20200905-p55spq.html>. Poposki, Claudia, and Louise Ayling. “AFL Star’s Wife Who Caused Uproar by Breaching Quarantine to Go to a Spa Reveals She’s Been Smashed by Vile Trolls.” Daily Mail Australia 29 Aug. 2020. 8 Mar. 2021 <https://www.dailymail.co.uk/news/article-8674083/AFL-WAG-Brooke-Cotchin-breached-COVID-19-quarantine-spa-cops-abuse-trolls.html>. Ramsey, Michael. “Axed Swan Spared Jail over Ex-Girlfriend Assault.” AFL.com.au 2 Dec. 2020. 8 Mar. 2021 <https://www.afl.com.au/news/526677/axed-swan-spared-jail-over-ex-girlfriend-assault>. Read, Brent. “The NRL Is Set to Finish the Season on a High after Stunning Financial Results.” The Australian 1 Dec. 2020. 8 Mar. 2021 <https://www.theaustralian.com.au/sport/nrl/the-nrl-is-set-to-finish-the-season-on-a-high-after-stunning-financial-results/news-story/1ce9c2f9b598441d88daaa8cc2b44dc1>. Reel, Justine, J., and Emily Crouch. “#MeToo: Uncovering Sexual Harassment and Assault in Sport.” Journal of Clinical Sport Psychology 13.2 (2018): 177–79. Rogers, Michael. “Buckley, Sanderson to Pay Pies’ Huge Fine for COVID Breach.” AFL.com.au 1 Aug. 2020. 8 Mar. 2021 <https://www.afl.com.au/news/479118/buckley-sanderson-to-pay-pies-huge-fine-for-COVID-breach>. Richardson, David, and Richard Denniss. “Gender Experiences during the COVID-19 Lockdown: Women Lose from COVID-19, Men to Gain from Stimulus.” The Australia Institute June 2020. 8 Mar. 2021 <https://australiainstitute.org.au/report/gender-experiences-during-the-COVID-19-lockdown>. Rowe, David. “All Sport Is Global: A Hard Lesson from the Pandemic.” Open Forum 28 Mar. 2020. 8 Mar. 2021 <https://www.openforum.com.au/all-sport-is-global-a-hard-lesson-from-the-pandemic>. ———. “And the Winner Is … Television: Spectacle and Sport in a Pandemic.” Open Forum 19 Sep. 2020. 8 Mar. 2021 <https://www.openforum.com.au/and-the-winner-istelevision-spectacle-and-sport-in-a-pandemic>. ———. Global Media Sport: Flows, Forms and Futures. London: Bloomsbury, 2011. ———. “Scandals and Sport.” Routledge Companion to Media and Scandal. Eds. Howard Tumber and Silvio Waisbord. London: Routledge, 2019. 324–32. ———. “Subjecting Pandemic Sport to a Sociological Procedure.” Journal of Sociology 56.4 (2020): 704–13. Schout, David. “Cricket Prepares for Mental Health Challenges Thrown Up by Bubble Life.” The Guardian 8 Nov. 2020. 8 Mar. 2021 <https://www.theguardian.com/sport/2020/nov/08/cricket-prepares-for-mental-health-challenges-thrown-up-by-bubble-life>. Spaaij, Ramón. Sport and Social Mobility: Crossing Boundaries. London: Routledge, 2011. The Sporting Bubble. Dir. Peter Dickson. Nine Network Australia, 2020. Swanston, Tim. “With Coronavirus Limiting Interstate Movement, Queensland Is the Nation’s Sporting Hub—Is That Really Safe?” ABC News 29 Aug. 2020. 8 Mar. 2021 <https://www.abc.net.au/news/2020-08-29/coronavirus-queensland-rules-for-sports-teams-explainer/12542634>. Toffoletti, Kim. “How Is Gender-Based Violence Covered in the Sporting News? An Account of the Australian Football League Sex Scandal.” Women's Studies International Forum 30.5 (2007): 427–38. Urry, John. Mobilities. Cambridge: Polity Press, 2007. Walter, Brad. “From Shutdown to Restart: How NRL Walked Tightrope to Get Season Going Again.” NRL.com 25 May 2020. 8 Mar. 2021 <https://www.nrl.com/news/2020/05/25/from-shutdown-to-restart-how-nrl-walked-tightrope-to-get-season-going-again>. Wade, Lisa. “Rape on Campus: Athletes, Status, and the Sexual Assault Crisis.” The Conversation 7 Mar. 2017. 8 Mar. 2021 <https://theconversation.com/rape-on-campus-athletes-status-and-the-sexual-assault-crisis-72255>. Webster, Andrew. “Sydney Roosters’ Mitchell Pearce Involved in a Drunken Incident with a Dog? And Your Point Is ...?” Sydney Morning Herald 28 Jan. 2016. 8 Mar. 2021 <https://www.smh.com.au/sport/nrl/sydney-roosters-mitchell-pearce-involved-in-a-drunken-incident-with-a-dog-and-your-point-is--20160127-gmfemh.html>. Whittaker, Troy. “Three-Peat Not Driving Broncos in NRLW Grand Final.” NRL.com 24 Oct. 2020. 8 Mar. 2021 <https://www.nrl.com/news/2020/10/24/three-peat-not-driving-broncos-in-nrlw-grand-final>. Yahoo! Sport Staff. “‘Not Okay’: Uproar over ‘Disgusting’ Find inside Quarantine.” Yahoo! Sport 9 July 2020. 8 Mar. 2021 <https://au.sports.yahoo.com/wnba-disturbing-conditions-coronavirus-bubble-slammed-003557243.html>.

APA, Harvard, Vancouver, ISO, and other styles

16

"ZOOLOGICAL CATALOGUE OF AUSTRALIA, Vol. I, Amphibia and Reptilia, by Harold G. Cogger, Elizabeth E. Cameron and Heather M. Cogger. Published by Australian Government Publishing Service, G. P. O. Box 84, Canberra A. C. T. 2601, Australia. pp. vi+313. Hardbound. US$ 33 including postage." Japanese journal of herpetology 11, no.1 (1985): 36a—37. http://dx.doi.org/10.5358/hsj1972.11.1_36a.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Seabrook,AmandaJ., JessicaE.Harris, SofiaB.Velosa, Edward Kim, AideenM.McInerney-Leo, Trisha Dwight, JasonI.Hockings, et al. "Multiple Endocrine Tumors Associated with Germline MAX Mutations: Multiple Endocrine Neoplasia Type 5?" Journal of Clinical Endocrinology & Metabolism, December25, 2020. http://dx.doi.org/10.1210/clinem/dgaa957.

Full text

Abstract:

Abstract Context Pathogenic germline MAX variants are associated with pheochromocytoma and paraganglioma (PPGL), pituitary neuroendocrine tumors and, possibly, other endocrine and non-endocrine tumors. Objective To report two families with germline MAX variants, pheochromocytomas (PC) and multiple other tumors. Design Clinical, genetic, immunohistochemical, and functional studies. Setting University Hospitals in Australia Participants Two families with germline MAX variants. Interventions Usual clinical care. Main Outcome measures Phenotyping; germline and tumor sequencing; immunohistochemistry of PC and other tumors; functional studies of MAX variants. Results Family A has multiple individuals with PC (including bilateral and metastatic disease) and two children (to date, without PC) with neuroendocrine tumors (paravertebral ganglioneuroma and abdominal neuroblastoma, respectively). One individual has acromegaly; immunohistochemistry of PC tissue showed positive GHRH staining. Another individual with previously resected PCs has pituitary enlargement and elevated IGF-1. A germline MAX variant (c.200C&gt;A, p.Ala67Asp) was identified in all individuals with PC and both children, with loss-of-heterozygosity in PC tissue. Immunohistochemistry showed loss of MAX staining in PCs and other neural crest tumors. In vitro studies confirmed the variant as loss-of-function. In Family B, the proband has bilateral and metastatic PC, prolactin-producing pituitary tumor, multi-gland parathyroid adenomas, chondrosarcoma, and multifocal pulmonary adenocarcinomas. A truncating germline MAX variant (c.22G&gt;T, p.Glu8*) was identified. Conclusions Germline MAX mutations are associated with PCs, ganglioneuromas, neuroblastomas, pituitary neuroendocrine tumors, and, possibly, parathyroid adenomas, as well as non-endocrine tumors of chondrosarcoma and lung adenocarcinoma, suggesting MAX is a novel multiple endocrine neoplasia gene.

APA, Harvard, Vancouver, ISO, and other styles

18

Gallegos, Danielle, and Felicity Newman. "What about the Women?" M/C Journal 2, no.7 (October1, 1999). http://dx.doi.org/10.5204/mcj.1798.

Full text

Abstract:

Contemporary culinary discourse in Australia has been dominated by the notion that migration and the increased mobility of Australians is responsible for filling a culinary void, as though, because we have had no peasantry we have no affinity with either the land or its produce. This argument serves to alienate Australians of British descent and its validity is open to questioning. It's an argument in urgent need of debate because cuisine stands out as the signifier of a 'multicultural' nation. Despite all the political posturing, food has 'long been the acceptable face of multiculturalism' (Gunew 13). We argue that the rhetoric of multiculturalism serves to widen the chasm between Australians of British descent and other migrants by encouraging the 'us' and 'them' mentality. We have examined the common links in the food stories of three women from disparate backgrounds. The sample is small in quantitative terms but we felt that if the culinary histories of just three women ran counter to the dominant discourse, then they would provide a new point of departure. In doing this we hope to question the precept driving culinary discourse which gives more weight to what men have said and done, than what women have cooked and how; and propagates mythologies about the eating habits of 'ethnic' migrants. Multiculturalism The terminology surrounding policies that seek to manage difference and diversity is culturally loaded and tends to perpetuate binaries. "Multiculturalism, circulates in Australia as a series of discursive formations serving a variety of institutional interests" (Gunew 256). In Australia multicultural policy seeks to "manage our cultural diversity so that the social cohesion of our nation is preserved" (Advisory Council on Multicultural Affairs 4). The result is to allow diversity that is sanctioned and is to some extent homogenised, while difference is not understood and is contained (see Newman). Multicultural? Who does it include and exclude? Gunew points out that official formulations of multiculturalism exclude people of 'Anglo-Celtic' origin, as though they had no 'ethnicity'. Multiculturalism, while addressing some of the social problems of immigration, is propelled at government level by our need for national cultural policy (see Stratton and Ang). To have a national cultural policy you need, it would seem, a film industry, a music industry, and a cuisine. In his history of Australian cuisine, Symons has only briefly alluded to women's role in the development of Australia's 'industrial cuisine'. One Continuous Picnic presents an essentially masculinist history, a pessimistic derogatory view giving little value to domestic traditions passed from mother to daughter. Women are mentioned only as authors of cookbooks produced throughout the 19th century and as the housewives whose role in the 1950s changed due to the introduction of labour-saving devices. Scant reference is made to the pre-eminent icon of Australian rural culinary history, the Country Women's Association1 and their recipe books. These books have gone through numerous editions from the 1920s, but Symons refers to them dismissively as a 'plain text' arising from the 'store-shelf of processed ingredients' (Symons 201). What of the 'vegie' patch, the afternoon tea? These traditions are mentioned, but only in passing. The products of arduous and loving baking are belittled as 'pretty things'. Is this because they are too difficult to document or because they are women's business? Female writers Barbara Santich and Marion Halligan have both written on the importance of these traditions in the lives of Australian women. Symons's discourse concentrates on 'industrial cuisine', but who is to say that its imperatives were not transgressed. The available data derives from recipe books, sales figures and advertising, but we don't actually know how much food came from other sources. Did your grandmother keep chickens? Did your grandfather fish? Terra Australis Culinae Nullius2 Michael Symons's precept is: This is the only continent which has not supported an agrarian society ... . Our land missed that fertile period when agriculture and cooking were created. There has never been the creative interplay between society and the soil. Almost no food has ever been grown by the person who eats it, almost no food has been preserved in the home and indeed, very little preparation is now done by a family cook. This is the uncultivated continent. Our history is without peasants. (10, our emphasis) This notion of terra Australis culinae nullius is problematic on two levels. The use of the word indigenous implies both Aboriginal and British settler culinary tradition. This statement consequently denies both traditional Aboriginal knowledge and the British traditions. The importance of Aboriginal foodways, their modern exploitation and their impact on the future of Australian cuisine needs recognition, but the complexity of the issue places it beyond the bounds of this paper. Symons's view of peasantry is a romanticised one, and says less about food and more about nostalgia for a more permanent, less changing environment. Advertising of 'ethnic' food routinely exploits this nostalgia by appropriating the image of the cheerful peasant. These advertisements perpetuate the mythologies that link pastoral images with 'family values'. These myths, or what Barthes describes as 'cultural truths', hold that migrant families all have harmonious relationships, are benevolently patriarchal and they all sit down to eat together. 'Ethnic' families are at one with the land and use recipes made from fresher, more natural produce, that are handed down through the female line and have had the benefit of generations of culinary wisdom. (See Gallegos & Mansfield.) So are the culinary traditions of Australians of British descent so different from those of migrant families? Joan, born near her home in Cunderdin in the Western Australian wheatbelt, grew up on a farm in reasonably prosperous circumstances with her six siblings. After marrying, she remained in the Cunderdin area to continue farming. Giovanna was born in 1915 on a farm four kilometres outside Vasto, in the Italian region of Abruzzi. One of seven children, her father died when she was young and at the age of twenty, she came to Australia to marry a Vastese man 12 years her senior. Maria was born in Madeira in 1946, in a coastal village near the capital Funchal. Like Giovanna she is the fifth of seven children and arrived in Australia at the age of twenty to marry. We used the information elicited from these three women to scrutinise some of the mythology surrounding ethnic families. Myth 1: 'Ethnic' families all eat together. All three women said their families had eaten together in the past and it was Joan who commented that what was missing in Australia today was people sitting down together to share a meal. Joan's farming community all came in for an extended midday meal from necessity, as the horses needed to be rested. Both women described radio, television, increasing work hours and different shifts as responsible for the demise of the family meal. Commensality is one of the common boundary markers for all groups 'indicating a kind of equality, peership, and the promise of further kinship links stemming from the intimate acts of dining together' (Nash 11). It is not only migrant families who eat together, and the demise of the family meal is more widely felt. Myth 2: Recipes in 'ethnic' families are passed down from generation to generation. Handing recipes down from generation to generation is not limited to just 'ethnic' families. All three women describe learning to cook from their mothers. Giovanna and Maria had hands-on experiences at very young ages, cooking for the family out of necessity. Joan did not have to cook for her family but her mother still taught her basic cookery as well as the finer points. The fluidity of the mother-daughter identity is expressed and documented by the handing on of recipes. Joan's community thought the recipes important enough to document in a written form, and so the West Australian version of the CWA cookbook became a reality. Joan, when asked about why the CWA developed a cookbook, replied that they wanted to record the recipes that were all well tried by women who spent the bulk of their days in the kitchen, cooking. Being taught to cook, teaching your children to cook and passing on recipes crosses borders, and does not serve to create or maintain boundaries. Myth 3: 'Ethnic' food is never prepared from processed products but always from homegrown produce. During their childhoods the range of food items purchased by the families was remarkably similar for all three women. All described buying tinned fish, rice and sugar, while the range of items produced from what was grown reflected common practices for the use and preservation of fresh produce. The major difference was the items that were in abundance, so while Joan describes pickling meat in addition to preserving fruits, Maria talks about preserving fish and Giovanna vegetables. The traditions developed around what was available. Joan and her family grew the food that they ate, preserved the food in their own home, and the family cook did all the preparation. To suggest they did not have a creative interplay with the soil is suggesting that they were unskilled in making a harsh landscape profitable. Joan's family could afford to buy more food items than the other families. Given the choice both Giovanna's and Maria's families would have only been too eager to make their lives easier. For example, on special occasions when the choice was available Giovanna's family chose store-bought pasta. The perception of the freshness and tastiness of peasant cuisine and affinity with the land obscures the issue, which for much of the world is still quantity, not quality. It would seem that these women's stories have points of reference. All three women describe the sense of community food engendered. They all remember sharing and swapping recipes. This sense of community was expressed by the sharing of food -- regardless of how little there was or what it was. The legacy lives on, while no longer feeling obliged to provide an elaborate afternoon tea as she did in her married life, visitors to Joan's home arrive to the smell of freshly baked biscuits shared over a cup of tea or coffee. Giovanna is only too eager to share her Vastese cakes with a cup of espresso coffee, and as new acquaintances we are obliged to taste each of the five different varieties of cakes and take some home. Maria, on the other hand, offered instant coffee and store-bought biscuits; having worked outside the home all her life and being thirty years younger than the other women, is this perhaps the face of modernity? The widespread anticipation of the divisions between these women has more to do with power relationships and the politics of east, west, north, south than with the realities of everyday life. The development of a style of eating will depend on your knowledge both as an individual and as a collective, the ingredients that are available at any one time, the conditions under which food has to be grown, and your own history. For the newly-arrived Southern Europeans meat was consumed in higher quantities because its availability was restricted in their countries of origin, to eat meat regularly was to increase your status in society. Interest in 'ethnic' food and its hybridisation is a global phenomenon and the creolisation of eating has been described both in America (see Garbaccia) and in Britain (James 81). The current obsession with the 'ethnic' has more to do with nostalgia than tolerance. The interviews which were conducted highlight the similarities between three women from different backgrounds despite differences in age and socioeconomic status. Our cuisine is in the process of hybridisation, but let us not forget who is manipulating this process and the agendas under which it is encouraged. To lay claim that one tradition is wonderful, while the other either does not exist or has nothing to offer, perpetuates divisive binaries. By focussing on what these women have in common rather than their differences we begin to critically interrogate the "culinary binary". It is our intention to stimulate debate that we hope will eventually lead to the encouragement of difference rather than the futile pursuit of authenticity. Footnotes 1. The Country Women's Association is an organisation that began in Australia in the 1920s. It is still operational and has as one of its primary aims the improvement of the welfare and conditions of women and children, especially those living in the country. 2. The term terra australis nullius is used to describe Australia at the point of colonisation. The continent was regarded as "empty" because the native people had neither improved nor settled on the land. We have extended this concept to incorporate cuisine. This notion of emptiness has influenced readings of Australian history which overlook the indigenous population and their relationship with the land. References Advisory Council on Multicultural Affairs. Towards A National Agenda for a Multicultural Australia. Canberra, 1988. Barthes, Roland. Mythologies. Trans. A. Lavers. London: Vintage, 1993. Belasco, Warren. "Ethnic Fast Foods: The Corporate Melting Pot". Food and Foodways 2.1 (1987): 1-30. Gallegos, Danielle, and Alan Mansfield. "Eclectic Gastronomes or Conservative Eaters: What Does Advertising Say?" Nutrition Unplugged, Proceedings of the 16th Dietitians Association of Australia National Conference. Hobart: Dietitians Association of Australia, 1997. Gallegos, Danielle, and Alan Mansfield. "Screen Cuisine: The Pastes, Powders and Potions of the Mediterranean Diet". Celebrate Food, Proceedings of the 17th Dietitians Association of Australia National Conference. Sydney: Dietitians Association of Australia, 1998. Garbaccia, D.R. We Are What We Eat: Ethnic Food and the Making of Americans. Boston: Harvard UP, 1998. Gunew, Sneja. "Denaturalising Cultural Nationalisms; Multicultural Readings of 'Australia'." Nation and Narration. Ed. Homi Bhabha. London: Routledge, 1990. 245-66. Gunew, Sneja. Introduction. Feminism and the Politics of Difference. Eds. S. Gunew and A. Yeatman. Sydney: Allen and Unwin, 1993. xiii-xxv. Halligan, Marion. Eat My Words. Melbourne: Angus & Robertson, 1990. Harvey, D. The Condition of Postmodernity. Oxford: Basil Blackwell, 1989. James, Alison. "How British Is British Food". Food, Health and Identity. Ed. P. Caplan. London: Routledge, 1997. 71-86. Mennell, Stephen. All Manners of Food: Eating and Taste in England and France from the Middle Ages to the Present. Oxford: Basil Blackwell, 1996. Nash, Manning. The Cauldron of Ethnicity in the Modern World. Chicago: U of Chicago P, 1989. Newman, Felicity. Didn't Your Mother Teach You Not to Talk with Your Mouth Full? Food, Families and Friction. Unpublished Masters Thesis, Murdoch University, Perth, Western Australia, 1997. Santich, Barbara. Looking for Flavour. Adelaide: Wakefield, 1996. Stratton, Jon, and Ien Ang. "Multicultural Imagined Communities: Cultural Difference and National Identity in Australia and the USA". Continuum 8.2 (1994): 124-58. Symons, Michael. One Continuous Picnic. Adelaide: Duck, 1992. Citation reference for this article MLA style: Danielle Gallegos, Felicity Newman. "What about the Women? Food, Migration and Mythology." M/C: A Journal of Media and Culture 2.7 (1999). [your date of access] <http://www.uq.edu.au/mc/9910/women.php>. Chicago style: Danielle Gallegos, Felicity Newman, "What about the Women? Food, Migration and Mythology," M/C: A Journal of Media and Culture 2, no. 7 (1999), <http://www.uq.edu.au/mc/9910/women.php> ([your date of access]). APA style: Danielle Gallegos, Felicity Newman. (1999) What about the women? Food, migration and mythology. M/C: A Journal of Media and Culture 2(7). <http://www.uq.edu.au/mc/9910/women.php> ([your date of access]).

APA, Harvard, Vancouver, ISO, and other styles

19

Thai, Tran Thanh, and Ngo Xuan Quang. "The Seasonal Variability in The Genus-Family Structure of Free-Living Nematode Communities in Organic Shrimp Farming Ponds, Ca Mau Province." VNU Journal of Science: Natural Sciences and Technology, March27, 2019. http://dx.doi.org/10.25073/2588-1140/vnunst.4864.

Full text

Abstract:

This study determined the seasonal variability of free-living nematode communities structure (genus/family level) in organic shrimp farms ponds in Tam Giang commune, Nam Can district, Ca Mau province. Based on the result of SIMPER analysis, the average similarity in nematode communities at genus level was low with 30.75% and 30.81% (in dry and rainy season, respectively). However, the average dissimilarity between seasons was considerably high with 71.75%. Terschellingia, Daptonema, and Parodontophora were main genera contributing to similarity/dissimilarity between seasons. At the family level, results of SIMPER analysis showed that the average similarity was low with 37.12% and 39.02% (dry and rainy, respectively). Additionally, the average dissimilarity between dry and rainy season was fairly high with 64.06%. Specifically, four families such as Linhomoeidae, Xyalidae, Axonolaimidae, and Chromadoridae were the main families contributing to similarity/dissimilarity between seasons. Differences in sediment environmental characteristics between dry and rainy season are the reason for dissimilarity in the nematode communities structure. The high abundance of genus Terschellingia, Daptonema, Parodontophora may be indicative of organic enrichment conditions in shrimp pond sediment in both seasons. Nematodes with their rapid adaptation to changing environments can be used as a potential tool for bio-indicator. Keywords Bio-indicator, Ca Mau province, nematode communities, organic shrimp farms ponds, simper analysis References [1] Lin, F. Y., Vo, A. H., Phan, V. B., Nguyen, T. T., Bryla, D., Tran, C. T., ... & Robbins, J. B., The epidemiology of typhoid fever in the Dong Thap Province, Mekong Delta region of Vietnam, The American journal of tropical medicine and hygiene 62(5) (2000) 644-648.[2] Semprucci F, Moreno M, Sbrocca S, Rocchi M, AlbertelliG, Balsamo, M., The nematode assemblage as a tool for the assessment of marine ecological quality status: a case-study in the Central Adriatic Sea, Mediterranean Marine Science 14(1) (2013) 48-57.[3] Ngo, Q. X., Nguyen, N. C., Nguyen, D. T., & Vanreusel, A., Distribution pattern of free living nematode communities in the eight Mekong estuaries by seasonal factor, Journal of Vietnamese Environment 4(1) (2013) 28-33.[4] Heip, C., Vincx, M., Vranken G., The ecology of marine nematodes, Oceanography and Marine Biology: An Annual Review 23 (1985) 399-489.[5] Hodda, M., Nicholas, W.L., Nematode diversity and industrial pollution in the Hunter River Estuary, NSW, Australia, Marine Pollution Bulletin 17 (1986) 251-255.[6] Alongi D.M., Intertidal zonation and seasonality of meiobenthos in tropical mangrove estuaries, Marine Biology 95 (1987) 447-458.[7] Tudorancea, C., & Zullini, A., Associations and distribution of benthic nematodes in the Ethiopian Rift Valley lakes, Hydrobiologia, 179(1) (1989) 81-96.[8] Hodda M., Nicholas W.L., Production of meiofauna in an Australian estuary, Wetland 9 (1990) 41-48.[9] Beier, S., & Traunspurger, W., Seasonal distribution of free-living nematodes in the Körsch, a coarse-grained submountain carbonate stream in southwest Germany, Nematology 5(4) (2003) 481-504.[10] Hourston, M., Potter, I. C., Warwick, R. M., Valesini, F. J., & Clarke, K. R., Spatial and seasonal variations in the ecological characteristics of the free-living nematode assemblages in a large microtidal estuary, Estuarine, Coastal and Shelf Science 82(2) (2009) 309-322.[11] Tran, T.T., Pham, T.L., Nguyen, T., Ngo, X. Q., Relationship of free-lingving nematode communities to some environmental characteristics in the organic shrimp farms, Ca Mau province, Vietnam Journal of Science and Technology 56(5) (2018).[12] Tran, T. T., Nguyen, T. M. Y., Nguyen, T., Ngo, X. Q., Meiofauna in the mangrove–shrimp farms ponds, Ca Mau province, Vietnam Journal of Science and Technology 55(3) (2017) 271.[13] El Hag E. A., Food and food selection of the Penaeid prawn Penaeus monodon (Fabricius), In Limnology and Marine Biology in the Sudan, Springer Netherlands, (1984) 213-217.[14] Chong V. C., Sasekumar A., Food and feeding habits of the white prawn Penaeus merguiensis, Marine ecology progress series 5 (20) (1981) 185-191.[15] Nguyen Thi My Yen, Tran Thanh Thai, Nguyen Tan Duc, Ngo Xuan Quang, Free living nematode communities as fundamental food for shrimps in the ecological - model of mangrove - shrimp farming ponds, Nam Can district, Ca Mau province, Vietnam Journal of Biotechnology, 16(3) (2018), 581 -588.[16] Clarke, K.R. and Gorley, R.N., PRIMER v6: User Manual/Tutorial PRIMER-E: Plymouth (2006).[17] Ingels, J., Tchesunov, A. V. and Vanreusel, A., Meiofauna in the Gollum Channels and the Whittard Canyon, Celtic Margin—how local environmental conditions shape nematode structure and function, PLoS One 6(5) (2011) e20094.[18] Cai, L., Fu, S., Yang, J. and Zhou, X., Distribution of meiofaunal abundance in relation to environmental factors in Beibu Gulf, South China Sea, Acta Oceanologica Sinica 31(6) (2012) 92-103.[19] Ngo, X. Q., Smol, N. and Vanreusel, A., The meiofauna distribution in correlation with environmental characteristics in 5 Mekong estuaries, Vietnam, Cahiers de Biologie Marine 54 (2013) 71 -83.[20] Górska, B., Grzelak, K., Kotwicki, L., Hasemann, C., Schewe, I., Soltwedel, T. and W łodarska-Kowalczuk, M., Bathymetric variations in vertical distribution patterns of meiofauna in the surface sediments of the deep Arctic ocean (HAUSGARTEN, Fram strait), Deep Sea Research Part I: Oceanographic Research 91 (2014) 36-49.[21] Mueller, M., Pander, J., & Geist, J., The effects of weirs on structural stream habitat and biological communities, Journal of Applied Ecology 48(6) (2011) 1450-1461.[22] Schratzberger, M., Warr, K., Rogers, S. I., Patterns of nematode populations in the southwestern North Sea and their link to other components of the benthic fauna, Journal of Sea Research 55 (2006) 113–127.[23] Moreno, M., Albertelli, G., and Fabiano, M., Nematode response to metal, PAHs and organic enrichment in tourist marinas of the mediterranean sea, Marine Pollution Bulletin 58(8) (2009) 1192-1201.[24] Alves, A. S., Adão, H., Ferrero, T. J., Marques, J. C., Costa, M. J., & Patrício, J., Benthic meiofauna as indicator of ecological changes in estuarine ecosystems: the use of nematodes in ecological quality assessment, Ecological Indicators 24 (2013) 462-475.[25] Moreno, M., Semprucci, F., Vezzulli, L., Balsamo, M., Fabiano, M., & Albertelli, G., The use of nematodes in assessing ecological quality status in the Mediterranean (2) (2011) 328-336.

APA, Harvard, Vancouver, ISO, and other styles

20

Green, Lelia. "Scanning the Satellite Signal in Remote Western Australia." M/C Journal 8, no.4 (August1, 2005). http://dx.doi.org/10.5204/mcj.2379.

Full text

Abstract:

I can remember setting up the dish, all the excitement of assembling it [...] and then putting the motor on. And in the late afternoon, you position the dish and kind of turn it, to find the right spot, and all of a sudden on this blank television screen there was an image that came on. And it was shocking knowing that this noise and this thing would be there, and begin to infiltrate – because I see it as an infiltration, I see it as invasion – I’m not mad on television, very choosy really about what I watch – and I see it as an invasion, and there was GWN as well as the ABC. I just thought ‘by golly, I’m in the process of brain-washing people to accept stuff without thinking about it, like consciously considering either side of any case’ [...] The one thing that protected you from having it on at all times was the need to put on the generator in order to power it. I felt a bit sad actually. (Savannah Kingston, Female, 55+ – name changed – homestead respondent) This paper addresses the huge communications changes that occurred over the past fifty years in outback Western Australia. (What happened in WA also has parallels with equivalent events in the Northern Territory, Queensland, in the larger properties in western New South Wales and northern South Australia.) Although the ‘coming of television’ – associated in remote areas with using a satellite dish to scan for the incoming signal – is typically associated with a major shift in community and cultural life, the evidence suggests that the advent of the telephone had an equivalent or greater impact in remote areas. With the introduction of the telephone, the homestead family no longer had to tune into (or scan) the radio frequencies to check on predicted weather conditions, to respond to emergencies, to engage in roll call or to hold a ‘public meeting’. As the scanning of the radio frequencies ended, so the scanning of the satellite signals began. As Sandstone resident Grant Coleridge (pseudonym, male, 40-54) said, only half ironically, “We got the telephone and the telly at the same time, so civilisation sort of hit altogether actually.” The scale and importance of changes to the technological communications infrastructure in remote WA within a single life-time spans pre-2-way radio to video livestock auctions by satellite. It comes as a surprise to most Australians that these changes have occurred in the past generation. As recent viewers of the unexpectedly-successful Mongolian film The Story of the Weeping Camel (2004) would know, one of the themes of the Oscar-nominated movie is the coming of television and its impact upon a traditional rural life. The comparative availability of television outside the rural areas of Mongolia – and its attraction to, particularly, the younger family members in the Weeping Camel household – is a motif that is explored throughout the narrative, with an unspoken question about the price to be paid for including television in the cultural mix. It’s easy to construct this story as a fable about the ‘exotic other’, but the same theme was played out comparatively recently in remote Western Australia, where the domestic satellite service AUSSAT first made television an affordable option just under twenty years ago. This paper is about the people in remote Western Australia who started scanning for the satellite signal in 1986, and stopped scanning for the RFDS (Royal Flying Doctor Service) 2-way radio phone messages at about the same time. Savannah Kingston (name changed), who in 1989 generously agreed to an in-depth interview discussing the impact of satellite broadcasting upon her outback life, was a matriarch on a rural property with four grown children. She had clear views upon ways in which life had changed dramatically in the generation before the satellite allowed the scanning of the television signal. Her recollection of the weft and warp of the tapestry of life in outback WA started thirty-five years previously, with her arrival on the station as a young wife: When I went there [mid-1950s], we had a cook and we ate in the dining room. The cook and anyone who worked in the house ate in the kitchen and the men outside ate in the outside. So, with the progress of labour away from the bush, and the cost of labour becoming [prohibitive] for a lot of people, we got down to having governesses or house-girls. If the house-girls were white, they ate at the table with us and the governesses ate with us. If the house-girls were Aboriginal, they didn’t like eating with us, and they preferred to eat in the kitchen. The kids ate with them. Which wasn’t a good idea because two of my children have good manners and two of them have appalling manners. The availability of domestic help supported a culture of hospitality reminiscent of British between-the-wars country house parties, recreated in Agatha Christie novels and historically-based films such as The Remains of the Day (1993): In those early days, we still had lots of visitors [...] People visited a lot and stayed, so that you had people coming to stay for maybe two or three days, five days, a week, two weeks at a time and that required a lot of organisation. [int:] WHERE DID YOUR VISITORS COME FROM? City, or from the Eastern states, occasionally from overseas. [Int:] WOULD THEY BE RELATIVES? Sometimes relatives, friends or someone passing through who’d been, you know, someone would say ‘do visit’ and they’d say ‘they’d love to see you’. But it was lovely, it was good. It’s a way of learning what’s going on. (Savannah Kingston.) The ‘exotic other’ of the fabled hospitality of station life obscures the fact that visitors from the towns, cities and overseas were a major source of news and information in a society where radio broadcasts were unpredictable and there was no post or newspaper delivery. Visitors were supplemented by a busy calendar of social events that tied together a community of settlements in gymkhanas, cricket fixtures and golf tournaments (on a dirt course). Shifts in the communications environment – the introduction of television and telephone – followed a generation of social change witnessing the metamorphosis of the homestead from the hub of a gentrified lifestyle (with servants, governesses, polo and weekends away) to compact, efficient business-units, usually run by a skeleton staff with labour hired in at the peak times of year. Over the years between the 1960s-1980s isolation became a growing problem. Once Indigenous people won the fight for award-rate wages their (essentially) unpaid labour could no longer support the lifestyle of the station owners and the absence of support staff constrained opportunities for socialising off the property, and entertaining on it, and the communication environment became progressively poorer. Life on the homestead was conceived of as being more fragile than that in the city, and more economically vulnerable to a poor harvest or calamities such as wildfire. The differences wrought by the introduction of newer communication technologies were acknowledged by those in the country, but there was a clear resistance to city-dwellers constructing the changes as an attack upon the romance of the outback lifestyle. When the then Communications Minister Tony Staley suggested in 1979 that a satellite could help “dispel the distance – mental as well as geographical – between urban and regional dwellers, between the haves and the have-nots in a communication society”, he was buying into a discourse of rural life which effectively disempowered those who lived in rural and remote areas. He was also ignoring the reality of a situation where the Australian outback was provided with satellite communication a decade after it was made available to Canadians, and where the king-maker in the story – Kerry Packer – stood to reap a financial windfall. There was a mythological dimension to Australia (finally) having a domestic satellite. Cameron Hazelhurst’s article on ‘The Dawn of the Satellite Era in Australia’ includes a colourful account of Kerry Packer’s explanation to Prime Minister Malcolm Fraser of the capacity of domestic satellites to bring television, radio and telephone services to isolated communities in arctic Canada: And I [Packer] went and saw the Prime Minister and I explained to him my understanding of what was happening in those areas, and to his undying credit he grasped on to it immediately and said ‘Of course, it’s what we want. It’s exactly the sort of thing we need to stop the drift of people into urban areas. We can keep them informed. We can allow them to participate in whatever’s happening around the nation (Day 7, cited in Hazelhurst). Fraser here, as someone with experience of running a rural property in Victoria, propounds a pro-country rhetoric as a rationale for deployment of the satellite in terms of the Australian national policy agenda. (The desire of Packer to network his television stations and couple efficiency with reach is not addressed in this mythological reconstruction.) It is difficult, sometimes, to appreciate the level of isolation experienced on outback properties at the time. As Bryan Docker (male, 40-54), a resident of Broome at the time of the interviews, commented, “Telegrams, in those days, were the life-blood of the stations, through the Flying Doctor Service. But at certain times of the year the sun spots would interfere with the microwave links and we were still on morse from Broome to Derby during those periods.” Without reliable shortwave radio; with no television, newspapers or telephone; and with the demands of keeping the RFDS (Royal Flying Doctor Service) 2-way radio channel open for emergencies visitors were one of the ways in which station-dwellers could maintain an awareness of current events. Even at the time of the interviews, after the start of satellite broadcasting, I never travelled to an outback property without taking recent papers and offering to pick up post. (Many of the stations were over an hour’s journey from their nearest post office.) The RFDS 2-way radio service offered a social-lifeline as well as an emergency communication system: [Int:] DO YOU MISS THE ROYAL FLYING DOCTOR SERVICE AT ALL? Yes, I do actually. It’s – I think it’s probably more lonely now because you used to switch it on and – you know if you’re here on your own like I am a lot – and you’d hear voices talking, and you used to know what everybody was doing – sort of all their dramas and all their [...] Now you don’t know anything that’s going on and unless somebody rings you, you don’t have that communication, where before you used to just hop over to another channel and have a chat [...] I think it is lonelier on the telephone because it costs so much to ring up. (Felicity Rohrer, female, 40-54, homestead.) Coupled with the lack of privacy of 2-way radio communication, and the lack of broadcasting, was the particular dynamic of a traditional station family. Schooled at home, and integrated within their homestead lifestyle, station children spent most of their formative years in the company of one or other of their parents (or, in previous decades, the station staff). This all changed at secondary school age when the children of station-owners and managers tended to be sent away to boarding school in the city. Exposure of the next generation to the ways of city life was seen as a necessary background to future business competence, but the transitions from ‘all’ to ‘next-to-nothing’ in terms of children’s integration within family life had a huge socio-emotional cost which was aggravated, until the introduction of the phone service, by the lack of private communication channels. Public Relations and news theory talk about the importance of the ‘environmental scan’ to understand how current events are going to impact upon a business and a family: for many years in outback Australia the environmental scan occurred when families got together (typically in the social and sporting rounds), on the RFDS radio broadcasts and ‘meetings’, in infrequent visits to the closest towns and through the giving and receiving of hospitality. Felicity Rohrer, who commented (above) about how she missed the RFDS had noted earlier in her interview: “It’s made a big difference, telephone. That was the most isolating thing, especially when your children were away at school or your parents are getting older [...] That was the worst thing, not having a phone.” Further, in terms of the economics of running a property, Troy Bowen (male, 25-39, homestead respondent) noted that the phone had made commercial life much easier: I can carry out business on the phone without anyone else hearing [...] On the radio you can’t do it, you more or less have to say ‘well, have you got it – over’. ‘Yeah – over’. ‘Well, I’ll take it – over’. That’s all you can do [...] Say if I was chasing something [...] the cheapest I might get it down to might be [...] $900. Well I can go to the next bloke and I can tell him I got it down to $850. If you can’t do any better than that, you miss out. ‘oh, yes, alright $849, that’s the best I can do.’ So I’ll say ‘alright, I’ll take it’. But how can you do that on the radio and say that your best quote is [$850] when the whole district knows that ‘no, it isn’t’. You can’t very well do it, can you? This dynamic occurs because, for many homestead families prior to the telephone, the RFDS broadcasts were continuously monitored by the women of the station as a way of keeping a finger on the pulse of the community. Even – sometimes, especially – when they were not part of the on-air conversation, the broadcast could be received for as far as reception was possible. The introduction of the phone led to a new level of privacy, particularly appreciated by parents who had children away at school, but also introduced new problems. Fran Coleridge, (female, 40-54, Sandstone) predicted that: The phone will lead to isolation. There’s an old lady down here, she’s about 80, and she housekeeps for her brother and she’s still wearing – her mother died 50 years ago – but she’s still wearing her clothes. She is so encapsulated in her life. And she used to have her [RFDS] transceiver. Any time, Myrtle would know anything that’s going on. Anything. Birthday party at [local station], she’d know about it. She knew everything. Because she used to have the transceiver on all the time. And now there’s hardly any people on, and she’s a poor little old lonely lady that doesn’t hear anything now. Can you see that? Given the nuances of the introduction of the telephone (and the loss of the RFDS 2-way), what was the perceived impact of satellite broadcasting? Savannah Kingston again: Where previously we might have sat around the table and talked about things – at least the kids and I would – with television there is now more of a habit of coming in, showering and changing for dinner, putting on the motor and the men go and sit in front of the television during [...] six o’clock onwards, news programs and whatnot and um, I find myself still in the kitchen, getting the meal and then whoever was going to eat it, wanting to watch whatever was on the television. So it changed quite appreciably. Felicity Rohrer agrees: [Int:] DO YOU THINK THERE HAVE BEEN CHANGES IN THE TIME THAT YOU SPEND WITH EACH OTHER? Yes, I think so. They [the homestead household] come home and they – we all sit down here and look at the news and have a drink before tea whereas people used to be off doing their own tea. [Int] SO YOU THINK IT’S INCREASED THE AMOUNT OF TIME YOU SPEND TOGETHER? Yes, I think so – well, as a family. They all try and be home by 6 to see the [GWN] news. If they miss that, we look at the 7 o’clock [ABC], but they like the Golden West because it’s got country news in it. But the realities of everyday life, as experienced in domestic contexts, are sometimes ignored by commentators and analysts, except insofar as they are raised by interviewees. Thus the advent of the satellite might have made Savannah Kingston feel “a bit sad actually”, but it had its compensations: It was definitely a bit of a peace-maker. It sort of meant there wasn’t the stress that we had previously when going through [...] at least people sitting and watching something, you’re not so likely to get into arguments or [...] It definitely had value there. In fact, when I think about it, that might be one of its major applications, ’cos a lot of men in the bush tend to come in – if they drink to excess they start drinking in the evening, and that can make for very uncomfortable company. For film-makers like the Weeping Camel crew – and for audiences and readers of historical accounts of life in outback Australia – the changes heralded by the end of scanning the RFDS channels, and the start of scanning for satellite channels, may seem like the end of an era. In some ways the rhythms of broadcasting helped to homogenise life in the country with life in the city. For many families in remote homes, as well as the metropolis, the evening news became a cue for the domestic rituals of ‘after work’. A superficial evaluation of communications changes might lead to a consideration of how some areas of life were threatened by improved broadcasting, while others were strengthened, and how some of the uniqueness of a lifestyle had been compromised by an absorption into the communication patterns of urban life. It is unwise for commentators to construct the pre-television past as an uncomplicated romantic prior-time, however. Interviews with those who live such changes as their reality become a more revealing indicator of the nuances and complexities of communications environments than a quick scan from the perspective of the city-dweller. References Day, C. “Packer: The Man and the Message.” The Video Age (February 1983): 7 (cited in Hazelhurst). Hazelhurst, Cameron. “The Dawn of the Satellite Era.” Media Information Australia 58 (November 1990): 9-22. Staley, Tony. Commonwealth Parliamentary Debates. Canberra: House of Representatives Hansard (18 October 1979): 2225, 2228-9. The Remains of the Day. 1993. The Story of the Weeping Camel. Thinkfilm and National Geographic, 2004. Citation reference for this article MLA Style Green, Lelia. "Scanning the Satellite Signal in Remote Western Australia." M/C Journal 8.4 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0508/01-green.php>. APA Style Green, L. (Aug. 2005) "Scanning the Satellite Signal in Remote Western Australia," M/C Journal, 8(4). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0508/01-green.php>.

APA, Harvard, Vancouver, ISO, and other styles

21

Goggin, Gerard. "Broadband." M/C Journal 6, no.4 (August1, 2003). http://dx.doi.org/10.5204/mcj.2219.

Full text

Abstract:

Connecting I’ve moved house on the weekend, closer to the centre of an Australian capital city. I had recently signed up for broadband, with a major Australian Internet company (my first contact, cf. Turner). Now I am the proud owner of a larger modem than I have ever owned: a white cable modem. I gaze out into our new street: two thick black cables cosseted in silver wire. I am relieved. My new home is located in one of those streets, double-cabled by Telstra and Optus in the data-rush of the mid-1990s. Otherwise, I’d be moth-balling the cable modem, and the thrill of my data percolating down coaxial cable. And it would be off to the computer supermarket to buy an ASDL modem, then to pick a provider, to squeeze some twenty-first century connectivity out of old copper (the phone network our grandparents and great-grandparents built). If I still lived in the country, or the outskirts of the city, or anywhere else more than four kilometres from the phone exchange, and somewhere that cable pay TV will never reach, it would be a dish for me — satellite. Our digital lives are premised upon infrastructure, the networks through which we shape what we do, fashion the meanings of our customs and practices, and exchange signs with others. Infrastructure is not simply the material or the technical (Lamberton), but it is the dense, fibrous knotting together of social visions, cultural resources, individual desires, and connections. No more can one easily discern between ‘society’ and ‘technology’, ‘carriage’ and ‘content’, ‘base’ and ‘superstructure’, or ‘infrastructure’ and ‘applications’ (or ‘services’ or ‘content’). To understand telecommunications in action, or the vectors of fibre, we need to consider the long and heterogeneous list of links among different human and non-human actors — the long networks, to take Bruno Latour’s evocative concept, that confect our broadband networks (Latour). The co-ordinates of our infrastructure still build on a century-long history of telecommunications networks, on the nineteenth-century centrality of telegraphy preceding this, and on the histories of the public and private so inscribed. Yet we are in the midst of a long, slow dismantling of the posts-telegraph-telephone (PTT) model of the monopoly carrier for each nation that dominated the twentieth century, with its deep colonial foundations. Instead our New World Information and Communication Order is not the decolonising UNESCO vision of the late 1970s and early 1980s (MacBride, Maitland). Rather it is the neoliberal, free trade, market access model, its symbol the 1984 US judicial decision to require the break-up of AT&T and the UK legislation in the same year that underpinned the Thatcherite twin move to privatize British Telecom and introduce telecommunications competition. Between 1984 and 1999, 110 telecommunications companies were privatized, and the ‘acquisition of privatized PTOs [public telecommunications operators] by European and American operators does follow colonial lines’ (Winseck 396; see also Mody, Bauer & Straubhaar). The competitive market has now been uneasily installed as the paradigm for convergent communications networks, not least with the World Trade Organisation’s 1994 General Agreement on Trade in Services and Annex on Telecommunications. As the citizen is recast as consumer and customer (Goggin, ‘Citizens and Beyond’), we rethink our cultural and political axioms as well as the axes that orient our understandings in this area. Information might travel close to the speed of light, and we might fantasise about optical fibre to the home (or pillow), but our terrain, our band where the struggle lies today, is narrower than we wish. Begging for broadband, it seems, is a long way from warchalking for WiFi. Policy Circuits The dreary everyday business of getting connected plugs the individual netizen into a tangled mess of policy circuits, as much as tricky network negotiations. Broadband in mid-2003 in Australia is a curious chimera, welded together from a patchwork of technologies, old and newer communications industries, emerging economies and patterns of use. Broadband conjures up grander visions, however, of communication and cultural cornucopia. Broadband is high-speed, high-bandwidth, ‘always-on’, networked communications. People can send and receive video, engage in multimedia exchanges of all sorts, make the most of online education, realise the vision of home-based work and trading, have access to telemedicine, and entertainment. Broadband really entered the lexicon with the mass takeup of the Internet in the early to mid-1990s, and with the debates about something called the ‘information superhighway’. The rise of the Internet, the deregulation of telecommunications, and the involuted convergence of communications and media technologies saw broadband positioned at the centre of policy debates nearly a decade ago. In 1993-1994, Australia had its Broadband Services Expert Group (BSEG), established by the then Labor government. The BSEG was charged with inquiring into ‘issues relating to the delivery of broadband services to homes, schools and businesses’. Stung by criticisms of elite composition (a narrow membership, with only one woman among its twelve members, and no consumer or citizen group representation), the BSEG was prompted into wider public discussion and consultation (Goggin & Newell). The then Bureau of Transport and Communications Economics (BTCE), since transmogrified into the Communications Research Unit of the Department of Communications, Information Technology and the Arts (DCITA), conducted its large-scale Communications Futures Project (BTCE and Luck). The BSEG Final report posed the question starkly: As a society we have choices to make. If we ignore the opportunities we run the risk of being left behind as other countries introduce new services and make themselves more competitive: we will become consumers of other countries’ content, culture and technologies rather than our own. Or we could adopt new technologies at any cost…This report puts forward a different approach, one based on developing a new, user-oriented strategy for communications. The emphasis will be on communication among people... (BSEG v) The BSEG proposed a ‘National Strategy for New Communications Networks’ based on three aspects: education and community access, industry development, and the role of government (BSEG x). Ironically, while the nation, or at least its policy elites, pondered the weighty question of broadband, Australia’s two largest telcos were doing it. The commercial decision of Telstra/Foxtel and Optus Vision, and their various television partners, was to nail their colours (black) to the mast, or rather telegraph pole, and to lay cable in the major capital cities. In fact, they duplicated the infrastructure in cities such as Sydney and Melbourne, then deciding it would not be profitable to cable up even regional centres, let alone small country towns or settlements. As Terry Flew and Christina Spurgeon observe: This wasteful duplication contrasted with many other parts of the country that would never have access to this infrastructure, or to the social and economic benefits that it was perceived to deliver. (Flew & Spurgeon 72) The implications of this decision for Australia’s telecommunications and television were profound, but there was little, if any, public input into this. Then Minister Michael Lee was very proud of his anti-siphoning list of programs, such as national sporting events, that would remain on free-to-air television rather than screen on pay, but was unwilling, or unable, to develop policy on broadband and pay TV cable infrastructure (on the ironies of Australia’s television history, see Given’s masterly account). During this period also, it may be remembered, Australia’s Internet was being passed into private hands, with the tendering out of AARNET (see Spurgeon for discussion). No such national strategy on broadband really emerged in the intervening years, nor has the market provided integrated, accessible broadband services. In 1997, landmark telecommunications legislation was enacted that provided a comprehensive framework for competition in telecommunications, as well as consolidating and extending consumer protection, universal service, customer service standards, and other reforms (CLC). Carrier and reseller competition had commenced in 1991, and the 1997 legislation gave it further impetus. Effective competition is now well established in long distance telephone markets, and in mobiles. Rivalrous competition exists in the market for local-call services, though viable alternatives to Telstra’s dominance are still few (Fels). Broadband too is an area where there is symbolic rivalry rather than effective competition. This is most visible in advertised ADSL offerings in large cities, yet most of the infrastructure for these services is comprised by Telstra’s copper, fixed-line network. Facilities-based duopoly competition exists principally where Telstra/Foxtel and Optus cable networks have been laid, though there are quite a number of ventures underway by regional telcos, power companies, and, most substantial perhaps, the ACT government’s TransACT broadband network. Policymakers and industry have been greatly concerned about what they see as slow takeup of broadband, compared to other countries, and by barriers to broadband competition and access to ‘bottleneck’ facilities (such as Telstra or Optus’s networks) by potential competitors. The government has alternated between trying to talk up broadband benefits and rates of take up and recognising the real difficulties Australia faces as a large country with a relative small and dispersed population. In March 2003, Minister Alston directed the ACCC to implement new monitoring and reporting arrangements on competition in the broadband industry. A key site for discussion of these matters has been the competition policy institution, the Australian Competition and Consumer Commission, and its various inquiries, reports, and considerations (consult ACCC’s telecommunications homepage at http://www.accc.gov.au/telco/fs-telecom.htm). Another key site has been the Productivity Commission (http://www.pc.gov.au), while a third is the National Office on the Information Economy (NOIE - http://www.noie.gov.au/projects/access/access/broadband1.htm). Others have questioned whether even the most perfectly competitive market in broadband will actually provide access to citizens and consumers. A great deal of work on this issue has been undertaken by DCITA, NOIE, the regulators, and industry bodies, not to mention consumer and public interest groups. Since 1997, there have been a number of governmental inquiries undertaken or in progress concerning the takeup of broadband and networked new media (for example, a House of Representatives Wireless Broadband Inquiry), as well as important inquiries into the still most strategically important of Australia’s companies in this area, Telstra. Much of this effort on an ersatz broadband policy has been piecemeal and fragmented. There are fundamental difficulties with the large size of the Australian continent and its harsh terrain, the small size of the Australian market, the number of providers, and the dominant position effectively still held by Telstra, as well as Singtel Optus (Optus’s previous overseas investors included Cable & Wireless and Bell South), and the larger telecommunications and Internet companies (such as Ozemail). Many consumers living in metropolitan Australia still face real difficulties in realising the slogan ‘bandwidth for all’, but the situation in parts of rural Australia is far worse. Satellite ‘broadband’ solutions are available, through Telstra Countrywide or other providers, but these offer limited two-way interactivity. Data can be received at reasonable speeds (though at far lower data rates than how ‘broadband’ used to be defined), but can only be sent at far slower rates (Goggin, Rural Communities Online). The cultural implications of these digital constraints may well be considerable. Computer gamers, for instance, are frustrated by slow return paths. In this light, the final report of the January 2003 Broadband Advisory Group (BAG) is very timely. The BAG report opens with a broadband rhapsody: Broadband communications technologies can deliver substantial economic and social benefits to Australia…As well as producing productivity gains in traditional and new industries, advanced connectivity can enrich community life, particularly in rural and regional areas. It provides the basis for integration of remote communities into national economic, cultural and social life. (BAG 1, 7) Its prescriptions include: Australia will be a world leader in the availability and effective use of broadband...and to capture the economic and social benefits of broadband connectivity...Broadband should be available to all Australians at fair and reasonable prices…Market arrangements should be pro-competitive and encourage investment...The Government should adopt a National Broadband Strategy (BAG 1) And, like its predecessor nine years earlier, the BAG report does make reference to a national broadband strategy aiming to maximise “choice in work and recreation activities available to all Australians independent of location, background, age or interests” (17). However, the idea of a national broadband strategy is not something the BAG really comes to grips with. The final report is keen on encouraging broadband adoption, but not explicit on how barriers to broadband can be addressed. Perhaps this is not surprising given that the membership of the BAG, dominated by representatives of large corporations and senior bureaucrats was even less representative than its BSEG predecessor. Some months after the BAG report, the Federal government did declare a broadband strategy. It did so, intriguingly enough, under the rubric of its response to the Regional Telecommunications Inquiry report (Estens), the second inquiry responsible for reassuring citizens nervous about the full-privatisation of Telstra (the first inquiry being Besley). The government’s grand $142.8 million National Broadband Strategy focusses on the ‘broadband needs of regional Australians, in partnership with all levels of government’ (Alston, ‘National Broadband Strategy’). Among other things, the government claims that the Strategy will result in “improved outcomes in terms of services and prices for regional broadband access; [and] the development of national broadband infrastructure assets.” (Alston, ‘National Broadband Strategy’) At the same time, the government announced an overall response to the Estens Inquiry, with specific safeguards for Telstra’s role in regional communications — a preliminary to the full Telstra sale (Alston, ‘Future Proofing’). Less publicised was the government’s further initiative in indigenous telecommunications, complementing its Telecommunications Action Plan for Remote Indigenous Communities (DCITA). Indigenous people, it can be argued, were never really contemplated as citizens with the ken of the universal service policy taken to underpin the twentieth-century government monopoly PTT project. In Australia during the deregulatory and re-regulatory 1990s, there was a great reluctance on the part of Labor and Coalition Federal governments, Telstra and other industry participants, even to research issues of access to and use of telecommunications by indigenous communicators. Telstra, and to a lesser extent Optus (who had purchased AUSSAT as part of their licence arrangements), shrouded the issue of indigenous communications in mystery that policymakers were very reluctant to uncover, let alone systematically address. Then regulator, the Australian Telecommunications Authority (AUSTEL), had raised grave concerns about indigenous telecommunications access in its 1991 Rural Communications inquiry. However, there was no government consideration of, nor research upon, these issues until Alston commissioned a study in 2001 — the basis for the TAPRIC strategy (DCITA). The elision of indigenous telecommunications from mainstream industry and government policy is all the more puzzling, if one considers the extraordinarily varied and significant experiments by indigenous Australians in telecommunications and Internet (not least in the early work of the Tanami community, made famous in media and cultural studies by the writings of anthropologist Eric Michaels). While the government’s mid-2003 moves on a ‘National Broadband Strategy’ attend to some details of the broadband predicament, they fall well short of an integrated framework that grasps the shortcomings of the neoliberal communications model. The funding offered is a token amount. The view from the seat of government is a glance from the rear-view mirror: taking a snapshot of rural communications in the years 2000-2002 and projecting this tableau into a safety-net ‘future proofing’ for the inevitable turning away of a fully-privately-owned Telstra from its previously universal, ‘carrier of last resort’ responsibilities. In this aetiolated, residualist policy gaze, citizens remain constructed as consumers in a very narrow sense in this incremental, quietist version of state securing of market arrangements. What is missing is any more expansive notion of citizens, their varied needs, expectations, uses, and cultural imaginings of ‘always on’ broadband networks. Hybrid Networks “Most people on earth will eventually have access to networks that are all switched, interactive, and broadband”, wrote Frances Cairncross in 1998. ‘Eventually’ is a very appropriate word to describe the parlous state of broadband technology implementation. Broadband is in a slow state of evolution and invention. The story of broadband so far underscores the predicament for Australian access to bandwidth, when we lack any comprehensive, integrated, effective, and fair policy in communications and information technology. We have only begun to experiment with broadband technologies and understand their evolving uses, cultural forms, and the sense in which they rework us as subjects. Our communications networks are not superhighways, to invoke an enduring artefact from an older technology. Nor any longer are they a single ‘public’ switched telecommunications network, like those presided over by the post-telegraph-telephone monopolies of old. Like roads themselves, or the nascent postal system of the sixteenth century, broadband is a patchwork quilt. The ‘fibre’ of our communications networks is hybrid. To be sure, powerful corporations dominate, like the Tassis or Taxis who served as postmasters to the Habsburg emperors (Briggs & Burke 25). Activating broadband today provides a perspective on the path dependency of technology history, and how we can open up new threads of a communications fabric. Our options for transforming our multitudinous networked lives emerge as much from everyday tactics and strategies as they do from grander schemes and unifying policies. We may care to reflect on the waning potential for nation-building technology, in the wake of globalisation. We no longer gather our imagined community around a Community Telephone Plan as it was called in 1960 (Barr, Moyal, and PMG). Yet we do require national and international strategies to get and stay connected (Barr), ideas and funding that concretely address the wider dimensions of access and use. We do need to debate the respective roles of Telstra, the state, community initiatives, and industry competition in fair telecommunications futures. Networks have global reach and require global and national integration. Here vision, co-ordination, and resources are urgently required for our commonweal and moral fibre. To feel the width of the band we desire, we need to plug into and activate the policy circuits. Thanks to Grayson Cooke, Patrick Lichty, Ned Rossiter, John Pace, and an anonymous reviewer for helpful comments. Works Cited Alston, Richard. ‘ “Future Proofing” Regional Communications.’ Department of Communications, Information Technology and the Arts, Canberra, 2003. 17 July 2003 <http://www.dcita.gov.au/Article/0,,0_1-2_3-4_115485,00.php> —. ‘A National Broadband Strategy.’ Department of Communications, Information Technology and the Arts, Canberra, 2003. 17 July 2003 <http://www.dcita.gov.au/Article/0,,0_1-2_3-4_115486,00.php>. Australian Competition and Consumer Commission (ACCC). Broadband Services Report March 2003. Canberra: ACCC, 2003. 17 July 2003 <http://www.accc.gov.au/telco/fs-telecom.htm>. —. Emerging Market Structures in the Communications Sector. Canberra: ACCC, 2003. 15 July 2003 <http://www.accc.gov.au/pubs/publications/utilities/telecommu... ...nications/Emerg_mar_struc.doc>. Barr, Trevor. new media.com: The Changing Face of Australia’s Media and Telecommunications. Sydney: Allen & Unwin, 2000. Besley, Tim (Telecommunications Service Inquiry). Connecting Australia: Telecommunications Service Inquiry. Canberra: Department of Information, Communications and the Arts, 2000. 17 July 2003 <http://www.telinquiry.gov.au/final_report.php>. Briggs, Asa, and Burke, Peter. A Social History of the Internet: From Gutenberg to the Internet. Cambridge: Polity, 2002. Broadband Advisory Group. Australia’s Broadband Connectivity: The Broadband Advisory Group’s Report to Government. Melbourne: National Office on the Information Economy, 2003. 15 July 2003 <http://www.noie.gov.au/publications/NOIE/BAG/report/index.htm>. Broadband Services Expert Group. Networking Australia’s Future: Final Report. Canberra: Australian Government Publishing Service (AGPS), 1994. Bureau of Transport and Communications Economics (BTCE). Communications Futures Final Project. Canberra: AGPS, 1994. Cairncross, Frances. The Death of Distance: How the Communications Revolution Will Change Our Lives. London: Orion Business Books, 1997. Communications Law Centre (CLC). Australian Telecommunications Regulation: The Communications Law Centre Guide. 2nd edition. Sydney: Communications Law Centre, University of NSW, 2001. Department of Communications, Information Technology and the Arts (DCITA). Telecommunications Action Plan for Remote Indigenous Communities: Report on the Strategic Study for Improving Telecommunications in Remote Indigenous Communities. Canberra: DCITA, 2002. Estens, D. Connecting Regional Australia: The Report of the Regional Telecommunications Inquiry. Canberra: DCITA, 2002. <http://www.telinquiry.gov.au/rti-report.php>, accessed 17 July 2003. Fels, Alan. ‘Competition in Telecommunications’, speech to Australian Telecommunications Users Group 19th Annual Conference. 6 March, 2003, Sydney. <http://www.accc.gov.au/speeches/2003/Fels_ATUG_6March03.doc>, accessed 15 July 2003. Flew, Terry, and Spurgeon, Christina. ‘Television After Broadcasting’. In The Australian TV Book. Ed. Graeme Turner and Stuart Cunningham. Allen & Unwin, Sydney. 69-85. 2000. Given, Jock. Turning Off the Television. Sydney: UNSW Press, 2003. Goggin, Gerard. ‘Citizens and Beyond: Universal service in the Twilight of the Nation-State.’ In All Connected?: Universal Service in Telecommunications, ed. Bruce Langtry. Melbourne: University of Melbourne Press, 1998. 49-77 —. Rural Communities Online: Networking to link Consumers to Providers. Melbourne: Telstra Consumer Consultative Council, 2003. Goggin, Gerard, and Newell, Christopher. Digital Disability: The Social Construction of Disability in New Media. Lanham, MD: Rowman & Littlefield, 2003. House of Representatives Standing Committee on Communications, Information Technology and the Arts (HoR). Connecting Australia!: Wireless Broadband. Report of Inquiry into Wireless Broadband Technologies. Canberra: Parliament House, 2002. <http://www.aph.gov.au/house/committee/cita/Wbt/report.htm>, accessed 17 July 2003. Lamberton, Don. ‘A Telecommunications Infrastructure is Not an Information Infrastructure’. Prometheus: Journal of Issues in Technological Change, Innovation, Information Economics, Communication and Science Policy 14 (1996): 31-38. Latour, Bruno. Science in Action: How to Follow Scientists and Engineers Through Society. Cambridge, MA: Harvard University Press, 1987. Luck, David. ‘Revisiting the Future: Assessing the 1994 BTCE communications futures project.’ Media International Australia 96 (2000): 109-119. MacBride, Sean (Chair of International Commission for the Study of Communication Problems). Many Voices, One World: Towards a New More Just and More Efficient World Information and Communication Order. Paris: Kegan Page, London. UNESCO, 1980. Maitland Commission (Independent Commission on Worldwide Telecommunications Development). The Missing Link. Geneva: International Telecommunications Union, 1985. Michaels, Eric. Bad Aboriginal Art: Tradition, Media, and Technological Horizons. Sydney: Allen & Unwin, 1994. Mody, Bella, Bauer, Johannes M., and Straubhaar, Joseph D., eds. Telecommunications Politics: Ownership and Control of the Information Highway in Developing Countries. Mahwah, NJ: Erlbaum, 1995. Moyal, Ann. Clear Across Australia: A History of Telecommunications. Melbourne: Thomas Nelson, 1984. Post-Master General’s Department (PMG). Community Telephone Plan for Australia. Melbourne: PMG, 1960. Productivity Commission (PC). Telecommunications Competition Regulation: Inquiry Report. Report No. 16. Melbourne: Productivity Commission, 2001. <http://www.pc.gov.au/inquiry/telecommunications/finalreport/>, accessed 17 July 2003. Spurgeon, Christina. ‘National Culture, Communications and the Information Economy.’ Media International Australia 87 (1998): 23-34. Turner, Graeme. ‘First Contact: coming to terms with the cable guy.’ UTS Review 3 (1997): 109-21. Winseck, Dwayne. ‘Wired Cities and Transnational Communications: New Forms of Governance for Telecommunications and the New Media’. In The Handbook of New Media: Social Shaping and Consequences of ICTs, ed. Leah A. Lievrouw and Sonia Livingstone. London: Sage, 2002. 393-409. World Trade Organisation. General Agreement on Trade in Services: Annex on Telecommunications. Geneva: World Trade Organisation, 1994. 17 July 2003 <http://www.wto.org/english/tratop_e/serv_e/12-tel_e.htm>. —. Fourth protocol to the General Agreement on Trade in Services. Geneva: World Trade Organisation. 17 July 2003 <http://www.wto.org/english/tratop_e/serv_e/4prote_e.htm>. Links http://www.accc.gov.au/pubs/publications/utilities/telecommunications/Emerg_mar_struc.doc http://www.accc.gov.au/speeches/2003/Fels_ATUG_6March03.doc http://www.accc.gov.au/telco/fs-telecom.htm http://www.aph.gov.au/house/committee/cita/Wbt/report.htm http://www.dcita.gov.au/Article/0,,0_1-2_3-4_115485,00.html http://www.dcita.gov.au/Article/0,,0_1-2_3-4_115486,00.html http://www.noie.gov.au/projects/access/access/broadband1.htm http://www.noie.gov.au/publications/NOIE/BAG/report/index.htm http://www.pc.gov.au http://www.pc.gov.au/inquiry/telecommunications/finalreport/ http://www.telinquiry.gov.au/final_report.html http://www.telinquiry.gov.au/rti-report.html http://www.wto.org/english/tratop_e/serv_e/12-tel_e.htm http://www.wto.org/english/tratop_e/serv_e/4prote_e.htm Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Goggin, Gerard. "Broadband" M/C: A Journal of Media and Culture< http://www.media-culture.org.au/0308/02-featurebroadband.php>. APA Style Goggin, G. (2003, Aug 26). Broadband. M/C: A Journal of Media and Culture, 6,< http://www.media-culture.org.au/0308/02-featurebroadband.php>

APA, Harvard, Vancouver, ISO, and other styles

22

Stansbury, Gwendolyn. "Arresting Fast Food." M/C Journal 3, no.3 (June1, 2000). http://dx.doi.org/10.5204/mcj.1852.

Full text

Abstract:

We are enslaved by speed and have succumbed to the same insidious virus: Fast Life, which disrupts our habits, pervades the privacy of our homes and forces us to eat Fast Foods. -- Manifesto of the Slow Food movement In Australia, we like our food fast. We spend more than a third of our average weekly household budget eating out or on takeaway food, a figure that may jump to 50% in the next five years (Macken). An ever increasing proportion of the food we do prepare at home has been processed for convenience, so that now we manage to spend just an hour and a half eating and drinking each day, or less time than we spend watching television (ABS, How Australians). If the sharing of food fosters family and social ties, and strong family and social relationships are an integral part of civil society, statistics such as these should give us pause. While it is beyond the scope of this article to give this topic the full attention it deserves, the article will nonetheless briefly examine some of the implications of life on the fast-food track. But first, why have we become so reliant on convenience foods? One reason is that significant numbers of women have entered the workforce during the last few decades and today, more than 60 percent of Australian women who are married work outside the home (ABS, Labour Force). As the value of women's labour in the market increases, their time becomes a more precious commodity and they seek ways to use it more efficiently (Bourdieu). Because women have traditionally been responsible for the preparation of family meals, and continue to shoulder most of the responsibility regardless of their role in the workforce, they naturally look for ways to save time buying and cooking food. However, this is not a trend confined solely to working women with families, but rather one that crosses many demographic and economic lines. We all seem to feel our time is at a premium, even though we are actually working less (ABS, Social Trends). That is because we are increasingly placing a greater value on our leisure time, and although we have more of it because of the shorter hours we work and the multitude of time-saving devices we use, we do not want to spend our free time shopping for food (Cheeseman & Breddin) or cooking it. Instead, our preferred activities are watching television and videos, socialising and talking, listening to the radio and reading (ABS, Social Trends). Interestingly, we have placed socialising and the family meal into completely separate categories. But first, why have we become so reliant on convenience foods? One reason is that significant numbers of women have entered the workforce during the last few decades and today, more than 60 percent of Australian women who are married work outside the home (ABS, Labour Force). As the value of women's labour in the market increases, their time becomes a more precious commodity and they seek ways to use it more efficiently (Bourdieu). Because women have traditionally been responsible for the preparation of family meals, and continue to shoulder most of the responsibility regardless of their role in the workforce, they naturally look for ways to save time buying and cooking food. However, this is not a trend confined solely to working women with families, but rather one that crosses many demographic and economic lines. We all seem to feel our time is at a premium, even though we are actually working less (ABS, Social Trends). That is because we are increasingly placing a greater value on our leisure time, and although we have more of it because of the shorter hours we work and the multitude of time-saving devices we use, we do not want to spend our free time shopping for food (Cheeseman & Breddin) or cooking it. Instead, our preferred activities are watching television and videos, socialising and talking, listening to the radio and reading (ABS, Social Trends). Interestingly, we have placed socialising and the family meal into completely separate categories. While the nutritional benefits derived from 'replaced' meals may be questionable, there are more important considerations at stake. People who have come to feel they do not have time to cook are not likely to feel they can spare much time to eat, either. 'Eating on the run' has now become part of our lexicon. And truthfully, who would want to linger over a meal made from reconstituted foods? But more importantly, what message do meals such as these impart to those who eat them? The social engagement, for example, that occurs over a frozen dinner "is very different to that which occurs over a long meal that has been carefully prepared and is shared with family or friends" (Finkelstein). The message inherent in quickly prepared or purchased foods that are in turn quickly consumed, often at different times by different members of the family or household, is that the family or communal meal is not an occasion worthy of much attention. Nothing can be farther from the truth. According to Claude Lévi-Strauss, food is at the very core of sociality. Humans evolved as food-sharing animals (van den Berghe), and the origin of the family can be traced in large part to the necessity of sharing meals. Today, meal times not only serve to strengthen family and social ties, but also to acculturate children into the norms of 'civilised' behaviour" (Lupton). Yet, they are under attack as family members are increasingly left to forage for food on their own. We need to consider what social and emotional skills our children are developing as they nibble on leftover pizza by the kitchen sink or unwrap their microwaved meal in front of the television. In an interview with Psychology Today, Ruth Reichl, renowned food writer and current editor of Gourmet magazine, said that the trend for family members to eat five-minute meals on their own will have a profound psychological impact on future generations of children, who will have missed out on a vital part of the socialisation process (Toufexis). Perhaps the Slow Food movement, then, has hit upon something. Its manifesto states, "a firm defense of quiet material pleasure is the only way to oppose the universal folly of Fast Life... . Our defense should begin at the table with Slow Food. Let us rediscover the flavors and savors of regional cooking and banish the degrading effects of Fast Food" (Slow Food). The movement was founded in Italy in 1986 by Carlos Petrini as a reaction to the establishment of a McDonald's near Rome's historic Spanish Steps. While global fast food colonisation is certainly a rallying point, the movement also encourages members to eat seasonal foods, support and protect regional cuisines, reinstate the ritual of family dining and educate children's palates. Mostly, however, Slow Food is about taking the time to enjoy a meal, to value the ingredients that go into it, and to share it with friends and family. It is appropriate, then, that the movement's symbol is a snail, "a talisman against speed" (Slow Food). While speed may be exciting, fast foods are not, and the idea of slowing down to savour meals with family and friends is one that is gaining momentum. The Slow Food movement, which started with a few delegates from 15 countries just over a decade ago, has now grown to 60,000 members in 35 countries, complete with 400 convivia, or local branches. Australia hosts eight of these chapters. Maggie Beer, the well-known Barossa Valley chef, entrepreneur and food writer, is also a Slow Food member. Her solution to the daily dinner dilemma is simple: by planning ahead and keeping a well-stocked pantry, it is possible for time-constrained cooks to have at hand many of the ingredients they need to make simple and nutritious meals in as much time as it takes to go get takeaway food (Beer). Nonetheless, keeping the pantry well-stocked with quality foods instead of dinners-in-a-packet means deciding that meals matter, that they are worthy of consideration and of time spent in preparation and consumption, and that the long-term rewards of Slow Food are worth far more than the short-term benefits of Fast Food. As the training grounds for future generations and important sites of reconnection for current ones, meals should be welcomed as opportunities for interaction rather than chores to be completed as quickly as possible. They should make people want to linger, while enjoying the company, the conversation and the food. As the French gastronome Jean-Anthelme Brillat-Savarin wrote in the early nineteenth century: One may find round a single table all the modifications which extreme sociability has introduced into our midst: love, friendship, business, speculation, influence, solicitation, patronage, ambition, intrigue; that is why conviviality affects every aspect of human life, and bears fruits of every flavour. (Brillat-Savarin). Reviving the ritual of a family meal does not mean returning to 'traditional' 1950s household dynamics, but rather, adopting a modern view that meals are important, even vital, and that all members of a family should contribute to making them special. The preparation of a meal can become part of the social process; Italo-Australians, for example, have turned the making of tomato sauce into a very communal and social event that draws friends and family closer together. It is a type of meal preparation that can be replicated on a far smaller scale by simply involving family members, housemates and partners in the making of a meal, which can be accomplished in a myriad of ways by people of varying ages and skills. However, it means periodically suspending time, for a good meal that satisfies body and soul cannot be rushed. The evidence suggests, however, that many of us are not yet able to jump off the treadmill, even though the current trend toward faster and faster foods may have a significant impact on the structure of the family and the nature of our relationships with each other. If we continue to eat on the run, if we consistently eat meals that do not make us want to linger, then we may find ourselves in danger of losing that uniquely human ritual of sharing food, which is a cornerstone of our sociality, the bedrock of family life and a building block of our collective spirit. Much does, indeed, depend on dinner. References Australian Bureau of Statistics. How Australians Use Their Time. Canberra: ABS, 1998. Australian Bureau of Statistics. Labour Force Status and Other Characteristics of Families, Australia. Canberra: ABS, 1999. Australian Bureau of Statistics. Social Trends 1999. Canberra: ABS, 1999. Beer, Maggie. "Advance Australia's Fare." The Australian Magazine 1-2 Jan. 2000: 40. Van den Berghe, Pierre. "Ethnic Cuisine: Culture in Nature." Ethnic and Racial Studies 7.3 (1984): 387-97. Bourdieu, Pierre. Distinction: A Social Critique of the Judgement of Taste. London: Routledge & Kegan Paul, 1984. Brillat-Savarin, Jean-Anthelme. The Philosopher in the Kitchen. Trans. Anne Drayton. Harmondsworth: Penguin Books, 1970. Cheeseman, Noel, and Robyn Breddin. Food Retailing in Australia. Brisbane: Queensland Department of Primary Industries, 1995. Finkelstein, Joanne. "Fast Foods: The Dangers of Eating Too Quickly." Proceedings of the Sixth Symposium of Australian Gastronomy: Much Depends on Dinner. Melbourne, 1991. 173-7. Lupton, Deborah. Food, the Body and the Self. London: Sage, 1996. Macken, Deirdre. "The Death of the Kitchen: Will Cooking Survive the 1990s?" Sydney Morning Herald Spectrum 7 Sep. 1996: 10s. Mangosi, Sandro. "Pie-and-Sandwich Corner Shop Threatened by Dynamics of Fast Food Industry." BIS Shrapnel News Release. 18 May 2000. Slattery, Geoff. "Accept No Imitations." The Age Food 11 May 1999. Slow Food. "Manifesto." 2000. 1 June 2000 <http://www.slowfood.com/>. Toufexis, Anastasia. "Dishing with Ruth Reichl." Psychology Today 31.6 (Nov.-Dec. 1998): 48. Citation reference for this article MLA style: Gwendolyn Stansbury. "Arresting Fast Food." M/C: A Journal of Media and Culture 3.3 (2000). [your date of access] <http://www.api-network.com/mc/0006/food.php>. Chicago style: Gwendolyn Stansbury, "Arresting Fast Food," M/C: A Journal of Media and Culture 3, no. 3 (2000), <http://www.api-network.com/mc/0006/food.php> ([your date of access]). APA style: Gwendolyn Stansbury. (2000) Arresting fast food. M/C: A Journal of Media and Culture 3(3). <http://www.api-network.com/mc/0006/food.php> ([your date of access]).

APA, Harvard, Vancouver, ISO, and other styles

23

Grossman, Michele. "Prognosis Critical: Resilience and Multiculturalism in Contemporary Australia." M/C Journal 16, no.5 (August28, 2013). http://dx.doi.org/10.5204/mcj.699.

Full text

Abstract:

Introduction Most developed countries, including Australia, have a strong focus on national, state and local strategies for emergency management and response in the face of disasters and crises. This framework can include coping with catastrophic dislocation, service disruption, injury or loss of life in the face of natural disasters such as major fires, floods, earthquakes or other large-impact natural events, as well as dealing with similar catastrophes resulting from human actions such as bombs, biological agents, cyber-attacks targeting essential services such as communications networks, or other crises affecting large populations. Emergency management frameworks for crisis and disaster response are distinguished by their focus on the domestic context for such events; that is, how to manage and assist the ways in which civilian populations, who are for the most part inexperienced and untrained in dealing with crises and disasters, are able to respond and behave in such situations so as to minimise the impacts of a catastrophic event. Even in countries like Australia that demonstrate a strong public commitment to cultural pluralism and social cohesion, ethno-cultural diversity can be seen as a risk or threat to national security and values at times of political, natural, economic and/or social tensions and crises. Australian government policymakers have recently focused, with increasing intensity, on “community resilience” as a key element in countering extremism and enhancing emergency preparedness and response. In some sense, this is the result of a tacit acknowledgement by government agencies that there are limits to what they can do for domestic communities should such a catastrophic event occur, and accordingly, the focus in recent times has shifted to how governments can best help people to help themselves in such situations, a key element of the contemporary “resilience” approach. Yet despite the robustly multicultural nature of Australian society, explicit engagement with Australia’s cultural diversity flickers only fleetingly on this agenda, which continues to pursue approaches to community resilience in the absence of understandings about how these terms and formations may themselves need to be diversified to maximise engagement by all citizens in a multicultural polity. There have been some recent efforts in Australia to move in this direction, for example the Australian Emergency Management Institute (AEMI)’s recent suite of projects with culturally and linguistically diverse (CALD) communities (2006-2010) and the current Australia-New Zealand Counter-Terrorism Committee-supported project on “Harnessing Resilience Capital in Culturally Diverse Communities to Counter Violent Extremism” (Grossman and Tahiri), which I discuss in a longer forthcoming version of this essay (Grossman). Yet the understanding of ethno-cultural identity and difference that underlies much policy thinking on resilience remains problematic for the way in which it invests in a view of the cultural dimensions of community resilience as relic rather than resource – valorising the preservation of and respect for cultural norms and traditions, but silent on what different ethno-cultural communities might contribute toward expanded definitions of both “community” and “resilience” by virtue of the transformative potential and existing cultural capital they bring with them into new national and also translocal settings. For example, a primary conclusion of the joint program between AEMI and the Australian Multicultural Commission is that CALD communities are largely “vulnerable” in the context of disasters and emergency management and need to be better integrated into majority-culture models of theorising and embedding community resilience. This focus on stronger national integration and the “vulnerability” of culturally diverse ethno-cultural communities in the Australian context echoes the work of scholars beyond Australia such as McGhee, Mouritsen (Reflections, Citizenship) and Joppke. They argue that the “civic turn” in debates around resurgent contemporary nationalism and multicultural immigration policies privileges civic integration over genuine two-way multiculturalism. This approach sidesteps the transculturational (Ortiz; Welsch; Mignolo; Bennesaieh; Robins; Stein) aspects of contemporary social identities and exchange by paying lip-service to cultural diversity while affirming a neo-liberal construct of civic values and principles as a universalising goal of Western democratic states within a global market economy. It also suggests a superficial tribute to cultural diversity that does not embed diversity comprehensively at the levels of either conceptualising or resourcing different elements of Australian transcultural communities within the generalised framework of “community resilience.” And by emphasising cultural difference as vulnerability rather than as resource or asset, it fails to acknowledge the varieties of resilience capital that many culturally diverse individuals and communities may bring with them when they resettle in new environments, by ignoring the question of what “resilience” actually means to those from culturally diverse communities. In so doing, it also avoids the critical task of incorporating intercultural definitional diversity around the concepts of both “community” and “resilience” used to promote social cohesion and the capacity to recover from disasters and crises. How we might do differently in thinking about the broader challenges for multiculturalism itself as a resilient transnational concept and practice? The Concept of Resilience The meanings of resilience vary by disciplinary perspective. While there is no universally accepted definition of the concept, it is widely acknowledged that resilience refers to the capacity of an individual to do well in spite of exposure to acute trauma or sustained adversity (Liebenberg 219). Originating in the Latin word resilio, meaning ‘to jump back’, there is general consensus that resilience pertains to an individual’s, community’s or system’s ability to adapt to and ‘bounce back’ from a disruptive event (Mohaupt 63, Longstaff et al. 3). Over the past decade there has been a dramatic rise in interest in the clinical, community and family sciences concerning resilience to a broad range of adversities (Weine 62). While debate continues over which discipline can be credited with first employing resilience as a concept, Mohaupt argues that most of the literature on resilience cites social psychology and psychiatry as the origin for the concept beginning in the mid-20th century. The pioneer researchers of what became known as resilience research studied the impact on children living in dysfunctional families. For example, the findings of work by Garmezy, Werner and Smith and Rutter showed that about one third of children in these studies were coping very well despite considerable adversities and traumas. In asking what it was that prevented the children in their research from being negatively influenced by their home environments, such research provided the basis for future research on resilience. Such work was also ground-breaking for identifying the so-called ‘protective factors’ or resources that individuals can operationalise when dealing with adversity. In essence, protective factors are those conditions in the individual that protect them from the risk of dysfunction and enable recovery from trauma. They mitigate the effects of stressors or risk factors, that is, those conditions that predispose one to harm (Hajek 15). Protective factors include the inborn traits or qualities within an individual, those defining an individual’s environment, and also the interaction between the two. Together, these factors give people the strength, skills and motivation to cope in difficult situations and re-establish (a version of) ‘normal’ life (Gunnestad). Identifying protective factors is important in terms of understanding the particular resources a given sociocultural group has at its disposal, but it is also vital to consider the interconnections between various protective mechanisms, how they might influence each other, and to what degree. An individual, for instance, might display resilience or adaptive functioning in a particular domain (e.g. emotional functioning) but experience significant deficits in another (e.g. academic achievement) (Hunter 2). It is also essential to scrutinise how the interaction between protective factors and risk factors creates patterns of resilience. Finally, a comprehensive understanding of the interrelated nature of protective mechanisms and risk factors is imperative for designing effective interventions and tailored preventive strategies (Weine 65). In short, contemporary thinking about resilience suggests it is neither entirely personal nor strictly social, but an interactive and iterative combination of the two. It is a quality of the environment as much as the individual. For Ungar, resilience is the complex entanglements between “individuals and their social ecologies [that] will determine the degree of positive outcomes experienced” (3). Thinking about resilience as context-dependent is important because research that is too trait-based or actor-centred risks ignoring any structural or institutional forces. A more ecological interpretation of resilience, one that takes into a person’s context and environment into account, is vital in order to avoid blaming the victim for any hardships they face, or relieving state and institutional structures from their responsibilities in addressing social adversity, which can “emphasise self-help in line with a neo-conservative agenda instead of stimulating state responsibility” (Mohaupt 67). Nevertheless, Ungar posits that a coherent definition of resilience has yet to be developed that adequately ‘captures the dual focus of the individual and the individual’s social ecology and how the two must both be accounted for when determining the criteria for judging outcomes and discerning processes associated with resilience’ (7). Recent resilience research has consequently prompted a shift away from vulnerability towards protective processes — a shift that highlights the sustained capabilities of individuals and communities under threat or at risk. Locating ‘Culture’ in the Literature on Resilience However, an understanding of the role of culture has remained elusive or marginalised within this trend; there has been comparatively little sustained investigation into the applicability of resilience constructs to non-western cultures, or how the resources available for survival might differ from those accessible to western populations (Ungar 4). As such, a growing body of researchers is calling for more rigorous inquiry into culturally determined outcomes that might be associated with resilience in non-western or multicultural cultures and contexts, for example where Indigenous and minority immigrant communities live side by side with their ‘mainstream’ neighbours in western settings (Ungar 2). ‘Cultural resilience’ considers the role that cultural background plays in determining the ability of individuals and communities to be resilient in the face of adversity. For Clauss-Ehlers, the term describes the degree to which the strengths of one’s culture promote the development of coping (198). Culturally-focused resilience suggests that people can manage and overcome stress and trauma based not on individual characteristics alone, but also from the support of broader sociocultural factors (culture, cultural values, language, customs, norms) (Clauss-Ehlers 324). The innate cultural strengths of a culture may or may not differ from the strengths of other cultures; the emphasis here is not so much comparatively inter-cultural as intensively intra-cultural (VanBreda 215). A culturally focused resilience model thus involves “a dynamic, interactive process in which the individual negotiates stress through a combination of character traits, cultural background, cultural values, and facilitating factors in the sociocultural environment” (Clauss-Ehlers 199). In understanding ways of ‘coping and hoping, surviving and thriving’, it is thus crucial to consider how culturally and linguistically diverse minorities navigate the cultural understandings and assumptions of both their countries of origin and those of their current domicile (Ungar 12). Gunnestad claims that people who master the rules and norms of their new culture without abandoning their own language, values and social support are more resilient than those who tenaciously maintain their own culture at the expense of adjusting to their new environment. They are also more resilient than those who forego their own culture and assimilate with the host society (14). Accordingly, if the combination of both valuing one’s culture as well as learning about the culture of the new system produces greater resilience and adaptive capacities, serious problems can arise when a majority tries to acculturate a minority to the mainstream by taking away or not recognising important parts of the minority culture. In terms of resilience, if cultural factors are denied or diminished in accounting for and strengthening resilience – in other words, if people are stripped of what they possess by way of resilience built through cultural knowledge, disposition and networks – they do in fact become vulnerable, because ‘they do not automatically gain those cultural strengths that the majority has acquired over generations’ (Gunnestad 14). Mobilising ‘Culture’ in Australian Approaches to Community Resilience The realpolitik of how concepts of resilience and culture are mobilised is highly relevant here. As noted above, when ethnocultural difference is positioned as a risk or a threat to national identity, security and values, this is precisely the moment when vigorously, even aggressively, nationalised definitions of ‘community’ and ‘identity’ that minoritise or disavow cultural diversities come to the fore in public discourse. The Australian evocation of nationalism and national identity, particularly in the way it has framed policy discussion on managing national responses to disasters and threats, has arguably been more muted than some of the European hysteria witnessed recently around cultural diversity and national life. Yet we still struggle with the idea that newcomers to Australia might fall on the surplus rather than the deficit side of the ledger when it comes to identifying and harnessing resilience capital. A brief example of this trend is explored here. From 2006 to 2010, the Australian Emergency Management Institute embarked on an ambitious government-funded four-year program devoted to strengthening community resilience in relation to disasters with specific reference to engaging CALD communities across Australia. The program, Inclusive Emergency Management with CALD Communities, was part of a wider Australian National Action Plan to Build Social Cohesion, Harmony and Security in the wake of the London terrorist bombings in July 2005. Involving CALD community organisations as well as various emergency and disaster management agencies, the program ran various workshops and agency-community partnership pilots, developed national school education resources, and commissioned an evaluation of the program’s effectiveness (Farrow et al.). While my critique here is certainly not aimed at emergency management or disaster response agencies and personnel themselves – dedicated professionals who often achieve remarkable results in emergency and disaster response under extraordinarily difficult circumstances – it is nevertheless important to highlight how the assumptions underlying elements of AEMI’s experience and outcomes reflect the persistent ways in which ethnocultural diversity is rendered as a problem to be surmounted or a liability to be redressed, rather than as an asset to be built upon or a resource to be valued and mobilised. AEMI’s explicit effort to engage with CALD communities in building overall community resilience was important in its tacit acknowledgement that emergency and disaster services were (and often remain) under-resourced and under-prepared in dealing with the complexities of cultural diversity in emergency situations. Despite these good intentions, however, while the program produced some positive outcomes and contributed to crucial relationship building between CALD communities and emergency services within various jurisdictions, it also continued to frame the challenge of working with cultural diversity as a problem of increased vulnerability during disasters for recently arrived and refugee background CALD individuals and communities. This highlights a common feature in community resilience-building initiatives, which is to focus on those who are already ‘robust’ versus those who are ‘vulnerable’ in relation to resilience indicators, and whose needs may require different or additional resources in order to be met. At one level, this is a pragmatic resourcing issue: national agencies understandably want to put their people, energy and dollars where they are most needed in pursuit of a steady-state unified national response at times of crisis. Nor should it be argued that at least some CALD groups, particularly those from new arrival and refugee communities, are not vulnerable in at least some of the ways and for some of the reasons suggested in the program evaluation. However, the consistent focus on CALD communities as ‘vulnerable’ and ‘in need’ is problematic, as well as partial. It casts members of these communities as structurally and inherently less able and less resilient in the context of disasters and emergencies: in some sense, as those who, already ‘victims’ of chronic social deficits such as low English proficiency, social isolation and a mysterious unidentified set of ‘cultural factors’, can become doubly victimised in acute crisis and disaster scenarios. In what is by now a familiar trope, the description of CALD communities as ‘vulnerable’ precludes asking questions about what they do have, what they do know, and what they do or can contribute to how we respond to disaster and emergency events in our communities. A more profound problem in this sphere revolves around working out how best to engage CALD communities and individuals within existing approaches to disaster and emergency preparedness and response. This reflects a fundamental but unavoidable limitation of disaster preparedness models: they are innately spatially and geographically bounded, and consequently understand ‘communities’ in these terms, rather than expanding definitions of ‘community’ to include the dimensions of community-as-social-relations. While some good engagement outcomes were achieved locally around cross-cultural knowledge for emergency services workers, the AEMI program fell short of asking some of the harder questions about how emergency and disaster service scaffolding and resilience-building approaches might themselves need to change or transform, using a cross-cutting model of ‘communities’ as both geographic places and multicultural spaces (Bartowiak-Théron and Crehan) in order to be more effective in national scenarios in which cultural diversity should be taken for granted. Toward Acknowledgement of Resilience Capital Most significantly, the AEMI program did not produce any recognition of the ways in which CALD communities already possess resilience capital, or consider how this might be drawn on in formulating stronger community initiatives around disaster and threats preparedness for the future. Of course, not all individuals within such communities, nor all communities across varying circumstances, will demonstrate resilience, and we need to be careful of either overgeneralising or romanticising the kinds and degrees of ‘resilience capital’ that may exist within them. Nevertheless, at least some have developed ways of withstanding crises and adapting to new conditions of living. This is particularly so in connection with individual and group behaviours around resource sharing, care-giving and social responsibility under adverse circumstances (Grossman and Tahiri) – all of which are directly relevant to emergency and disaster response. While some of these resilient behaviours may have been nurtured or enhanced by particular experiences and environments, they can, as the discussion of recent literature above suggests, also be rooted more deeply in cultural norms, habits and beliefs. Whatever their origins, for culturally diverse societies to achieve genuine resilience in the face of both natural and human-made disasters, it is critical to call on the ‘social memory’ (Folke et al.) of communities faced with responding to emergencies and crises. Such wellsprings of social memory ‘come from the diversity of individuals and institutions that draw on reservoirs of practices, knowledge, values, and worldviews and is crucial for preparing the system for change, building resilience, and for coping with surprise’ (Adger et al.). Consequently, if we accept the challenge of mapping an approach to cultural diversity as resource rather than relic into our thinking around strengthening community resilience, there are significant gains to be made. For a whole range of reasons, no diversity-sensitive model or measure of resilience should invest in static understandings of ethnicities and cultures; all around the world, ethnocultural identities and communities are in a constant and sometimes accelerated state of dynamism, reconfiguration and flux. But to ignore the resilience capital and potential protective factors that ethnocultural diversity can offer to the strengthening of community resilience more broadly is to miss important opportunities that can help suture the existing disconnects between proactive approaches to intercultural connectedness and social inclusion on the one hand, and reactive approaches to threats, national security and disaster response on the other, undermining the effort to advance effectively on either front. This means that dominant social institutions and structures must be willing to contemplate their own transformation as the result of transcultural engagement, rather than merely insisting, as is often the case, that ‘other’ cultures and communities conform to existing hegemonic paradigms of being and of living. In many ways, this is the most critical step of all. A resilience model and strategy that questions its own culturally informed yet taken-for-granted assumptions and premises, goes out into communities to test and refine these, and returns to redesign its approach based on the new knowledge it acquires, would reflect genuine progress toward an effective transculturational approach to community resilience in culturally diverse contexts.References Adger, W. Neil, Terry P. Hughes, Carl Folke, Stephen R. Carpenter and Johan Rockström. “Social-Ecological Resilience to Coastal Disasters.” Science 309.5737 (2005): 1036-1039. ‹http://www.sciencemag.org/content/309/5737/1036.full> Bartowiak-Théron, Isabelle, and Anna Corbo Crehan. “The Changing Nature of Communities: Implications for Police and Community Policing.” Community Policing in Australia: Australian Institute of Criminology (AIC) Reports, Research and Policy Series 111 (2010): 8-15. Benessaieh, Afef. “Multiculturalism, Interculturality, Transculturality.” Ed. A. Benessaieh. Transcultural Americas/Ameriques Transculturelles. Ottawa: U of Ottawa Press/Les Presses de l’Unversite d’Ottawa, 2010. 11-38. Clauss-Ehlers, Caroline S. “Sociocultural Factors, Resilience and Coping: Support for a Culturally Sensitive Measure of Resilience.” Journal of Applied Developmental Psychology 29 (2008): 197-212. Clauss-Ehlers, Caroline S. “Cultural Resilience.” Encyclopedia of Cross-Cultural School Psychology. Ed. C. S. Clauss-Ehlers. New York: Springer, 2010. 324-326. Farrow, David, Anthea Rutter and Rosalind Hurworth. Evaluation of the Inclusive Emergency Management with Culturally and Linguistically Diverse (CALD) Communities Program. Parkville, Vic.: Centre for Program Evaluation, U of Melbourne, July 2009. ‹http://www.ag.gov.au/www/emaweb/rwpattach.nsf/VAP/(9A5D88DBA63D32A661E6369859739356)~Final+Evaluation+Report+-+July+2009.pdf/$file/Final+Evaluation+Report+-+July+2009.pdf>.Folke, Carl, Thomas Hahn, Per Olsson, and Jon Norberg. “Adaptive Governance of Social-Ecological Systems.” Annual Review of Environment and Resources 30 (2005): 441-73. ‹http://arjournals.annualreviews.org/doi/pdf/10.1146/annurev.energy.30.050504.144511>. Garmezy, Norman. “The Study of Competence in Children at Risk for Severe Psychopathology.” The Child in His Family: Children at Psychiatric Risk. Vol. 3. Eds. E. J. Anthony and C. Koupernick. New York: Wiley, 1974. 77-97. Grossman, Michele. “Resilient Multiculturalism? Diversifying Australian Approaches to Community Resilience and Cultural Difference”. Global Perspectives on Multiculturalism in the 21st Century. Eds. B. E. de B’beri and F. Mansouri. London: Routledge, 2014. Grossman, Michele, and Hussein Tahiri. Harnessing Resilience Capital in Culturally Diverse Communities to Counter Violent Extremism. Canberra: Australia-New Zealand Counter-Terrorism Committee, forthcoming 2014. Grossman, Michele. “Cultural Resilience and Strengthening Communities”. Safeguarding Australia Summit, Canberra. 23 Sep. 2010. ‹http://www.safeguardingaustraliasummit.org.au/uploader/resources/Michele_Grossman.pdf>. Gunnestad, Arve. “Resilience in a Cross-Cultural Perspective: How Resilience Is Generated in Different Cultures.” Journal of Intercultural Communication 11 (2006). ‹http://www.immi.se/intercultural/nr11/gunnestad.htm>. Hajek, Lisa J. “Belonging and Resilience: A Phenomenological Study.” Unpublished Master of Science thesis, U of Wisconsin-Stout. Menomonie, Wisconsin, 2003. Hunter, Cathryn. “Is Resilience Still a Useful Concept When Working with Children and Young People?” Child Family Community Australia (CFA) Paper 2. Melbourne: Australian Institute of Family Studies, 2012.Joppke, Christian. "Beyond National Models: Civic Integration Policies for Immigrants in Western Europe". West European Politics 30.1 (2007): 1-22. Liebenberg, Linda, Michael Ungar, and Fons van de Vijver. “Validation of the Child and Youth Resilience Measure-28 (CYRM-28) among Canadian Youth.” Research on Social Work Practice 22.2 (2012): 219-226. Longstaff, Patricia H., Nicholas J. Armstrong, Keli Perrin, Whitney May Parker, and Matthew A. Hidek. “Building Resilient Communities: A Preliminary Framework for Assessment.” Homeland Security Affairs 6.3 (2010): 1-23. ‹http://www.hsaj.org/?fullarticle=6.3.6>. McGhee, Derek. The End of Multiculturalism? Terrorism, Integration and Human Rights. Maidenhead: Open U P, 2008.Mignolo, Walter. Local Histories/Global Designs: Coloniality, Subaltern Knowledges, and Border Thinking. Princeton: Princeton U P, 2000. Mohaupt, Sarah. “Review Article: Resilience and Social Exclusion.” Social Policy and Society 8 (2009): 63-71.Mouritsen, Per. "The Culture of Citizenship: A Reflection on Civic Integration in Europe." Ed. R. Zapata-Barrero. Citizenship Policies in the Age of Diversity: Europe at the Crossroad." Barcelona: CIDOB Foundation, 2009: 23-35. Mouritsen, Per. “Political Responses to Cultural Conflict: Reflections on the Ambiguities of the Civic Turn.” Ed. P. Mouritsen and K.E. Jørgensen. Constituting Communities. Political Solutions to Cultural Conflict, London: Palgrave, 2008. 1-30. Ortiz, Fernando. Cuban Counterpoint: Tobacco and Sugar. Trans. Harriet de Onís. Intr. Fernando Coronil and Bronislaw Malinowski. Durham, NC: Duke U P, 1995 [1940]. Robins, Kevin. The Challenge of Transcultural Diversities: Final Report on the Transversal Study on Cultural Policy and Cultural Diversity. Culture and Cultural Heritage Department. Strasbourg: Council of European Publishing, 2006. Rutter, Michael. “Protective Factors in Children’s Responses to Stress and Disadvantage.” Annals of the Academy of Medicine, Singapore 8 (1979): 324-38. Stein, Mark. “The Location of Transculture.” Transcultural English Studies: Fictions, Theories, Realities. Eds. F. Schulze-Engler and S. Helff. Cross/Cultures 102/ANSEL Papers 12. Amsterdam and New York: Rodopi, 2009. 251-266. Ungar, Michael. “Resilience across Cultures.” British Journal of Social Work 38.2 (2008): 218-235. First published online 2006: 1-18. In-text references refer to the online Advance Access edition ‹http://bjsw.oxfordjournals.org/content/early/2006/10/18/bjsw.bcl343.full.pdf>. VanBreda, Adrian DuPlessis. Resilience Theory: A Literature Review. Erasmuskloof: South African Military Health Service, Military Psychological Institute, Social Work Research & Development, 2001. Weine, Stevan. “Building Resilience to Violent Extremism in Muslim Diaspora Communities in the United States.” Dynamics of Asymmetric Conflict 5.1 (2012): 60-73. Welsch, Wolfgang. “Transculturality: The Puzzling Form of Cultures Today.” Spaces of Culture: City, Nation World. Eds. M. Featherstone and S. Lash. London: Sage, 1999. 194-213. Werner, Emmy E., and Ruth S. Smith. Vulnerable But Invincible: A Longitudinal Study of\ Resilience and Youth. New York: McGraw Hill, 1982. NotesThe concept of ‘resilience capital’ I offer here is in line with one strand of contemporary theorising around resilience – that of resilience as social or socio-ecological capital – but moves beyond the idea of enhancing general social connectedness and community cohesion by emphasising the ways in which culturally diverse communities may already be robustly networked and resourceful within micro-communal settings, with new resources and knowledge both to draw on and to offer other communities or the ‘national community’ at large. In effect, ‘resilience capital’ speaks to the importance of finding ‘the communities within the community’ (Bartowiak-Théron and Crehan 11) and recognising their capacity to contribute to broad-scale resilience and recovery.I am indebted for the discussion of the literature on resilience here to Dr Peta Stephenson, Centre for Cultural Diversity and Wellbeing, Victoria University, who is working on a related project (M. Grossman and H. Tahiri, Harnessing Resilience Capital in Culturally Diverse Communities to Counter Violent Extremism, forthcoming 2014).

APA, Harvard, Vancouver, ISO, and other styles

24

Stephenson, Peta. "Sorry Business." M/C Journal 4, no.1 (February1, 2001). http://dx.doi.org/10.5204/mcj.1892.

Full text

Abstract:

In a letter responding to the Federal Government’s refusal to offer a formal apology to the ‘Stolen Generation’ of Indigenous Australians, members of the Vietnamese-Australian community expressed an understanding (often lacked by Anglo-Australians) of the need to appreciate their position as migrants in relation to the Indigenous community: "We are here now, living in cities and towns that once were their hunting grounds, their camping places, their sacred sites. We are the beneficiaries of their dispossession, and we acknowledge their loss. We understand about the loss of home, family and cultural values, and we too would like to express our deep sorrow to all indigenous Australians for their suffering and offer our support for genuine reconciliation." (Le and Nguyen 14) This letter remains one of the few instances in which the contemporary positioning of migrant and Indigenous peoples is discussed in relation to one another. It is demonstrative of some of the points of continuity between the ways Aboriginal and migrant collectivities (especially those who are racially ‘marked’) experience Australian society but, more often than not, these connections remain under-theorised. In Australian debates concerning the significance of descent, belonging and culture, there have been two distinct, yet connected currents (Curthoys 21). One of these debates concerns the positioning of Indigenous and settler Australians within a (continuing) history of colonisation and genocide. The other debate centres on immigration, multiculturalism and ethnic/cultural diversity. Ghassan Hage argues that such distinctions are a reflection of a white governmental tendency that conceives ‘white-Aboriginal’ and ‘Anglo-Ethnic’ relations in oppositional terms. The whites "relating to Aboriginal people appear as totally unaffected by multiculturalism, while the ‘Anglos’ relating to the ‘ethnics’ appear as if they have no Aboriginal question about which to worry" (24). It is only since the mid to late 1990s that debates on both Indigenous and immigration policies (re-ignited by independent member of parliament Pauline Hanson in 1996) have been explicitly connected. This article examines the ambiguous and often strained relationship between the positioning of Indigenous and migrant peoples in contemporary Australian society. While the above letter suggests a degree of sympathy and empathy between recent migrant collectivities and Aboriginal people, such a level of recognition and understanding cannot be taken for granted. The following account of Aboriginal-migrant relations indicates that these are structured by both "complex conflicts and points of solidarity" (Perera and Pugliese 5). Given that both diasporic and Indigenous communities can be the targets of white supremacist ideologies and hostilities, some commonalities between these collectivities become apparent. The "attraction of outsiders to fellow outsiders, the stranger (the [I]ndigenous made a stranger in her or his own land) to the stranger from elsewhere" (Docker and Fischer 15), can result in the creation of common interests and affiliations. However, diasporic communities do not share the same history of colonisation (in Australia, at least) with Indigenous Australians, and may be perceived as yet another set of invaders. Just like the colonisers, more recent migrants are beneficiaries of the original dispossession and (continuing) colonisation of Aboriginal and Torres Strait Islander Australians. The Indigenous and the Diasporic: Tensions and Uncertainties The shared knowledge of being located on the margins of white Australian society has enabled Aboriginal and non-white racial minorities to see many similarities in their circumstances and experiences. Both Aboriginal and non-Anglo migrant collectivities have largely been excluded from dominant ideologies of Australian national belonging. Those migrants who have come to Australia as refugees can often appreciate the feelings of cultural domination and loss that many Aboriginal people experience on a daily basis. Both Aboriginal and NESB collectivities have also come under pressure to adopt the assumed monolithic Australian culture. The assimilation policy offered a chance for Aborigines and NESB migrants to ‘fit in’, but this was on the proviso that they conform. Both NESB and Aboriginal communities experience ongoing structural disadvantages in Australian society and its economy. These collectivities can also suffer discrimination and hostility in their social relations with fellow Australians. Despite these similarities, however, there is often a lack of identification between Aboriginal and migrant collectivities. Australian Indigenous and immigrant peoples have very divergent histories and Aboriginal and Torres Strait Islander people often resist being drawn under the rubric of multiculturalism. Instead, many Indigenous Australians have attacked multiculturalism, claiming that the idea of the equal validity of every culture "reduces them to the status of just another ethnic minority" (Bulbeck 273). Many Aboriginal and Torres Strait Islander people wish to reinforce their status as the ‘first’ or Indigenous peoples of this country; an insistence that does not necessarily assist recognition of the ways in which racism and ethnocentrism impact upon ‘Other’ minorities. Another reason for the relative lack of engagement between Indigenous and diasporic communities is that the political agenda of Aboriginal and Torres Strait Islander people is different from that of other minority collectivities. Indigenous activists have expressed understandable and substantiated fears that the focus on multiculturalism not only overlooks the Indigenous status of Aborigines as ‘first peoples’, but can distract attention from the issues of land rights and Native Title (Gunew 455). Lois O’Donoghue recognises both advantages and disadvantages in contemporary multiculturalism: "Perhaps Aboriginal people have benefited from the greater appreciation of cultural diversity which has resulted from the admission of other points of view". However, "we are the original inhabitants of this land, and our sufferings, past and present, make some form of special recognition a moral imperative" (qtd. in Bulbeck 274). Another difficulty lies is that newly arrived migrants are extended various social rights and privileges that have only relatively recently been granted to Indigenous Australians. Many Indigenes have resented the fact that new groups may be better treated than themselves, with some migrants taking on "the racist stereotypes of Anglo-Australian society" (Vasta 51). In Sang Ye’s interviews with various Chinese migrants in The Year the Dragon Came, for instance, one interviewee claimed that: "Nearly all the Aborigines are unemployed or refuse to take jobs that are available; they’re outside the pubs or on the grass getting drunk on beer" (182). These comments show very clearly that the common experiences of racism that many NESB and Aboriginal Australians share do not automatically guarantee understanding or political solidarity between the two groups (Perera and Pugliese 14). The above quotation also illustrates the way in which NESB Australians can reproduce dominant white Australian characterisations of contemporary Aboriginality. Aboriginal people continue to face popular conceptions of themselves as drunken, lazy, intellectually inferior, or as suitable only for servile or menial work (Morris 171-173). As Ruby Langford Ginibi maintains: They’ve got us stereotyped as nothing but lazy layabout boongs, you know, and they see a Koori fella staggering down the street charged up and they say, ‘Oh, they’re all like that,’ but they never stop, or pause to think, ‘Hey, what’s made this person like this?’ You can’t do what has been done to a race of people without it having disastrous results. (qtd. in Little 105 As long as Anglo- and NESB Australians focus on the low socioeconomic position of Aboriginal people without considering the lasting effects of colonialism, Aborigines will continually be cast as the culprits of their own positioning. Widely-circulated conservative ideologies that blame Aboriginal people for their own victimisation overlook the enduring legacies of colonisation. As Arthur Corunna states in Sally Morgan’s My Place: "You see, the trouble is that colonialism isn’t over yet" (212). According to Suvendrini Perera and Joseph Pugliese, "[i]t is vital that the structural disadvantages and racisms faced by indigenous peoples not be relegated to history, but be seen as ongoing in contemporary Australia" (10). Many Aboriginal communities also feel that because migrants have not, in Australia at least, suffered the same extent of cultural domination, they are less disadvantaged. John Docker argues that each individual in 1788 and since who has come to Australia, however variegated their experiences and "however much there has been racism and ethnocentrism and differential access to power ha[s] benefited from the original invasion and dispossession of the Aboriginal peoples, and still benefit[s]" (54). For Aboriginal people migrant groups could be seen as another set of invaders, "not brothers and sisters on the margins, not the fellow oppressed and dispossessed" (Docker 54). Aboriginal and Torres Strait Islander people have thus avoided conflating their own political agendas – at the foreground of which are land rights and Native Title – with the very different concerns of various migrant communities (Brewster 16). Many Aboriginal people feel that because those migrating to Australia can retain their language, and often have families or communities to go to, they are less disadvantaged. Langford Ginibi’s comments are illustrative: Even the people who migrate here are on a higher social level than we are, and we’re the first people of this land! My people were forced to give away using our language and culture, and adopt the ways of the white man, but the people who migrated here don’t give away their language or culture to become Australian citizens." (52) In her autobiography Born a Half-Caste, Marnie Kennedy makes similar claims: "Every nationality in Australia is allowed to speak its language. They have their own gatherings. These are the things that make Aborigines very bitter because they were made to give up everything that was sacred to them" (4-5). Given the tensions and contradictions outlined above, long-lasting and productive relations between Aboriginal and NESB peoples can sometimes be difficult to forge, but it is important that NESB people recognise their responsibility in the ongoing dispossession of Indigenous Australians. NESB migrants (and all non-Aboriginal Australians) remain the beneficiaries of colonisation but, unlike their Anglo-Australian counterparts, non-white migrants have been racially marked and had their ability to claim the title ‘Australian’ questioned. Ongoing analysis of the positioning of NESB collectivities in relation to Aboriginal peoples will assist in undermining the central conflict of Black vs. white in reconciliation debates. Further research might also help disrupt the continuing cleavage of ‘the immigrant’ and ‘the Indigene’ in contemporary paradigms of reconciliation, providing a space for discussion on the potential role and contribution of NESB Australians to the reconciliation process. References Brewster, Anne. Literary Formations: Post-colonialism, Nationalism, Globalism. Carlton, Vic: Melbourne UP, 1995. Bulbeck, Chilla. Social Sciences in Australia: An Introduction. Sydney: Harcourt Brace Jovanovich, 1993. Curthoys, Ann. "An Uneasy Conversation: The Multicultural and the Indigenous." Race, Colour and Identity in Australia and New Zealand. Eds. John Docker and Gerhard Fischer. Sydney: U of NSW P, 2000. 21-36. Docker, John. "The Temperament of Editors and a New Multicultural Orthodoxy." Island Magazine 48 (1991): 50-55. Docker, John, and Gerhard Fischer. "Adventures of Identity." Race, Colour and Identity in Australia and New Zealand. Eds. John Docker and Gerhard Fischer. Sydney: U of NSW P, 2000. 3-20. Gunew, Sneja. "Multicultural Multplicities: US, Canada, and Australia." Meanjin 52.3 (1993): 447-461. Kennedy, Marnie. Born a Half-Caste. Canberra: Australian Institute of Aboriginal Studies, 1985. Langford Ginibi, Ruby. My Bundjalung People. St. Lucia, Qld: U of Queensland P, 1994. Le, Thanh Van , and Thang Manh Nguyen. "Vietnamese and Aborigines: Letter." Age 3 Apr. 1998: 14. Little, Janine. "Talking with Ruby Langford Ginibi." Hecate 20.1 (1994): 100-121. Morgan, Sally. My Place. South Fremantle: Fremantle Arts Centre P, 1987. Morris, Barry. "Racism, Egalitarianism and Aborigines." Race Matters: Indigenous Australians and 'Our' Society. Eds. Gillian Cowlishaw and Barry Morris. Canberra: Aboriginal Studies P, 1997. 161-176. Perera, Suvendrini, and Joseph Pugliese. "Detoxifying Australia?" Migration Action 20.2 (1998): 4-18.

APA, Harvard, Vancouver, ISO, and other styles

25

Aly, Anne. "Illegitimate: When Moderate Muslims Speak Out." M/C Journal 17, no.5 (October25, 2014). http://dx.doi.org/10.5204/mcj.890.

Full text

Abstract:

It is now almost 15 years since the world witnessed one of modern history’s most devastating terrorist attacks on the United States on 11 September 2001. Despite all its promises, the so called ‘War on Terror’ failed to combat a growing tide of violent extremism. 11 years after the US led offensive on Iraq in 2003, the rise of terrorism by non-state actors in the Arab world presents a significant concern to international security and world peace. Since 2001 Australian Muslims have consistently been called upon to openly reject terrorism committed by a minority of Muslims who adhere to an extreme interpretation of Islamic doctrine that justifies attacks on civilians both in the Arab world and abroad.The responsibility placed on Australian Muslims to actively reject terrorism comes from both official channels through government funded programs under the banner of counter terrorism and countering violent extremism and the public through the popular media. Yet, Muslims in Australia who do speak out against religiously motivated non-state terrorism find themselves in an impossible bind. They are expected to speak out as representatives of a fragmented, heterogeneous and diverse mix of communities and ideologies. Often, when they do speak out, they are viewed with suspicion and presumed to be ‘apologists for Islam’ whose claim to tolerance and the peaceful nature of Islamic doctrine purposefully ignores its true nature. Such responses render these spokespersons illegitimate- both as representatives of Muslim communities and as Australian citizens. The question “Why don’t moderate Muslims speak out against terrorism?” is often raised in the popular media in response to attacks against Western interests by jihadi groups. On 15 August 2014 an article in the Daily Telegraph by well-known conservative journalist Piers Akerman raised the question in relation to the Australian government’s announcement of increased powers for law enforcement agencies to deal with the issue of returned foreign fighters who had joined the Islamic State’s conflict in Iraq and Syria. The article, titled “It’s Time for Muslim Leaders to Speak Up” reiterated much of the construction of the silent Muslim majority that has pervaded the Australian popular media since 2001. Akerman states: “They [the Australian government] should be making it clear to Australian Muslims that they expect their leaders to speak out more vehemently against those who groom terrorists from the among the young and stupidly impressionable in their communities”. While he continues by acknowledging that Muslims in Australia are diverse in ethnicity and religious views and that the vast majority of Muslims do not support terrorism, he concludes by stating that “the few are costing the majority of Australians millions in security and those who enjoy leadership titles must accept that some responsibility attaches to their position or they should abdicate in favour of individuals who are prepared to consent to the obligations inherent in their station” (Piers Akerman). The same sentiments were expressed by Pia Ackerman in the Australian who wrote that “AUSTRALIA’S Muslim leaders need to speak out against Islamic State terrorists or risk losing their credibility and ability to reach young men attracted to the extremists’ cause” (Pia Akerman).Other responses in the popular media present a different argument. In an article titled “The Moderate Muslims Are Talking If Only You Will Listen”, David Penberthy of the Herald Sun cites examples of Muslim Australians who are speaking out including the case of prominent Sydney GP Jamal Rifi whose condemnation of terrorist activities in the Arab world has earned him death threats from members of the Islamic State (Penberthy). Yet, as Penberthy rightly acknowledges the questions “where are the moderates? Where are the decent Muslims? Are there any? Why aren’t they speaking out?” are still the most salient questions being asked of Muslims in the public sphere. For Australian Muslims at least, they are questions that pervade their everyday lives. It is these questions for example that leads Muslim women who wear the tradition head covering or hijab to challenge media representations of themselves as complicit actors in terrorism by acting as alternative sources of truth for curious co-workers and members of the broader community (see Aly, A Study).Muslim women who do not wear the hijab can face even more barriers to speaking out because they do not pass the test of ‘legitimate’ Muslims: those who fit the stereotype of the angry bearded male and the oppressed female shrouded in black. This author, who has in the past written about extremist interpretations of Islam, has faced condemnation from anti- Islamic groups who questioned her authenticity as a Muslim. By speaking out as a Muslim against the violent actions of some Muslims in other parts of the world, I was being accused of misinformed. Ironically, those who are vehemently anti- Islamic espouse the very same ideological world view and interpretations of Islamic doctrine as those Muslims they claim to oppose. Both groups rely on an extreme and minority version of Islam that de-legitimises more mainstream, nuanced interpretations and both groups claim legitimacy to the truth that Islam can only ever be violent, aggressive and oppositional.It is not just in the public and media discourses that Muslims who speak out against terrorism face being branded illegitimate. The policy response to home-grown terrorism — acts of violence carried out by Australian citizens within Australia — has, albeit inadvertently, created the conditions through which Muslims must verify their legitimate claims to being Australian by participating in the governments’ program of counter terrorism.In the wake of the 2005 London bombings, the Prime Minister met with selected representatives from Muslim communities to discuss the development of a Muslim Community Reference Group. The Group was charged with assisting the Australian Government by acting as an advisory group and by working with Muslim communities “promote harmony, mutual understanding and Australian values and to challenge violence, ignorance and rigid thinking”. This was iterated through a Statement of Principles that committed members of Muslim communities to pursue “moderate’ Islam (Prime Minister, “Meeting”). The very need for a Muslim summit and for the development of a Statement of Principles (later endorsed by the Council of Australian Governments, COAG), sends a lucid message to the Australian public that not only are Australian Muslims responsible for terrorism but that they also have the capacity to prevent or minimise the threat of an attack in Australia.In 2005, the policy response to terrorism took its first step towards linking the social harmony agenda to the securitisation of the state in the form of the National Action Plan to Build Social Cohesion, Harmony and Security. The stated purpose of the National Action Plan (NAP) notably conflated national security with social cohesion and harmony and clearly indicated an understanding that violent extremism could be addressed through programs designed to reinforce Australian values, social harmony, interfaith understanding and tolerance: “The purpose of this National Action Plan (NAP) is to reinforce social cohesion, harmony and support the national security imperative in Australia by addressing extremism, the promotion of violence and intolerance…”(Commonwealth of Australia, National Action Plan).Between 2005 and 2010, the National Action Plan provided funding for 83 community based projects deemed to meet the Plan’s criteria of addressing extremism and the promotion of violence. Of the 83 projects funded, 33 were undertaken by associations that identified as Muslim or Islamic (some applicants received funding for more than one project or in more than one round). The remaining 50 organisations funded included universities and vocational training organisations (4), multicultural social services or migrant resource centres (14), interfaith groups (3), local councils (4), ethnic organisations (specifically African, East African, Afghan, Hazara, Arabic and Pakistani), sporting clubs (4) and miscellaneous social clubs and service providers. The kinds of projects that were funded were predominantly aimed at Muslim communities, most notably youth and women, and the provision of services, programs, education, information and dialogue. Sixty five of the projects funded were explicitly aimed at Muslim communities and identified their target groups variously as: ‘African Muslim’; ‘Muslim youth’; ‘Muslim women’; ‘at risk Muslims’; ‘young Muslims’; ‘Iraqi Muslims’; ‘Lebanese Muslims’ and ‘young Muslim men from Arabic speaking backgrounds’. Seven projects were described as involving ‘interfaith’ elements, though a further 13 projects described some form of interaction between Muslim and non-Muslim communities and groups through activities such as sport, dialogue, fashion parades, workshops, art and craft programs, music workshops. 29 projects involved some form of leadership training for Muslims: youth, women and young men. Overall, the range of projects funded under the National Action Plan in the five years of its operation reflect a policy approach that specifically identifies Muslim communities (including ethno specific and new and emerging Muslim communities) as the primary target of Australia’s broader security strategy.The National Action Plan was succeeded by the Building Community Resilience (BCR) Program. Despite the positive steps taken in attempting to move the BCR program away from the social harmony policy agenda, it continued to reflect an underlying preoccupation with the assumptions of its predecessor. Between 2011- 2013 it funded 51 community based projects. Of these, 7 projects were undertaken by Islamic or Muslim associations. Ten of the projects specifically target Muslims or Muslim communities, with 6 of these being Muslim youth leadership and/or mentoring programs. The remaining 4 Muslim focussed projects include a project designed to encourage Muslim youth to build positive connections with the broader community, the development of a Common Curriculum Framework for teaching Islamic Studies in Australian Islamic primary and secondary schools, a project to address misconceptions about Islam and promote cultural understanding and the production of a DVD for schools to address misperceptions about Muslims. Notably, only one project specifically targets white supremacist violent extremism. The Australian governments’ progressive policy approach to countering violent extremism at home has disproportionately focussed on the Australian Muslim communities. In an environment where Muslims are viewed with suspicion and as having the primary responsibility as both perpetrators and gatekeepers of terroristic ideologies, Muslims in diaspora communities have been forced to make legitimate claims to their innocence. In order to do this they are required to reaffirm their commitment to Australian values, not just by speaking out against terrorism but also by participating in programs that are based on false assumptions about the nature of Muslim citizenship in Australia and the premise that Muslim Australians are, both individually and collectively, opposed to such values by virtue of their religious affiliation. In 2014 and in response to growing concerns about the number of Australians travelling to Iraq and Syria to fight alongside the Islamic State, the government made a bold move by declaring its intention to overhaul existing terror laws. The new laws would reverse the onus of proof on those who travelled to certain countries deemed to be terrorist hotspots to prove that they were not partaking in armed conflict or terrorist training. They would also give more powers to law enforcement and surveillance agencies by lowering the threshold of arrest without a warrant. The announcement of the new laws by the Prime Minister coincided with the news that the Government would abandon its controversial plans to drop section 18c from the Racial Discrimination Act which makes it unlawful to "offend, insult, humiliate or intimidate another person or a group of people" because of their race or ethnicity" (Aston). The announcement was made under the guise of a press conference on terror laws and inferred that the back down on the Racial Discrimination Act reforms were a measure to win over the Muslim communities cooperation on the new terror laws. Referring to a somewhat curious notion of “team Australia”, the Prime Minister stated “I want to work with the communities of our country as team Australia here” (Aston). “Team Australia” has since become the Government’s narrative frame for garnering public support for its proposed new terrorism laws. Echoing his predecessor John Howard, whose narrative of Australian values pervaded much of the political discourse during his term in office, Prime Minister Abbott stated in a radio interview that "everyone has got to put this country, its interests, its values and its people first, and you don't migrate to this country unless you want to join our team". He followed this statement by emphasising that "What we need to do is to encourage the moderate mainstream to speak out" (Cox).Shortly after the release of a horrific image on social media showing Australian jihadists proudly flaunting the severed heads of their victims, the Australian government reacted with an even bolder move to introduce legislation that would see the government cancelling the welfare payments of persons “identified by national security agencies as being involved in extremist conduct.” According to the Government the reforms would “enable the Department of Human Services to cancel a person’s welfare payment if it receives advice that a person has been assessed as a serious threat to Australia’s national security.”(Prime Minister of Australia) The move was criticised by several groups including academics who argued that it would not only alienate the already disenfranchised Muslim communities, but could also result in greater radicalisation (Ireland). In response to the raft of new measures perceived to be targeting Muslim communities, Australian Muslims took measured steps to voice their opposition through written statements and media releases stating that, among other things: These proposals come in the same style as those which have preceded [sic] since the Howard era. An alleged threat is blown out of all proportion as the pretext, further "tightening" of the laws is claimed necessary and rushed through, without proper national debate or community consultation. The reality of the alleged threat is also exposed by the lack of correspondence between the official 'terror threat' level, which has remained the same since 2001, and the hysterical rhetoric from government ministers. (ABC News, "Australian Muslims")Australian Muslim leaders also boycotted government meetings including a planned meeting with the Prime Minister to discuss the new laws. The Prime Minister promptly branded the boycott “foolish” (ABC News, "Tony Abbott") yet refused to acknowledge the legitimacy of the claims made in the media statements and messages by Muslim organisations that prompted the boycotts. As Australian Muslims continue to grapple with ways to legitimize their claims to citizenship, the developing discourse on national security and terrorism continues to define them as the objects of terror. Notably, the media discourse is showing some signs of accommodating the views of Muslim Australians who have found some space in the public sphere. Recent media reporting on terror activities in the Middle East has given some consideration to the voices of Muslim leaders who openly oppose violent extremism. Yet Muslims in Australia are still battling for legitimacy. Those who speak out against the hijacking of their religion by a minority who espouse a rigid and uncompromising ideology in order to justify violence often find themselves the subjects of intense scrutiny. From within their communities they are seen to be mouth pieces for an unfair and unjust government agenda that targets Muslims as objects of fear. From outside their communities they are seen to be apologists for Islam whose authenticity should be questioned if not denied. Attempts by Muslim Australians to have their voices heard through political practices that define the very nature of democracy including peaceful demonstrations, boycotts and written statements have not been taken seriously. As a result, Muslim voices in Australia are deemed illegitimate regardless of the forms or platforms through which they seek to be heard. ReferencesABC News. “Australian Muslims Denounce Proposed 'Anti-Terror' Laws”. ABC Religion and Ethics, 21 Aug. 2014. 23 Aug. 2014 .ABC News. “Tony Abbott Says Muslim Leaders 'Foolishly Boycotted' Counterterrorism Law Meeting.” 22 Aug. 2014. 24 Aug. 2014 .Akerman, Pia. “Muslim Leaders Must Speak Out against Extremists, Academic Warns.” The Australian 13 Aug. 13 2014. 20 Aug. 2014 . Akerman, Piers. “It's Time for Muslim Leaders to Speak Up.” Daily Telegraph 15 Aug. 2014. 20 Aug. 2014 .Alynne, A. A Study of Audience Responses to the Media Discourse about the ‘Other’: The Fear of Terrorism between Australian Muslims and the Broader Community. Lampeter: Edwin Mellen, 2010.Aly, Anne. “Media Hegemony, Activism and Identity: Muslim Women Re-Presenting Muslim Women.” Beyond the Hijab Debates: New Conversations on Gender, Race and Religion, eds. T. Dreher and C. Ho. Cambridge: Cambridge Scholars, 2009.Aly, Anne, and Mark Balnaves. “The Atmosfear of Terror: Affective Modulation and the War on Terror.” M/C Journal 8.6 (2005).Aly, Anne, and Lelia Green. “‘Moderate Islam’: Defining the Good Citizen.” M/C Journal 10.6/11.1 (2008). 13 April 2008 ‹http://journal.media-culture.org.au/0804/08aly-green.php›.Aston, H. “Tony Abbott Dumps Controversial Changes to 18C Racial Discrimination Laws.” Sydney Morning Herald 5 Aug. 2014. 24 Aug. 2014 .Australian Government, Attorney General's Department. Building Community Resilience Grants Program. n.d. 24 July 2014 . Commonwealth of Australia. Transnational Terrorism White Paper: The Threat to Australia. Canberra: Department of Prime Minister and Cabinet, 2004. . Commonwealth of Australia. National Action Plan to Build Social Cohesion, Harmony and Security. Canberra: Department of Immigration and Citizenship, 2006. .Commonwealth of Australia. Counter Terrorism White Paper: Securing Australia, Protecting our Community. Canberra: Department of Prime Minister and Cabinet, 2010. 19 Nov. 2011 .Cox, L. “'You Don't Migrate to This Country unless You Want to Join Our Team': Tony Abbott Renews Push on National Security Laws.” Sydney Morning Herald 18 Aug. 2014. 24 Aug. 2014 . Ireland, J. “Extremism Warning on Coalition's Move to Cut Welfare Payments.” Sydney Morning Herald 19 Aug. 2014. 24 Aug. 2014 .Penberthy, D. “The Moderate Muslims Are Talking If Only You Will Listen. Herald Sun 17 Aug. 2014 .Prime Minister of Australia. “New Counter-Terrorism Measures for a Safer Australia - Cancelling Welfare Payments to Extremists”. 16 Aug. 2014. 23 Aug. 2014 .Prime Minister of Australia. “Meeting with Islamic Community Leaders, Statement of Principles.” 23 Aug. 2005. July 2008 .

APA, Harvard, Vancouver, ISO, and other styles

26

Brien, Donna Lee. "Unplanned Educational Obsolescence: Is the ‘Traditional’ PhD Becoming Obsolete?" M/C Journal 12, no.3 (July15, 2009). http://dx.doi.org/10.5204/mcj.160.

Full text

Abstract:

Discussions of the economic theory of planned obsolescence—the purposeful embedding of redundancy into the functionality or other aspect of a product—in the 1980s and 1990s often focused on the impact of such a design strategy on manufacturers, consumers, the market, and, ultimately, profits (see, for example, Bulow; Lee and Lee; Waldman). More recently, assessments of such shortened product life cycles have included calculations of the environmental and other costs of such waste (Claudio; Kondoh; Unruh). Commonly utilised examples are consumer products such as cars, whitegoods and small appliances, fashion clothing and accessories, and, more recently, new technologies and their constituent components. This discourse has been adopted by those who configure workers as human resources, and who speak both of skills (Janßen and Backes-Gellner) and human capital itself (Chauhan and Chauhan) being made obsolete by market forces in both predictable and unplanned ways. This includes debate over whether formal education can assist in developing the skills that make their possessors less liable to become obsolete in the workforce (Dubin; Holtmann; Borghans and de Grip; Gould, Moav and Weinberg). However, aside from periodic expressions of disciplinary angst (as in questions such as whether the Liberal Arts and other disciplines are becoming obsolete) are rarely found in discussions regarding higher education. Yet, higher education has been subsumed into a culture of commercial service provision as driven by markets and profit as the industries that design and deliver consumer goods. McKelvey and Holmén characterise this as a shift “from social institution to knowledge business” in the subtitle of their 2009 volume on European universities, and the recent decade has seen many higher educational institutions openly striving to be entrepreneurial. Despite some debate over the functioning of market or market-like mechanisms in higher education (see, for instance, Texeira et al), the corporatisation of higher education has led inevitably to market segmentation in the products the sector delivers. Such market segmentation results in what are called over-differentiated products, seemingly endless variations in the same product to attempt to increase consumption and attendant sales. Milk is a commonly cited example, with supermarkets today stocking full cream, semi-skimmed, skimmed, lactose-free, soy, rice, goat, GM-free and ‘smart’ (enriched with various vitamins, minerals and proteins) varieties; and many of these available in fresh, UHT, dehydrated and/or organic versions. In the education market, this practice has resulted in a large number of often minutely differentiated, but differently named, degrees and other programs. Where there were once a small number of undergraduate degrees with discipline variety within them (including the Bachelor of Arts and Bachelor of Science awards), students can now graduate with a named qualification in a myriad of discipline and professional areas. The attempt to secure a larger percentage of the potential client pool (who are themselves often seeking to update their own skills and knowledges to avoid workforce obsolescence) has also resulted in a significant increase in the number of postgraduate coursework certificates, diplomas and other qualifications across the sector. The Masters degree has fractured from a research program into a range of coursework, coursework plus research, and research only programs. Such proliferation has also affected one of the foundations of the quality and integrity of the higher education system, and one of the last bastions of conventional practice, the doctoral degree. The PhD as ‘Gold-Standard’ Market Leader? The Doctor of Philosophy (PhD) is usually understood as a largely independent discipline-based research project that results in a substantial piece of reporting, the thesis, that makes a “substantial original contribution to knowledge in the form of new knowledge or significant and original adaptation, application and interpretation of existing knowledge” (AQF). As the highest level of degree conferred by most universities, the PhD is commonly understood as indicating the height of formal educational attainment, and has, until relatively recently, been above reproach and alteration. Yet, whereas universities internationally once offered a single doctorate named the PhD, many now offer a number of doctoral level degrees. In Australia, for example, candidates can also complete PhDs by Publication and by Project, as well as practice-led doctorates in, and named Doctorates of/in, Creative Arts, Creative Industries, Laws, Performance and other ‘new’ discipline areas. The Professional Doctorate, introduced into Australia in the early 1990s, has achieved such longevity that it now has it’s own “first generation” incarnations in (and about) disciplines such as Education, Business, Psychology and Journalism, as well as a contemporary “second generation” version which features professionally-practice-led Mode 2 knowledge production (Maxwell; also discussed in Lee, Brennan and Green 281). The uniquely Australian PhD by Project in the disciplines of architecture, design, business, engineering and education also includes coursework, and is practice and particularly workplace (or community) focused, but unlike the above, does not have to include a research element—although this is not precluded (Usher). A significant number of Australian universities also currently offer a PhD by Publication, known also as the PhD by Published Papers and PhD by Published Works. Introduced in the 1960s in the UK, the PhD by Publication there is today almost exclusively undertaken by academic staff at their own institutions, and usually consists of published work(s), a critical appraisal of that work within the research context, and an oral examination. The named degree is rare in the USA, although the practice of granting PhDs on the basis of prior publications is not unknown. In Australia, an examination of a number of universities that offer the degree reveals no consistency in terms of the framing policies except for the generic Australian Qualifications Framework accreditation statement (AQF), entry requirements and conditions of candidature, or resulting form and examination guidelines. Some Australian universities, for instance, require all externally peer-refereed publications, while others will count works that are self-published. Some require actual publications or works in press, but others count works that are still at submission stage. The UK PhD by Publication shows similar variation, with no consensus on purpose, length or format of this degree (Draper). Across Australia and the UK, some institutions accept previously published work and require little or no campus participation, while others have a significant minimum enrolment period and count only work generated during candidature (see Brien for more detail). Despite the plethora of named degrees at doctoral level, many academics continue to support the PhD’s claim to rigor and intellectual attainment. Most often, however, these arguments cite tradition rather than any real assessment of quality. The archaic trappings of conferral—the caps, gowns and various other instruments of distinction—emphasise a narrative in which it is often noted that doctorates were first conferred by the University of Paris in the 12th century and then elsewhere in medieval Europe. However, challenges to this account note that today’s largely independently researched thesis is a relatively recent arrival to educational history, being only introduced into Germany in the early nineteenth century (Bourner, Bowden and Laing; Park 4), the USA in a modified form in the mid-nineteenth century and the UK in 1917 (Jolley 227). The Australian PhD is even more recent, with the first only awarded in 1948 and still relatively rare until the 1970s (Nelson 3; Valadkhani and Ville). Additionally, PhDs in the USA, Canada and Denmark today almost always incorporate a significant taught coursework element (Noble). This is unlike the ‘traditional’ PhD in the UK and Australia, although the UK also currently offers a number of what are known there as ‘taught doctorates’. Somewhat confusingly, while these do incorporate coursework, they still include a significant research component (UKCGE). However, the UK is also adopting what has been identified as an American-inflected model which consists mostly, or largely, of coursework, and which is becoming known as the ‘New Route British PhD’ (Jolley 228). It could be posited that, within such a competitive market environment, which appears to be driven by both a drive for novelty and a desire to meet consumer demand, obsolescence therefore, and necessarily, threatens the very existence of the ‘traditional’ PhD. This obsolescence could be seen as especially likely as, alongside the existence of the above mentioned ‘new’ degrees, the ‘traditional’ research-based PhD at some universities in Australia and the UK in particular is, itself, also in the process of becoming ‘professionalised’, with some (still traditionally-framed) programs nevertheless incorporating workplace-oriented frameworks and/or experiences (Jolley 229; Kroll and Brien) to meet professionally-focused objectives that it is acknowledged cannot be met by producing a research thesis alone. While this emphasis can be seen as operating at the expense of specific disciplinary knowledge (Pole 107; Ball; Laing and Brabazon 265), and criticised for that, this workplace focus has arisen, internationally, as an institutional response to requests from both governments and industry for training in generic skills in university programs at all levels (Manathunga and Wissler). At the same time, the acknowledged unpredictability of the future workplace is driving a cognate move from discipline specific knowledge to what have been described as “problem solving and knowledge management approaches” across all disciplines (Gilbert; Valadkhani and Ville 2). While few query a link between university-level learning and the needs of the workplace, or the motivating belief that the overarching role of higher education is the provision of professional training for its client-students (see Laing and Brabazon for an exception), it also should be noted that a lack of relevance is one of the contributors to dysfunction, and thence to obsolescence. The PhD as Dysfunctional Degree? Perhaps, however, it is not competition that threatens the traditional PhD but, rather, its own design flaws. A report in The New York Times in 2007 alerted readers to what many supervisors, candidates, and researchers internationally have recognised for some time: that the PhD may be dysfunctional (Berger). In Australia and elsewhere, attention has focused on the uneven quality of doctoral-level degrees across institutions, especially in relation to their content, rigor, entry and assessment standards, and this has not precluded questions regarding the PhD (AVCC; Carey, Webb, Brien; Neumann; Jolley; McWilliam et al., "Silly"). It should be noted that this important examination of standards has, however, been accompanied by an increase in the awarding of Honorary Doctorates. This practice ranges from the most reputable universities’ recognising individuals’ significant contributions to knowledge, culture and/or society, to wholly disreputable institutions offering such qualifications in return for payment (Starrs). While generally contested in terms of their status, Honorary Doctorates granted to sports, show business and political figures are the most controversial and include an award conferred on puppet Kermit the Frog in 1996 (Jeffries), and some leading institutions including MIT, Cornell University and the London School of Economics and Political Science are distinctive in not awarding Honorary Doctorates. However, while distracting, the Honorary Doctorate itself does not answer all the questions regarding the quality of doctoral programs in general, or the Doctor of Philosophy in particular. The PhD also has high attrition rates: 50 per cent or more across Australia, the USA and Canada (Halse 322; Lovitts and Nelson). For those who remain in the programs, lengthy completion times (known internationally as ‘time-to-degree’) are common in many countries, with averages of 10.5 years to completion in Canada, and from 8.2 to more than 13 years (depending on discipline) in the USA (Berger). The current government performance-based funding model for Australian research higher degrees focuses attention on timely completion, and there is no doubt that, under this system—where universities only receive funding for a minimum period of candidature when those candidates have completed their degrees—more candidates are completing within the required time periods (Cuthbert). Yet, such a focus has distracted from assessment of the quality and outcomes of such programs of study. A detailed survey, based on the theses lodged in Australian libraries, has estimated that at least 51,000 PhD theses were completed in Australia to 2003 (Evans et al. 7). However, little attention has been paid to the consequences of this work, that is, the effects that the generation of these theses has had on either candidates or the nation. There has been no assessment, for instance, of the impact on candidates of undertaking and completing a doctorate on such facets of their lives as their employment opportunities, professional choices and salary levels, nor any effect on their personal happiness or levels of creativity. Nor has there been any real evaluation of the effect of these degrees on GDP, rates of the commercialisation of research, the generation of intellectual property, meeting national agendas in areas such as innovation, productivity or creativity, and/or the quality of the Australian creative and performing arts. Government-funded and other Australian studies have, however, noted for at least a decade both that the high numbers of graduates are mismatched to a lack of market demand for doctoral qualifications outside of academia (Kemp), and that an oversupply of doctorally qualified job seekers is driving wages down in some sectors (Jones 26). Even academia is demanding more than a PhD. Within the USA, doctoral graduates of some disciplines (English is an often-cited example) are undertaking second PhDs in their quest to secure an academic position. In Australia, entry-level academic positions increasingly require a scholarly publishing history alongside a doctoral-level qualification and, in common with other quantitative exercises in the UK and in New Zealand, the current Excellence in Research for Australia research evaluation exercise values scholarly publications more than higher degree qualifications. Concluding Remarks: The PhD as Obsolete or Retro-Chic? Disciplines and fields are reacting to this situation in various ways, but the trend appears to be towards increased market segmentation. Despite these charges of PhD dysfunction, there are also dangers in the over-differentiation of higher degrees as a practice. If universities do not adequately resource the professional development and other support for supervisors and all those involved in the delivery of all these degrees, those institutions may find that they have spread the existing skills, knowledge and other institutional assets too thinly to sustain some or even any of these degrees. This could lead to the diminishing quality (and an attendant diminishing perception of the value) of all the higher degrees available in those institutions as well as the reputation of the hosting country’s entire higher education system. As works in progress, the various ‘new’ doctoral degrees can also promote a sense of working on unstable ground for both candidates and supervisors (McWilliam et al., Research Training), and higher degree examiners will necessarily be unfamiliar with expected standards. Candidates are attempting to discern the advantages and disadvantages of each form in order to choose the degree that they believe is right for them (see, for example, Robins and Kanowski), but such assessment is difficult without the benefit of hindsight. Furthermore, not every form may fit the unpredictable future aspirations of candidates or the volatile future needs of the workplace. The rate with which everything once new descends from stylish popularity through stages of unfashionableness to become outdated and, eventually, discarded is increasing. This escalation may result in the discipline-based research PhD becoming seen as archaic and, eventually, obsolete. Perhaps, alternatively, it will lead to newer and more fashionable forms of doctoral study being discarded instead. Laing and Brabazon go further to find that all doctoral level study’s inability to “contribute in a measurable and quantifiable way to social, economic or political change” problematises the very existence of all these degrees (265). Yet, we all know that some objects, styles, practices and technologies that become obsolete are later recovered and reassessed as once again interesting. They rise once again to be judged as fashionable and valuable. Perhaps even if made obsolete, this will be the fate of the PhD or other doctoral degrees?References Australian Qualifications Framework (AQF). “Doctoral Degree”. AQF Qualifications. 4 May 2009 ‹http://www.aqf.edu.au/doctor.htm›. Australian Vice-Chancellors’ Committee (AVCC). Universities and Their Students: Principles for the Provision of Education by Australian Universities. Canberra: AVCC, 2002. 4 May 2009 ‹http://www.universitiesaustralia.edu.au/documents/publications/Principles_final_Dec02.pdf›. Ball, L. “Preparing Graduates in Art and Design to Meet the Challenges of Working in the Creative Industries: A New Model For Work.” Art, Design and Communication in Higher Education 1.1 (2002): 10–24. Berger, Joseph. “Exploring Ways to Shorten the Ascent to a Ph.D.” Education. The New York Times, 3 Oct. 2008. 4 May 2009 ‹http://nytimes.com/2007/10/03/education/03education.html›. Borghans, Lex, and Andries de Grip. Eds. The Overeducated Worker?: The Economics of Skill Utilization. Cheltenham, UK: Edward Elgar, 2000. Bourner, T., R. Bowden and S. Laing. “Professional Doctorates in England”. Studies in Higher Education 26 (2001) 65–83. Brien, Donna Lee. “Publish or Perish?: Investigating the Doctorate by Publication in Writing”. The Creativity and Uncertainty Papers: the Refereed Proceedings of the 13th Conference of the Australian Association of Writing Programs. AAWP, 2008. 4 May 2009 ‹http://www.aawp.org.au/creativity-and-uncertainty-papers›. Bulow, Jeremy. “An Economic Theory of Planned Obsolescence.” The Quarterly Journal of Economics 101.4 (Nov. 1986): 729–50. Carey, Janene, Jen Webb, and Donna Lee Brien. “Examining Uncertainty: Australian Creative Research Higher Degrees”. The Creativity and Uncertainty Papers: the Refereed Proceedings of the 13th Conference of the Australian Association of Writing Programs. AAWP, 2008. 4 May 2009 ‹http://www.aawp.org.au/creativity-and-uncertainty-papers›. Chauhan, S. P., and Daisy Chauhan. “Human Obsolescence: A Wake–up Call to Avert a Crisis.” Global Business Review 9.1 (2008): 85–100. Claudio, Luz. "Environmental Impact of the Clothing Industry." Environmental Health Perspectives 115.9 (Set. 2007): A449–54. Cuthbert, Denise. “HASS PhD Completions Rates: Beyond the Doom and Gloom”. Council for the Humanities, Arts and Social Sciences, 3 March 2008. 4 May 2009 ‹http://www.chass.org.au/articles/ART20080303DC.php›. Draper, S. W. PhDs by Publication. University of Glasgow, 11 Aug. 2008. 4 May 2009 ‹http://www.psy.gla.ac.uk/~steve/resources/phd.html. Dubin, Samuel S. “Obsolescence or Lifelong Education: A Choice for the Professional.” American Psychologist 27.5 (1972): 486–98. Evans, Terry, Peter Macauley, Margot Pearson, and Karen Tregenza. “A Brief Review of PhDs in Creative and Performing Arts in Australia”. Proceeding of the Association for Active Researchers Newcastle Mini-Conference, 2–4 October 2003. Melbourne: Australian Association for Research in Education, 2003. 4 May 2009 ‹http://www.aare.edu.au/conf03nc. Gilbert, R. “A Framework for Evaluating the Doctoral Curriculum”. Assessment and Evaluation in Higher Education 29.3 (2004): 299–309. Gould, Eric D., Omer Moav, and Bruce A. Weinberg. “Skill Obsolescence and Wage Inequality within Education Groups.” The Economics of Skills Obsolescence. Eds. Andries de Grip, Jasper van Loo, and Ken Mayhew. Amsterdam: JAI Press, 2002. 215–34. Halse, Christine. “Is the Doctorate in Crisis?” Nagoya Journal of Higher Education 34 Apr. (2007): 321–37. Holtmann, A.G. “On-the-Job Training, Obsolescence, Options, and Retraining.” Southern Economic Journal 38.3 (1972): 414–17. Janßen, Simon, and Uschi Backes-Gellner. “Skill Obsolescence, Vintage Effects and Changing Tasks.” Applied Economics Quarterly 55.1 (2009): 83–103. Jeffries, Stuart. “I’m a Celebrity, Get Me an Honorary Degree”. The Guardian 6 July 2006. 4 May 2009 ‹http://www.guardian.co.uk/music/2006/jul/06/highereducation.popandrock. Jolley, Jeremy. “Choose your Doctorate.” Journal of Clinical Nursing 16.2 (2007): 225–33. Jones, Elka. “Beyond Supply and Demand: Assessing the Ph.D. Job Market.” Occupational Outlook Quarterly Winter (2002-2003): 22–33. Kemp, D. ­New Knowledge, New Opportunities: A Discussion Paper on Higher Education Research and Research Training. Canberra: Australian Government Printing Service, 1999. Kondoh, Shinsuke, Keijiro Masui, Mitsuro Hattori, Nozomu Mishima, and Mitsutaka Matsumoto. “Total Performance Analysis of Product Life Cycle Considering the Deterioration and Obsolescence of Product Value.” International Journal of Product Development 6.3–4 (2008): 334–52. Kroll, Jeri, and Donna Lee Brien. “Studying for the Future: Training Creative Writing Postgraduates For Life After Degrees.” Australian Online Journal of Arts Education 2.1 July (2006): 1–13. Laing, Stuart, and Tara Brabazon. “Creative Doctorates, Creative Education? Aligning Universities with the Creative Economy.” Nebula 4.2 (June 2007): 253–67. Lee, Alison, Marie Brennan, and Bill Green. “Re-imagining Doctoral Education: Professional Doctorates and Beyond.” Higher Education Research & Development 28.3 2009): 275–87. Lee, Ho, and Jonghwa Lee. “A Theory of Economic Obsolescence.” The Journal of Industrial Economics 46.3 (Sep. 1998): 383–401. Lovitts, B. E., and C. Nelson. “The Hidden Crisis in Graduate Education: Attrition from Ph.D. Programs.” Academe 86.6 (2000): 44–50. Manathunga, Catherine, and Rod Wissler. “Generic Skill Development for Research Higher Degree Students: An Australian Example”. International Journal of Instructional Media, 30.3 (2003): 233–46. Maxwell, T. W. “From First to Second Generation Professional Doctorate.” Studies in Higher Education 28.3 (2003): 279–91. McKelvey, Maureen, and Magnus Holmén. Ed. Learning to Compete in European Universities: From Social Institution to Knowledge Business. Cheltenham, UK: Edward Elgar Publishing, 2009. McWilliam, Erica, Alan Lawson, Terry Evans, and Peter G Taylor. “‘Silly, Soft and Otherwise Suspect’: Doctoral Education as Risky Business”. Australian Journal of Education 49.2 (2005): 214–27. 4 May 2009. http://eprints.qut.edu.au/archive/00004171. McWilliam, Erica, Peter G. Taylor, P. Thomson, B. Green, T. W. Maxwell, H. Wildy, and D. Simmons. Research Training in Doctoral Programs: What Can Be Learned for Professional Doctorates? Evaluations and Investigations Programme 02/8. Canberra: Commonwealth of Australia, 2002. Nelson, Hank. “A Doctor in Every House: The PhD Then Now and Soon”. Occasional Paper GS93/3. Canberra: The Graduate School, Australian National University, 1993. 4 May 2009 ‹http://dspace.anu.edu.au/bitstream/1885/41552/1/GS93_3.pdf›. Neumann, Ruth. The Doctoral Education Experience: Diversity and Complexity. 03/12 Evaluations and Investigations Programme. Canberra: Department of Education, Science and Training, 2003. Noble K. A. Changing Doctoral Degrees: An International Perspective. Buckingham: Society for Research into Higher Education, 1994. Park, Chris. Redefining the Doctorate: Discussion Paper. York: The Higher Education Academy, 2007. Pole, Christopher. “Technicians and Scholars in Pursuit of the PhD: Some Reflections on Doctoral Study.” Research Papers in Education 15 (2000): 95–111. Robins, Lisa M., and Peter J. Kanowski. “PhD by Publication: A Student’s Perspective”. Journal of Research Practice 4.2 (2008). 4 May 2009 ‹http://jrp.icaap.org›. Sheely, Stephen. “The First Among Equals: The PhD—Academic Standard or Historical Accident?”. Advancing International Perspectives: Proceedings of the Higher Education Research and Development Society of Australasia Conference, 1997. 654-57. 4 May 2009 ‹http://www.herdsa.org.au/wp-content/uploads/conference/1997/sheely01.pdf›. Texeira, Pedro, Ben Jongbloed, David Dill, and Alberto Amaral. Eds. Markets in Higher Education: Rethoric or Reality? Dordrecht, the Netherlands: Kluwer, 2004. UK Council for Graduate Education (UKCGE). Professional Doctorates. Dudley: UKCGE, 2002. Unruh, Gregory C. “The Biosphere Rules.” Harvard Business Review Feb. 2008: 111–17. Usher R. “A Diversity of Doctorates: Fitness for the Knowledge Economy?”. Higher Education Research & Development 21 (2002): 143–53. Valadkhani, Abbas, and Simon Ville. “A Disciplinary Analysis of the Contribution of Academic Staff to PhD Completions in Australian Universities”. International Journal of Business & Management Education 15.1 (2007): 1–22. Waldman, Michael. “A New Perspective on Planned Obsolescence.” The Quarterly Journal of Economics 108.1 (Feb. 1993): 273–83.

APA, Harvard, Vancouver, ISO, and other styles

27

Caluya, Gilbert. "The Architectural Nervous System." M/C Journal 10, no.4 (August1, 2007). http://dx.doi.org/10.5204/mcj.2689.

Full text

Abstract:

If the home is traditionally considered to be a space of safety associated with the warm and cosy feeling of the familial hearth, it is also continuously portrayed as a space under threat from the outside from which we must secure ourselves and our families. Securing the home entails a series of material, discursive and performative strategies, a host of precautionary measures aimed at regulating and ultimately producing security. When I was eleven my family returned home from the local fruit markets to find our house had been ransacked. Clothes were strewn across the floor, electrical appliances were missing and my parents’ collection of jewellery – wedding rings and heirlooms – had been stolen. Few things remained untouched and the very thought of someone else’s hands going through our personal belongings made our home feel tainted. My parents were understandably distraught. As Filipino immigrants to Australia the heirlooms were not only expensive assets from both sides of my family, but also signifiers of our homeland. Added to their despair was the fact that this was our first house – we had rented prior to that. During the police interviews, we discovered that our area, Sydney’s Western suburbs, was considered ‘high-risk’ and we were advised to install security. In their panic my parents began securing their home. Grills were installed on every window. Each external wooden door was reinforced by a metal security door. Movement detectors were installed at the front of the house, which were set to blind intruders with floodlights. Even if an intruder could enter the back through a window a metal grill security door was waiting between the backroom and the kitchen to stop them from getting to our bedrooms. In short, through a series of transformations our house was made into a residential fortress. Yet home security had its own dangers. A series of rules and regulations were drilled into me ‘in case of an emergency’: know where your keys are in case of a fire so that you can get out; remember the phone numbers for an emergency and the work numbers of your parents; never let a stranger into the house; and if you need to speak to a stranger only open the inside door but leave the security screen locked. Thus, for my Filipino-migrant family in the 1990s, a whole series of defensive behaviours and preventative strategies were produced and disseminated inside and around the home to regulate security risks. Such “local knowledges” were used to reinforce the architectural manifestations of security at the same time that they were a response to the invasion of security systems into our house that created a new set of potential dangers. This article highlights “the interplay of material and symbolic geographies of home” (Blunt and Varley 4), focusing on the relation between urban fears circulating around and within the home and the spatial practices used to negotiate such fears. In exploring home security systems it extends the exemplary analysis of home technologies already begun in Lynn Spigel’s reading of the ‘smart home’ (381-408). In a similar vein, David Morley’s analysis of mediated domesticity shows how communications technology has reconfigured the inside and outside to the extent that television actually challenges the physical boundary that “protects the privacy and solidarity of the home from the flux and threat of the outside world” (87). Television here serves as a passage in which the threat of the outside is reframed as news or entertainment for family viewing. I take this as a point of departure to consider the ways that this mediated fear unfolds in the technology of our homes. Following Brian Massumi, I read the home as “a node in a circulatory network of many dimensions (each corresponding to a technology of transmission)” (85). For Massumi, the home is an event-space at the crossroads of media technologies and political technologies. “In spite of the locks on the door, the event-space of the home must be seen as one characterized by a very loose regime of passage” (85). The ‘locked door’ is not only a boundary marker that defines the inside from the outside but another technology that leads us outside the home into other domains of inquiry: the proliferation of security technologies and the mundane, fearful intimacies of the home. In this context, we should heed Iris Marion Young’s injunction to feminist critics that the home does provide some positives including a sense of privacy and the space to build relationships and identities. Yet, as Colomina argues, the traditional domestic ideal “can only be produced by engaging the home in combat” (20). If, as Colomina’s comment suggests, ontological security is at least partially dependent on physical security, then this article explores the ontological effects of our home security systems. Houses at War: Targeting the Family As Beatriz Colomina reminds us, in times of war we leave our homelands to do battle on the front line, but battle lines are also being drawn in our homes. Drawing inspiration from Virilio’s claim that contemporary war takes place without fighting, Colomina’s article ‘Domesticity at War’ contemplates the domestic interior as a “battlefield” (15). The house, she writes, is “a mechanism within a war where the differences between defense [sic] and attack have become blurred” (17). According to the Home Security Precautions, New South Wales, October 1999 report conducted by the Australian Bureau of Statistics, 47% of NSW dwellings were ‘secure’ (meaning that they either had a burglar alarm, or all entry points were secured or they were inside a security block) while only 9% of NSW households had no home security devices present (Smith 3). In a similar report for Western Australia conducted in October 2004, an estimated 71% of WA households had window security of some sort (screens, locks or shutters) while 67% had deadlocks on at least one external door (4). An estimated 27% had a security alarm installed while almost half (49%) had sensor lights (Hubbard 4-5). This growing sense of insecurity means big business for those selling security products and services. By the end of June 1999, there were 1,714 businesses in Australia’s security services industry generating $1,395 million of income during 1998-99 financial year (McLennan 3; see also Macken). This survey did not include locksmith services or the companies dealing with alarm manufacturing, wholesaling or installing. While Colomina’s article focuses on the “war with weather” and the attempts to control environmental conditions inside the home through what she calls “counterdomesticity” (20), her conceptualisation of the house as a “military weapon” (17) provides a useful tool for thinking the relation between the home, architecture and security. Conceiving of the house as a military weapon might seem like a stretch, but we should recall that the rhetoric of war has already leaked into the everyday. One hears of the ‘war on drugs’ and the ‘war on crime’ in the media. ‘War’ is the everyday condition of our urban jungles (see also Diken and Lausten) and in order to survive, let alone feel secure, one must be able to defend one’s family and home. Take, for example, Signal Security’s website. One finds a panel on the left-hand side of the screen to all webpages devoted to “Residential Products”. Two circular images are used in the panel with one photograph overlapping the other. In the top circle, a white nuclear family (stereotypical mum, dad and two kids), dressed in pristine white clothing bare their white teeth to the internet surfer. Underneath this photo is another photograph in which an arm clad in a black leather jacket emerges through a smashed window. In the foreground a black-gloved hand manipulates a lock, while a black balaclava masks an unrecognisable face through the broken glass. The effect of their proximity produces a violent juxtaposition in which the burglar visually intrudes on the family’s domestic bliss. The panel stages a struggle between white and black, good and bad, family and individual, security and insecurity, recognisability and unidentifiability. It thus codifies the loving, knowable family as the domestic space of security against the selfish, unidentifiable intruder (presumed not to have a family) as the primary reason for insecurity in the family home – and no doubt to inspire the consumption of security products. Advertisements of security products thus articulate the family home as a fragile innocence constantly vulnerable from the outside. From a feminist perspective, this image of the family goes against the findings of the National Homicide Monitoring Program, which shows that 57% of the women killed in Australia between 2004 and 2005 were killed by an intimate partner while 17% were killed by a family member (Mouzos and Houliaras 20). If, on the one hand, the family home is targeted by criminals, on the other, it has emerged as a primary site for security advertising eager to exploit the growing sense of insecurity – the family as a target market. The military concepts of ‘target’ and ‘targeting’ have shifted into the benign discourse of strategic advertising. As Dora Epstein writes, “We arm our buildings to arm ourselves from the intrusion of a public fluidity, and thus our buildings, our architectures of fortification, send a very clear message: ‘avoid this place or protect yourself’” (1997: 139). Epstein’s reference to ‘architectures of fortification’ reminds us that the desire to create security through the built environment has a long history. Nan Ellin has argued that fear’s physical manifestation can be found in the formation of towns from antiquity to the Renaissance. In this sense, towns and cities are always already a response to the fear of foreign invaders (Ellin 13; see also Diken and Lausten 291). This fear of the outsider is most obviously manifested in the creation of physical walls. Yet fortification is also an effect of spatial allusions produced by the configuration of space, as exemplified in Fiske, Hodge and Turner’s semiotic reading of a suburban Australian display home without a fence. While the lack of a fence might suggest openness, they suggest that the manicured lawn is flat so “that eyes can pass easily over it – and smooth – so that feet will not presume to” (30). Since the front garden is best viewed from the street it is clearly a message for the outside, but it also signifies “private property” (30). Space is both organised and lived, in such a way that it becomes a medium of communication to passers-by and would-be intruders. What emerges in this semiotic reading is a way of thinking about space as defensible, as organised in a way that space can begin to defend itself. The Problematic of Defensible Space The incorporation of military architecture into civil architecture is most evident in home security. By security I mean the material systems (from locks to electronic alarms) and precautionary practices (locking the door) used to protect spaces, both of which are enabled by a way of imagining space in terms of risk and vulnerability. I read Oscar Newman’s 1972 Defensible Space as outlining the problematic of spatial security. Indeed, it was around that period that the problematic of crime prevention through urban design received increasing attention in Western architectural discourse (see Jeffery). Newman’s book examines how spaces can be used to reinforce human control over residential environments, producing what he calls ‘defensible space.’ In Newman’s definition, defensible space is a model for residential environments which inhibits crime by creating the physical expression of a social fabric that defends itself. All the different elements which combine to make a defensible space have a common goal – an environment in which latent territoriality and sense of community in the inhabitants can be translated into responsibility for ensuring a safe, productive, and well-maintained living space (3). Through clever design space begins to defend itself. I read Newman’s book as presenting the contemporary problematic of spatialised security: how to structure space so as to increase control; how to organise architecture so as to foster territorialism; how to encourage territorial control through amplifying surveillance. The production of defensible space entails moving away from what he calls the ‘compositional approach’ to architecture, which sees buildings as separate from their environments, and the ‘organic approach’ to architecture, in which the building and its grounds are organically interrelated (Newman 60). In this approach Newman proposes a number of changes to space: firstly, spaces need to be multiplied (one no longer has a simple public/private binary, but also semi-private and semi-public spaces); secondly, these spaces must be hierarchised (moving from public to semi-public to semi-private to private); thirdly, within this hierarchy spaces can also be striated using symbolic or material boundaries between the different types of spaces. Furthermore, spaces must be designed to increase surveillance: use smaller corridors serving smaller sets of families (69-71); incorporate amenities in “defined zones of influence” (70); use L-shaped buildings as opposed to rectangles (84); use windows on the sides of buildings to reveal the fire escape from outside (90). As he puts it, the subdivision of housing projects into “small, recognisable and comprehensible-at-a-glance enclaves is a further contributor to improving the visual surveillance mechanism” (1000). Finally, Newman lays out the principle of spatial juxtaposition: consider the building/street interface (positioning of doors and windows to maximise surveillance); consider building/building interface (e.g. build residential apartments next to ‘safer’ commercial, industrial, institutional and entertainment facilities) (109-12). In short, Newman’s book effectively redefines residential space in terms of territorial zones of control. Such zones of influence are the products of the interaction between architectural forms and environment, which are not reducible to the intent of the architect (68). Thus, in attempting to respond to the exigencies of the moment – the problem of urban crime, the cost of housing – Newman maps out residential space in what Foucault might have called a ‘micro-physics of power’. During the mid-1970s through to the 1980s a number of publications aimed at the average householder are printed in the UK and Australia. Apart from trade publishing (Bunting), The UK Design Council released two small publications (Barty, White and Burall; Design Council) while in Australia the Department of Housing and Construction released a home safety publication, which contained a small section on security, and the Australian Institute of Criminology published a small volume entitled Designing out Crime: Crime prevention through environmental design (Geason and Wilson). While Newman emphasised the responsibility of architects and urban planners, in these publications the general concerns of defensible space are relocated in the ‘average homeowner’. Citing crime statistics on burglary and vandalism, these publications incite their readers to take action, turning the homeowner into a citizen-soldier. The householder, whether he likes it or not, is already in a struggle. The urban jungle must be understood in terms of “the principles of warfare” (Bunting 7), in which everyday homes become bodies needing protection through suitable architectural armour. Through a series of maps and drawings and statistics, the average residential home is transformed into a series of points of vulnerability. Home space is re-inscribed as a series of points of entry/access and lines of sight. Simultaneously, through lists of ‘dos and don’ts’ a set of precautionary behaviours is inculcated into the readers. Principles of security begin codifying the home space, disciplining the spatial practices of the intimate, regulating the access and mobility of the family and guests. The Architectural Nervous System Nowadays we see a wild, almost excessive, proliferation of security products available to the ‘security conscious homeowner’. We are no longer simply dealing with security devices designed to block – such as locks, bolts and fasteners. The electronic revolution has aided the production of security devices that are increasingly more specialised and more difficult to manipulate, which paradoxically makes it more difficult for the security consumer to understand. Detection systems now include continuous wiring, knock-out bars, vibration detectors, breaking glass detectors, pressure mats, underground pressure detectors and fibre optic signalling. Audible alarm systems have been upgraded to wire-free intruder alarms, visual alarms, telephone warning devices, access control and closed circuit television and are supported by uninterruptible power supplies and control panels (see Chartered Institution of Building Service Engineers 19-39). The whole house is literally re-routed as a series of relays in an electronic grid. If the house as a security risk is defined in terms of points of vulnerability, alarm systems take these points as potential points of contact. Relays running through floors, doors and windows can be triggered by pressure, sound or dislocation. We see a proliferation of sensors: switching sensors, infra-red sensors, ultrasonic sensors, microwave radar sensors, microwave fence sensors and microphonic sensors (see Walker). The increasing diversification of security products attests to the sheer scale of these architectural/engineering changes to our everyday architecture. In our fear of crime we have produced increasingly more complex security products for the home, thus complexifying the spaces we somehow inherently feel should be ‘simple’. I suggest that whereas previous devices merely reinforced certain architectural or engineering aspects of the home, contemporary security products actually constitute the home as a feeling, architectural body capable of being affected. This recalls notions of a sensuous architecture and bodily metaphors within architectural discourse (see Thomsen; Puglini). It is not simply our fears that lead us to secure our homes through technology, but through our fears we come to invest our housing architecture with a nervous system capable of fearing for itself. Our eyes and ears become detection systems while our screams are echoed in building alarms. Body organs are deterritorialised from the human body and reterritorialised on contemporary residential architecture, while our senses are extended through modern security technologies. The vulnerable body of the family home has become a feeling body conscious of its own vulnerability. It is less about the physical expression of fear, as Nan Ellin has put it, than about how building materialities become capable of fearing for themselves. What we have now are residential houses that are capable of being more fully mobilised in this urban war. Family homes become bodies that scan the darkness for the slightest movements, bodies that scream at the slightest possibility of danger. They are bodies that whisper to each other: a house can recognise an intrusion and relay a warning to a security station, informing security personnel without the occupants of that house knowing. They are the newly produced victims of an urban war. Our homes are the event-spaces in which mediated fear unfolds into an architectural nervous system. If media plug our homes into one set of relations between ideologies, representations and fear, then the architectural nervous system plugs that back into a different set of relations between capital, fear and the electronic grid. The home is less an endpoint of broadcast media than a node in an electronic network, a larger nervous system that encompasses the globe. It is a network that plugs architectural nervous systems into city electronic grids into mediated subjectivities into military technologies and back again, allowing fear to be disseminated and extended, replayed and spliced into the most banal aspects of our domestic lives. References Barty, Euan, David White, and Paul Burall. Safety and Security in the Home. London: The Design Council, 1980. Blunt, Alison, and Ann Varley. “Introduction: Geographies of Home.” Cultural Geographies 11.1 (2004): 3-6. Bunting, James. The Protection of Property against Crime. Folkestone: Bailey Brothers & Sinfen, 1975. Chartered Institution of Building Service Engineers. Security Engineering. London: CIBSE, 1991. Colomina, Beatriz. “Domesticity at War.” Assemblage 16 (1991): 14-41. Department of Housing and Construction. Safety in and around the Home. Canberra: Australian Government Publishing Service, 1981. Design Council. The Design Centre Guide to Domestic Safety and Security. London: Design Council, 1976. Diken, Bülent, and Carsten Bagge Lausten. “Zones of Indistinction: Security and Terror, and Bare Life.” Space and Culture 5.3 (2002): 290-307. Ellin, Nan. “Shelter from the Storm or Form Follows Fear and Vice Versa.” Architecture of Fear. Ed. Nan Ellin. New York: Princeton Architectural Press, 1997. Epstein, Dora. “Abject Terror: A Story of Fear, Sex, and Architecture.” Architecture of Fear. Ed. Nan Ellin. New York: Princeton Architectural Press, 1997. Fiske, John, Bob Hodge, and Graeme Turner. Myths of Oz: Reading Australian Popular Culture. Sydney: Allen & Unwin, 1987. Geason, Susan, and Paul Wilson. Designing Out Crime: Crime Prevention through Environmental Design. Canberra: Australian Institute of Criminology, 1989. Hubbard, Alan. Home Safety and Security, Western Australia. Canberra: Australian Bureau of Statistics, 2005. Jeffery, C. Ray. Crime Prevention through Environmental Design. Beverley Hills: Sage, 1971. Macken, Julie. “Why Aren’t We Happier?” Australian Financial Review 26 Nov. 1999: 26. Mallory, Keith, and Arvid Ottar. Architecture of Aggression: A History of Military Architecture in North West Europe, 1900-1945. Hampshire: Architectural Press, 1973. Massumi, Brian. Parables of the Virtual: Movement, Affect, Sensation. Durham: Duke University Press, 2002. McLennan, W. Security Services, Australia, 1998-99. Canberra: Australian Bureau of Statistics, 2000. Morley, David. Home Territories: Media, Mobility and Identity. London and New York: Routledge, 2000. Mouzos, Jenny, and Tina Houliaras. Homicide in Australia: 2004-05 National Homicide Monitoring Program (NHMP) Annual Report. Research and Public Policy Series 72. Canberra: Australian Institute of Criminology, 2006. Newman, Oscar. Defensible Space: Crime Prevention through Urban Design. New York: Collier, 1973. Puglini, Luigi. HyperArchitecture: Space in the Electronic Age. Basel: Bikhäuser, 1999. Signal Security. 13 January 2007 http://www.signalsecurity.com.au/securitysystems.htm>. Smith, Geoff. Home Security Precautions, New South Wales, October 1999. Canberra: Australian Bureau of Statistics, 2000. Spigel, Lynn. Welcome to the Dreamhouse: Popular Media and Postwar Suburbs. Durham and London: Duke University Press, 2001. Thomsen, Christian W. Sensuous Architecture: The Art of Erotic Building. Munich and New York: Prestel, 1998. Walker, Philip. Electronic Security Systems: Better Ways to Crime Prevention. London: Butterworths, 1983. Young, Iris Marion. “House and Home: Feminist Variations on a Theme.” Feminist Interpretations of Martin Heidegger. Eds. Nancy J. Holland and Patricia Huntington. University Park, Pennsylvania: Pennsylvania State UP, 2001. Citation reference for this article MLA Style Caluya, Gilbert. "The Architectural Nervous System: Home, Fear, Insecurity." M/C Journal 10.4 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0708/05-caluya.php>. APA Style Caluya, G. (Aug. 2007) "The Architectural Nervous System: Home, Fear, Insecurity," M/C Journal, 10(4). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0708/05-caluya.php>.

APA, Harvard, Vancouver, ISO, and other styles

28

Deer, Patrick, and Toby Miller. "A Day That Will Live In … ?" M/C Journal 5, no.1 (March1, 2002). http://dx.doi.org/10.5204/mcj.1938.

Full text

Abstract:

By the time you read this, it will be wrong. Things seemed to be moving so fast in these first days after airplanes crashed into the World Trade Center, the Pentagon, and the Pennsylvania earth. Each certainty is as carelessly dropped as it was once carelessly assumed. The sounds of lower Manhattan that used to serve as white noise for residents—sirens, screeches, screams—are no longer signs without a referent. Instead, they make folks stare and stop, hurry and hustle, wondering whether the noises we know so well are in fact, this time, coefficients of a new reality. At the time of writing, the events themselves are also signs without referents—there has been no direct claim of responsibility, and little proof offered by accusers since the 11th. But it has been assumed that there is a link to US foreign policy, its military and economic presence in the Arab world, and opposition to it that seeks revenge. In the intervening weeks the US media and the war planners have supplied their own narrow frameworks, making New York’s “ground zero” into the starting point for a new escalation of global violence. We want to write here about the combination of sources and sensations that came that day, and the jumble of knowledges and emotions that filled our minds. Working late the night before, Toby was awoken in the morning by one of the planes right overhead. That happens sometimes. I have long expected a crash when I’ve heard the roar of jet engines so close—but I didn’t this time. Often when that sound hits me, I get up and go for a run down by the water, just near Wall Street. Something kept me back that day. Instead, I headed for my laptop. Because I cannot rely on local media to tell me very much about the role of the US in world affairs, I was reading the British newspaper The Guardian on-line when it flashed a two-line report about the planes. I looked up at the calendar above my desk to see whether it was April 1st. Truly. Then I got off-line and turned on the TV to watch CNN. That second, the phone rang. My quasi-ex-girlfriend I’m still in love with called from the mid-West. She was due to leave that day for the Bay Area. Was I alright? We spoke for a bit. She said my cell phone was out, and indeed it was for the remainder of the day. As I hung up from her, my friend Ana rang, tearful and concerned. Her husband, Patrick, had left an hour before for work in New Jersey, and it seemed like a dangerous separation. All separations were potentially fatal that day. You wanted to know where everyone was, every minute. She told me she had been trying to contact Palestinian friends who worked and attended school near the event—their ethnic, religious, and national backgrounds made for real poignancy, as we both thought of the prejudice they would (probably) face, regardless of the eventual who/what/when/where/how of these events. We agreed to meet at Bruno’s, a bakery on La Guardia Place. For some reason I really took my time, though, before getting to Ana. I shampooed and shaved under the shower. This was a horror, and I needed to look my best, even as men and women were losing and risking their lives. I can only interpret what I did as an attempt to impose normalcy and control on the situation, on my environment. When I finally made it down there, she’d located our friends. They were safe. We stood in the street and watched the Towers. Horrified by the sight of human beings tumbling to their deaths, we turned to buy a tea/coffee—again some ludicrous normalization—but were drawn back by chilling screams from the street. Racing outside, we saw the second Tower collapse, and clutched at each other. People were streaming towards us from further downtown. We decided to be with our Palestinian friends in their apartment. When we arrived, we learnt that Mark had been four minutes away from the WTC when the first plane hit. I tried to call my daughter in London and my father in Canberra, but to no avail. I rang the mid-West, and asked my maybe-former novia to call England and Australia to report in on me. Our friend Jenine got through to relatives on the West Bank. Israeli tanks had commenced a bombardment there, right after the planes had struck New York. Family members spoke to her from under the kitchen table, where they were taking refuge from the shelling of their house. Then we gave ourselves over to television, like so many others around the world, even though these events were happening only a mile away. We wanted to hear official word, but there was just a huge absence—Bush was busy learning to read in Florida, then leading from the front in Louisiana and Nebraska. As the day wore on, we split up and regrouped, meeting folks. One guy was in the subway when smoke filled the car. Noone could breathe properly, people were screaming, and his only thought was for his dog DeNiro back in Brooklyn. From the panic of the train, he managed to call his mom on a cell to ask her to feed “DeNiro” that night, because it looked like he wouldn’t get home. A pregnant woman feared for her unborn as she fled the blasts, pushing the stroller with her baby in it as she did so. Away from these heart-rending tales from strangers, there was the fear: good grief, what horrible price would the US Government extract for this, and who would be the overt and covert agents and targets of that suffering? What blood-lust would this generate? What would be the pattern of retaliation and counter-retaliation? What would become of civil rights and cultural inclusiveness? So a jumble of emotions came forward, I assume in all of us. Anger was not there for me, just intense sorrow, shock, and fear, and the desire for intimacy. Network television appeared to offer me that, but in an ultimately unsatisfactory way. For I think I saw the end-result of reality TV that day. I have since decided to call this ‘emotionalization’—network TV’s tendency to substitute analysis of US politics and economics with a stress on feelings. Of course, powerful emotions have been engaged by this horror, and there is value in addressing that fact and letting out the pain. I certainly needed to do so. But on that day and subsequent ones, I looked to the networks, traditional sources of current-affairs knowledge, for just that—informed, multi-perspectival journalism that would allow me to make sense of my feelings, and come to a just and reasoned decision about how the US should respond. I waited in vain. No such commentary came forward. Just a lot of asinine inquiries from reporters that were identical to those they pose to basketballers after a game: Question—‘How do you feel now?’ Answer—‘God was with me today.’ For the networks were insistent on asking everyone in sight how they felt about the end of las torres gemelas. In this case, we heard the feelings of survivors, firefighters, viewers, media mavens, Republican and Democrat hacks, and vacuous Beltway state-of-the-nation pundits. But learning of the military-political economy, global inequality, and ideologies and organizations that made for our grief and loss—for that, there was no space. TV had forgotten how to do it. My principal feeling soon became one of frustration. So I headed back to where I began the day—The Guardian web site, where I was given insightful analysis of the messy factors of history, religion, economics, and politics that had created this situation. As I dealt with the tragedy of folks whose lives had been so cruelly lost, I pondered what it would take for this to stop. Or whether this was just the beginning. I knew one thing—the answers wouldn’t come from mainstream US television, no matter how full of feelings it was. And that made Toby anxious. And afraid. He still is. And so the dreams come. In one, I am suddenly furloughed from my job with an orchestra, as audience numbers tumble. I make my evening-wear way to my locker along with the other players, emptying it of bubble gum and instrument. The next night, I see a gigantic, fifty-feet high wave heading for the city beach where I’ve come to swim. Somehow I am sheltered behind a huge wall, as all the people around me die. Dripping, I turn to find myself in a media-stereotype “crack house” of the early ’90s—desperate-looking black men, endless doorways, sudden police arrival, and my earnest search for a passport that will explain away my presence. I awake in horror, to the realization that the passport was already open and stamped—racialization at work for Toby, every day and in every way, as a white man in New York City. Ana’s husband, Patrick, was at work ten miles from Manhattan when “it” happened. In the hallway, I overheard some talk about two planes crashing, but went to teach anyway in my usual morning stupor. This was just the usual chatter of disaster junkies. I didn’t hear the words, “World Trade Center” until ten thirty, at the end of the class at the college I teach at in New Jersey, across the Hudson river. A friend and colleague walked in and told me the news of the attack, to which I replied “You must be fucking joking.” He was a little offended. Students were milling haphazardly on the campus in the late summer weather, some looking panicked like me. My first thought was of some general failure of the air-traffic control system. There must be planes falling out of the sky all over the country. Then the height of the towers: how far towards our apartment in Greenwich Village would the towers fall? Neither of us worked in the financial district a mile downtown, but was Ana safe? Where on the college campus could I see what was happening? I recognized the same physical sensation I had felt the morning after Hurricane Andrew in Miami seeing at a distance the wreckage of our shattered apartment across a suburban golf course strewn with debris and flattened power lines. Now I was trapped in the suburbs again at an unbridgeable distance from my wife and friends who were witnessing the attacks first hand. Were they safe? What on earth was going on? This feeling of being cut off, my path to the familiar places of home blocked, remained for weeks my dominant experience of the disaster. In my office, phone calls to the city didn’t work. There were six voice-mail messages from my teenaged brother Alex in small-town England giving a running commentary on the attack and its aftermath that he was witnessing live on television while I dutifully taught my writing class. “Hello, Patrick, where are you? Oh my god, another plane just hit the towers. Where are you?” The web was choked: no access to newspapers online. Email worked, but no one was wasting time writing. My office window looked out over a soccer field to the still woodlands of western New Jersey: behind me to the east the disaster must be unfolding. Finally I found a website with a live stream from ABC television, which I watched flickering and stilted on the tiny screen. It had all already happened: both towers already collapsed, the Pentagon attacked, another plane shot down over Pennsylvania, unconfirmed reports said, there were other hijacked aircraft still out there unaccounted for. Manhattan was sealed off. George Washington Bridge, Lincoln and Holland tunnels, all the bridges and tunnels from New Jersey I used to mock shut down. Police actions sealed off the highways into “the city.” The city I liked to think of as the capital of the world was cut off completely from the outside, suddenly vulnerable and under siege. There was no way to get home. The phone rang abruptly and Alex, three thousand miles away, told me he had spoken to Ana earlier and she was safe. After a dozen tries, I managed to get through and spoke to her, learning that she and Toby had seen people jumping and then the second tower fall. Other friends had been even closer. Everyone was safe, we thought. I sat for another couple of hours in my office uselessly. The news was incoherent, stories contradictory, loops of the planes hitting the towers only just ready for recycling. The attacks were already being transformed into “the World Trade Center Disaster,” not yet the ahistorical singularity of the emergency “nine one one.” Stranded, I had to spend the night in New Jersey at my boss’s house, reminded again of the boundless generosity of Americans to relative strangers. In an effort to protect his young son from the as yet unfiltered images saturating cable and Internet, my friend’s TV set was turned off and we did our best to reassure. We listened surreptitiously to news bulletins on AM radio, hoping that the roads would open. Walking the dog with my friend’s wife and son we crossed a park on the ridge on which Upper Montclair sits. Ten miles away a huge column of smoke was rising from lower Manhattan, where the stunning absence of the towers was clearly visible. The summer evening was unnervingly still. We kicked a soccer ball around on the front lawn and a woman walked distracted by, shocked and pale up the tree-lined suburban street, suffering her own wordless trauma. I remembered that though most of my students were ordinary working people, Montclair is a well-off dormitory for the financial sector and high rises of Wall Street and Midtown. For the time being, this was a white-collar disaster. I slept a short night in my friend’s house, waking to hope I had dreamed it all, and took the commuter train in with shell-shocked bankers and corporate types. All men, all looking nervously across the river toward glimpses of the Manhattan skyline as the train neared Hoboken. “I can’t believe they’re making us go in,” one guy had repeated on the station platform. He had watched the attacks from his office in Midtown, “The whole thing.” Inside the train we all sat in silence. Up from the PATH train station on 9th street I came onto a carless 6th Avenue. At 14th street barricades now sealed off downtown from the rest of the world. I walked down the middle of the avenue to a newspaper stand; the Indian proprietor shrugged “No deliveries below 14th.” I had not realized that the closer to the disaster you came, the less information would be available. Except, I assumed, for the evidence of my senses. But at 8 am the Village was eerily still, few people about, nothing in the sky, including the twin towers. I walked to Houston Street, which was full of trucks and police vehicles. Tractor trailers sat carrying concrete barriers. Below Houston, each street into Soho was barricaded and manned by huddles of cops. I had walked effortlessly up into the “lockdown,” but this was the “frozen zone.” There was no going further south towards the towers. I walked the few blocks home, found my wife sleeping, and climbed into bed, still in my clothes from the day before. “Your heart is racing,” she said. I realized that I hadn’t known if I would get back, and now I never wanted to leave again; it was still only eight thirty am. Lying there, I felt the terrible wonder of a distant bystander for the first-hand witness. Ana’s face couldn’t tell me what she had seen. I felt I needed to know more, to see and understand. Even though I knew the effort was useless: I could never bridge that gap that had trapped me ten miles away, my back turned to the unfolding disaster. The television was useless: we don’t have cable, and the mast on top of the North Tower, which Ana had watched fall, had relayed all the network channels. I knew I had to go down and see the wreckage. Later I would realize how lucky I had been not to suffer from “disaster envy.” Unbelievably, in retrospect, I commuted into work the second day after the attack, dogged by the same unnerving sensation that I would not get back—to the wounded, humbled former center of the world. My students were uneasy, all talked out. I was a novelty, a New Yorker living in the Village a mile from the towers, but I was forty-eight hours late. Out of place in both places. I felt torn up, but not angry. Back in the city at night, people were eating and drinking with a vengeance, the air filled with acrid sicklysweet smoke from the burning wreckage. Eyes stang and nose ran with a bitter acrid taste. Who knows what we’re breathing in, we joked nervously. A friend’s wife had fallen out with him for refusing to wear a protective mask in the house. He shrugged a wordlessly reassuring smile. What could any of us do? I walked with Ana down to the top of West Broadway from where the towers had commanded the skyline over SoHo; downtown dense smoke blocked the view to the disaster. A crowd of onlookers pushed up against the barricades all day, some weeping, others gawping. A tall guy was filming the grieving faces with a video camera, which was somehow the worst thing of all, the first sign of the disaster tourism that was already mushrooming downtown. Across the street an Asian artist sat painting the street scene in streaky black and white; he had scrubbed out two white columns where the towers would have been. “That’s the first thing I’ve seen that’s made me feel any better,” Ana said. We thanked him, but he shrugged blankly, still in shock I supposed. On the Friday, the clampdown. I watched the Mayor and Police Chief hold a press conference in which they angrily told the stream of volunteers to “ground zero” that they weren’t needed. “We can handle this ourselves. We thank you. But we don’t need your help,” Commissioner Kerik said. After the free-for-all of the first couple of days, with its amazing spontaneities and common gestures of goodwill, the clampdown was going into effect. I decided to go down to Canal Street and see if it was true that no one was welcome anymore. So many paths through the city were blocked now. “Lock down, frozen zone, war zone, the site, combat zone, ground zero, state troopers, secured perimeter, national guard, humvees, family center”: a disturbing new vocabulary that seemed to stamp the logic of Giuliani’s sanitized and over-policed Manhattan onto the wounded hulk of the city. The Mayor had been magnificent in the heat of the crisis; Churchillian, many were saying—and indeed, Giuliani quickly appeared on the cover of Cigar Afficionado, complete with wing collar and the misquotation from Kipling, “Captain Courageous.” Churchill had not believed in peacetime politics either, and he never got over losing his empire. Now the regime of command and control over New York’s citizens and its economy was being stabilized and reimposed. The sealed-off, disfigured, and newly militarized spaces of the New York through which I have always loved to wander at all hours seemed to have been put beyond reach for the duration. And, in the new post-“9/11” post-history, the duration could last forever. The violence of the attacks seemed to have elicited a heavy-handed official reaction that sought to contain and constrict the best qualities of New York. I felt more anger at the clampdown than I did at the demolition of the towers. I knew this was unreasonable, but I feared the reaction, the spread of the racial harassment and racial profiling that I had already heard of from my students in New Jersey. This militarizing of the urban landscape seemed to negate the sprawling, freewheeling, boundless largesse and tolerance on which New York had complacently claimed a monopoly. For many the towers stood for that as well, not just as the monumental outposts of global finance that had been attacked. Could the American flag mean something different? For a few days, perhaps—on the helmets of firemen and construction workers. But not for long. On the Saturday, I found an unmanned barricade way east along Canal Street and rode my bike past throngs of Chinatown residents, by the Federal jail block where prisoners from the first World Trade Center bombing were still being held. I headed south and west towards Tribeca; below the barricades in the frozen zone, you could roam freely, the cops and soldiers assuming you belonged there. I felt uneasy, doubting my own motives for being there, feeling the blood drain from my head in the same numbing shock I’d felt every time I headed downtown towards the site. I looped towards Greenwich Avenue, passing an abandoned bank full of emergency supplies and boxes of protective masks. Crushed cars still smeared with pulverized concrete and encrusted with paperwork strewn by the blast sat on the street near the disabled telephone exchange. On one side of the avenue stood a horde of onlookers, on the other television crews, all looking two blocks south towards a colossal pile of twisted and smoking steel, seven stories high. We were told to stay off the street by long-suffering national guardsmen and women with southern accents, kids. Nothing happening, just the aftermath. The TV crews were interviewing worn-out, dust-covered volunteers and firemen who sat quietly leaning against the railings of a park filled with scraps of paper. Out on the West Side highway, a high-tech truck was offering free cellular phone calls. The six lanes by the river were full of construction machinery and military vehicles. Ambulances rolled slowly uptown, bodies inside? I locked my bike redundantly to a lamppost and crossed under the hostile gaze of plainclothes police to another media encampment. On the path by the river, two camera crews were complaining bitterly in the heat. “After five days of this I’ve had enough.” They weren’t talking about the trauma, bodies, or the wreckage, but censorship. “Any blue light special gets to roll right down there, but they see your press pass and it’s get outta here. I’ve had enough.” I fronted out the surly cops and ducked under the tape onto the path, walking onto a Pier on which we’d spent many lazy afternoons watching the river at sunset. Dust everywhere, police boats docked and waiting, a crane ominously dredging mud into a barge. I walked back past the camera operators onto the highway and walked up to an interview in process. Perfectly composed, a fire chief and his crew from some small town in upstate New York were politely declining to give details about what they’d seen at “ground zero.” The men’s faces were dust streaked, their eyes slightly dazed with the shock of a horror previously unimaginable to most Americans. They were here to help the best they could, now they’d done as much as anyone could. “It’s time for us to go home.” The chief was eloquent, almost rehearsed in his precision. It was like a Magnum press photo. But he was refusing to cooperate with the media’s obsessive emotionalism. I walked down the highway, joining construction workers, volunteers, police, and firemen in their hundreds at Chambers Street. No one paid me any attention; it was absurd. I joined several other watchers on the stairs by Stuyvesant High School, which was now the headquarters for the recovery crews. Just two or three blocks away, the huge jagged teeth of the towers’ beautiful tracery lurched out onto the highway above huge mounds of debris. The TV images of the shattered scene made sense as I placed them into what was left of a familiar Sunday afternoon geography of bike rides and walks by the river, picnics in the park lying on the grass and gazing up at the infinite solidity of the towers. Demolished. It was breathtaking. If “they” could do that, they could do anything. Across the street at tables military policeman were checking credentials of the milling volunteers and issuing the pink and orange tags that gave access to ground zero. Without warning, there was a sudden stampede running full pelt up from the disaster site, men and women in fatigues, burly construction workers, firemen in bunker gear. I ran a few yards then stopped. Other people milled around idly, ignoring the panic, smoking and talking in low voices. It was a mainly white, blue-collar scene. All these men wearing flags and carrying crowbars and flashlights. In their company, the intolerance and rage I associated with flags and construction sites was nowhere to be seen. They were dealing with a torn and twisted otherness that dwarfed machismo or bigotry. I talked to a moustachioed, pony-tailed construction worker who’d hitched a ride from the mid-west to “come and help out.” He was staying at the Y, he said, it was kind of rough. “Have you been down there?” he asked, pointing towards the wreckage. “You’re British, you weren’t in World War Two were you?” I replied in the negative. “It’s worse ’n that. I went down last night and you can’t imagine it. You don’t want to see it if you don’t have to.” Did I know any welcoming ladies? he asked. The Y was kind of tough. When I saw TV images of President Bush speaking to the recovery crews and steelworkers at “ground zero” a couple of days later, shouting through a bullhorn to chants of “USA, USA” I knew nothing had changed. New York’s suffering was subject to a second hijacking by the brokers of national unity. New York had never been America, and now its terrible human loss and its great humanity were redesignated in the name of the nation, of the coming war. The signs without a referent were being forcibly appropriated, locked into an impoverished patriotic framework, interpreted for “us” by a compliant media and an opportunistic regime eager to reign in civil liberties, to unloose its war machine and tighten its grip on the Muslim world. That day, drawn to the river again, I had watched F18 fighter jets flying patterns over Manhattan as Bush’s helicopters came in across the river. Otherwise empty of air traffic, “our” skies were being torn up by the military jets: it was somehow the worst sight yet, worse than the wreckage or the bands of disaster tourists on Canal Street, a sign of further violence yet to come. There was a carrier out there beyond New York harbor, there to protect us: the bruising, blustering city once open to all comers. That felt worst of all. In the intervening weeks, we have seen other, more unstable ways of interpreting the signs of September 11 and its aftermath. Many have circulated on the Internet, past the blockages and blockades placed on urban spaces and intellectual life. Karl-Heinz Stockhausen’s work was banished (at least temporarily) from the canon of avant-garde electronic music when he described the attack on las torres gemelas as akin to a work of art. If Jacques Derrida had described it as an act of deconstruction (turning technological modernity literally in on itself), or Jean Baudrillard had announced that the event was so thick with mediation it had not truly taken place, something similar would have happened to them (and still may). This is because, as Don DeLillo so eloquently put it in implicit reaction to the plaintive cry “Why do they hate us?”: “it is the power of American culture to penetrate every wall, home, life and mind”—whether via military action or cultural iconography. All these positions are correct, however grisly and annoying they may be. What GK Chesterton called the “flints and tiles” of nineteenth-century European urban existence were rent asunder like so many victims of high-altitude US bombing raids. As a First-World disaster, it became knowable as the first-ever US “ground zero” such precisely through the high premium immediately set on the lives of Manhattan residents and the rarefied discussion of how to commemorate the high-altitude towers. When, a few weeks later, an American Airlines plane crashed on take-off from Queens, that borough was left open to all comers. Manhattan was locked down, flown over by “friendly” bombers. In stark contrast to the open if desperate faces on the street of 11 September, people went about their business with heads bowed even lower than is customary. Contradictory deconstructions and valuations of Manhattan lives mean that September 11 will live in infamy and hyper-knowability. The vengeful United States government and population continue on their way. Local residents must ponder insurance claims, real-estate values, children’s terrors, and their own roles in something beyond their ken. New York had been forced beyond being the center of the financial world. It had become a military target, a place that was receiving as well as dispatching the slings and arrows of global fortune. Citation reference for this article MLA Style Deer, Patrick and Miller, Toby. "A Day That Will Live In … ?" M/C: A Journal of Media and Culture 5.1 (2002). [your date of access] < http://www.media-culture.org.au/0203/adaythat.php>. Chicago Style Deer, Patrick and Miller, Toby, "A Day That Will Live In … ?" M/C: A Journal of Media and Culture 5, no. 1 (2002), < http://www.media-culture.org.au/0203/adaythat.php> ([your date of access]). APA Style Deer, Patrick and Miller, Toby. (2002) A Day That Will Live In … ?. M/C: A Journal of Media and Culture 5(1). < http://www.media-culture.org.au/0203/adaythat.php> ([your date of access]).

APA, Harvard, Vancouver, ISO, and other styles

29

Gulliver, Robyn. "Iconic 21st Century Activist "T-Shirt and Tote-Bag" Combination Is Hard to Miss These Days!" M/C Journal 25, no.4 (October5, 2022). http://dx.doi.org/10.5204/mcj.2922.

Full text

Abstract:

Introduction Fashion has long been associated with resistance movements across Asia and Australia, from the hand-spun cotton Khadi of Mahatma Gandhi’s freedom struggle to the traditional ankle length robe worn by Tibetans in the ‘White Wednesday Movement’ (Singh et al.; Yangzom). There are many reasons why fashion and activism have been interlinked. Fashion can serve as a form of nonverbal communication (Crane), which can convey activists’ grievances and concerns while symbolising solidarity (Doerr). It can provide an avenue to enact individual agency against repressive, authoritarian regimes (Yangzom; Doerr et al.). Fashion can codify a degree of uniformity within groups and thereby signal social identity (Craik), while also providing a means of building community (Barry and Drak). Fashion, therefore, offers activists the opportunity to develop the three characteristics which unite a social or environmental movement: a shared concern about an issue, a sense of social identity, and connections between individuals and groups. But while these fashion functions map onto movement characteristics, it remains unclear whether activists across the world deliberately include fashion into their protest action repertoires. This uncertainty exists partly because of a research and media focus on large scale, mass protests (Lester and Hutchins), where fashion characteristics are immediately visible and amenable to retrospective interpretation. This focus helps explain the rich volume of research examining the manifestation of fashion in past protests, such as the black, red, and yellow colours worn during the 1988 Aboriginal Long March of Freedom, Justice, and Hope (Maynard Dress; Coghlan), and the pink anti-Trump ‘pussyhats’ (Thompson). However, the protest events used to identify these fashion characteristics are a relatively small proportion of actions used by environmental activists (Dalton et al.; Gulliver et al.), which include not only rallies and marches, but also information evenings, letter writing sessions, and eco-activities such as tree plantings. This article aims to respond to Barnard’s (Looking) call for more empirical work on what contemporary cultural groups visually do with what they wear (see also Gerbaudo and Treré) via a content analysis of 36,676 events promoted on Facebook by 728 Australian environmental groups between 2010 and 2019. The article firstly reports findings from an analysis of this dataset to identify how fashion manifests in environmental activism, building on research demonstrating the role of protest-related nonverbal communications, such as protest signage (Bloomfield and Doolin), images (Kim), and icons, slogans, and logos (Goodnow). The article then considers what activists may seek to achieve through incorporating fashion into their action repertoire, and whether this suggests solidarity with activists seeking to effect environmental change across the wider Asian region. Fashion Activism Fashion is created through a particular assemblage of clothes, accessories, and hairstyles (Barry and Drak), which in turn forms a prevailing custom or style of dress (Craik). It is a cultural practice, providing ‘real estate’ (Benda 7) for an individual to express their social roles (Craik) and political identity (Behnke). Some scholars argue that fashion became overtly political during the 1960s and 70s, as social movements politicised appearance (Edwards). This has only increased in relevance with the rise of far right, populist, and authoritarian regimes, whose sub-cultures enact politicised identities through their distinct fashion characteristics (Gaugele and Titton; Gaugele). Fashion can therefore play an important role in protest movements, as “political subjectivities, political authority, political power and discipline are rendered visible, and thereby real, by the way fashion co-establishes them” (Behnke 3). Across the literature scholars have identified two primary avenues by which fashion and activism are connected. The first of these relates to activism targeting the fashion industry. This type of activism is found in both Asia and Australia, and promotes sustainable consumption choices such as buying used goods and transforming existing items (Chung and Yim), as well as highlighting garment worker exploitation within the fashion industry (Khan and Richards). The second avenue is called ‘fashion activism’: the use of fashion to intentionally signal a message seeking to evoke social and/or political change (Thompson). In this conceptualisation, clothing is used to signify a particular message (Crane). An example of this type of fashion activism is the ‘SlutWalk’, a protest where participants deliberately wore outfits described as slutty or revealing as a response to victim-blaming of women who had experienced sexual assault (Thompson). A key element of fashion activism thus appears to be its message intentionality. Clothes are specifically utilised to convey a message, such as a grievance about victim-blaming, which can then be incorporated into design features displayed on t-shirts, pins, and signs both on the runway and in protest events (Titton). However, while this ‘sender/receiver’ model of fashion communication (Barnard, Fashion as) can be compelling for activists, it is complex in practice. A message receiver can never have full knowledge of what message the sender seeks to signify through a particular clothing item, nor can the message sender predict how a receiver will interpret that message. Particular arrangements of clothing only hold communicative power when they are easily interpreted and related to the movement and its message, usually only intelligible to a specific culture or subculture (Goodnow). Even within that subculture it remains problematic to infer a message from a particular style of dress, as demonstrated in examples where dress is used to imply sexual consent; for example, in rape and assault cases (Lennon et al.). Given the challenges of interpreting fashion, do activists appear to use the ‘real estate’ (Benda 7) afforded by it as a protest tool? To investigate this question a pre-existing dataset of 36,676 events was analysed to ascertain if, and how, environmental activism engages with fashion (a detailed methodology is available on the OSF). Across this dataset, event categories, titles, and descriptions were reviewed to collate events connecting environmental activism to fashion. Three categories of events were found and are discussed in the next section: street theatre, sustainable fashion practices, and disruptive protest. Street Theatre Street theatre is a form of entertainment which uses public performance to raise awareness of injustices and build support for collective action (Houston and Pulido). It uses costumes as a vehicle for conveying messages about political issues and for making demands visible, and has been utilised by protesters across Australia and Asia (Roces). Many examples of street theatre were found in the dataset. For example, Extinction Rebellion (XR) consistently promoted street theatre events via sub-groups such as the ‘Red Rebels’ – a dedicated team of volunteers specialising in costumed street theatre – as well as by inviting supporters to participate in open street theatre events, such as in the ‘Halloween Dead Things Disco’. Dressed as spooky skeletons (doot, doot) and ghosts, we'll slide and shimmy down Sydney's streets in a supernatural style, as we bring attention to all the species claimed by the Sixth Mass Extinction. These street theatre events appeared to prioritise spectacle rather than disruption as a means to attract attention to their message. The Cairns and Far North Environment Centre ‘Climate Action Float’, for example, requested that attendees: Wear blue and gold or dress as your favourite reef animal, solar panel, maybe even the sun itself!? Reef & Solar // Blue & Gold is the guiding theme but we want your creativity take it from there. Most groups used street theatre as one of a range of different actions organised across a period of time. However, Climacts, a performance collective which uses ‘spectacle and satire to communicate the urgency of the climate and biodiversity crisis’ (Climacts), utilised this tactic exclusively. Their Climate Guardians collective used distinctive angel costumes to perform at the Climate Conference of Parties 26, and in various places around Australia (see images on their Website). Fig. 1: Costumed protest against Downer EDI's proposed work on the Adani coalmine; Image by John Englart (CC BY-SA 2.0). Sustainable Fashion Practices The second most common type of event which connected fashion with activism were those promoting sustainable fashion practices. While much research has highlighted the role of activism in raising awareness of problems related to the fashion industry (e.g. Hirscher), groups in the dataset were primarily focussed on organising activities where supporters communally created their own fashion items. The most common of these was the ‘crafternoon’, with over 260 separate crafternoon events identified in the dataset. These events brought activists together to create protest-related kit such as banners, signs, and costumes from recycled or repurposed materials, as demonstrated by Hume Climate Action Now’s ‘Crafternoon for Climate’ event: Come along on Sunday arvo for a relaxed arvo making posters and banners for upcoming Hume Climate Action Now events… Bring: Paints, textas, cardboard, fabric – whatever you’ve got lying around. Don’t have anything? That’s cool, just bring yourself. Events highlighting fashion industry problems were less frequent and tended to prioritise sharing of information about the fashion industry rather than promoting protests. For example, Transition Town Vincent held a ‘Slowing Down Fast Fashion – Transition Town Vincent Movie Night’ while the Green Embassy promoted the ‘Eco Fashion Week’. This event, held in 2017, was described as Australia’s only eco-fashion week, and included runway shows, music, and public talks. Other events also focussed on public talks, such as a Conservation Council of ACT event called ‘Green Drinks Canberra October 2017: Summer Edwards on the fashion industry’ and a panel discussion organised by a group called SEE-Change entitled ‘The Sustainable Wardrobe’. Disruptive Protest and T-Shirts Few events in the dataset mentioned elements of fashion outside of street theatre or sustainable fashion practices, with only one organisation explicitly connecting fashion with activism in its event details. This group – Australian Youth Climate Coalition – organised an event called ‘Activism in Fashion: Tote Bags, T-shirts and Poster Painting!’, which asked: How can we consistently be involved in campaigning while life can be so busy? Can we still be loud and get a message across without saying a word? The iconic 21st century activist "t-shirt and tote-bag" combination is hard to miss these days! Unlike street theatre and sustainable fashion practices, fashion appeared to be a consideration for only a small number of disruptive protests promoted by environmental groups in Australia. XR Brisbane sought to organise a fashion parade during the 2019 Rebellion Week, while XR protesters in Melbourne stripped down to underwear for a march through Melbourne city arcades (see also Turbet). Few common fashion elements appeared consistently on individual activists participating in events, and these were limited to accessories, such as ‘Stop Adani’ earrings, or t-shirts sold for fundraising and promotional purposes. Indeed, t-shirts appeared to be the most promoted clothing item in the dataset, continuing a long tradition of their use in protests (e.g. Maynard, Blankets). Easy to create, suitable for displaying both text and imagery, t-shirts sharing anti-coal messages featured predominantly in the Stop Adani campaign, while yellow t-shirts were a common item in Knitting Nanna’s anti-coal seam gas mining protests. Fig. 2: Stop Adani earrings and t-shirts; Image by John Englart (CC BY-SA 2.0). The Role of Fashion in Environmental Activism As these findings demonstrate, fashion appears to be deliberately utilised in environmental activism primarily through street theatre and the promotion of sustainable fashion practices. While fewer examples of fashion in disruptive protest were found and no consistent fashion assemblage was identified, accessories and t-shirts were utilised by many groups. What may activists be seeking to achieve through incorporating fashion via street theatre and sustainable fashion practices? Some scholars have argued that incorporating fashion into protest allows activists to signal political dissent against authoritarian control. For example, Yanzoom noted that by utilising fashion as a means of communication, Tibetan activists were able to embody their political goals despite repression of speech and movement by political powerholders. However, a consistent fashion repertoire across protests in this Australian dataset was not found. The opportunities afforded by protected protest rights in Australia and absence of violent police repression of disruptive protests may be one explanation why distinctive dress such as the masks and black attire of Hong Kong pro-democracy protesters did not manifest in the dataset. Other scholars have observed that fashion sub-cultures also developed partly to express anti-establishment politics, such as the punk movement in the 1970s. Radical clothing accessorised by symbols, bright hair colours, body piercings, and heavy-duty books signalled opposition to the dominant political ideology (Craik). However, none of these purposes appeared to play a role in Australian environmental activism either. Instead, it appears that Maynard’s contention that Australian protest fashion barely deviates from everyday dress remains true today. Fashion within the events promoted in this large empirical dataset retained the ‘prevalence of everyday clothing’ (Maynard, Dress 111). The lack of a clearly discernible single protest fashion style within the dataset may be related to the shortcomings of the sender/receiver model of fashion communication. As Barnard (Fashion Statements) argued, fashion is not always used as a vehicle for conveying messages, but also as a platform for constructing and reproducing identity. Indeed, a multiplicity of researchers have noted how fashion acts as a signal of what social groups individuals belong to (see Roach-Higgins and Eicher). Activist groups have a variety of goals, which not only include promoting environmental change but also mobilising more people to join their cause (Gulliver et al., Understanding). Stereotyping can hinder achievement of these goals. It has been demonstrated, for example, that individuals who hold negative stereotypes of ‘typical’ activists are less likely to want to associate with them, and less likely to adopt their behaviours (Bashir et al.). Accordingly, some activist groups have been shown to actively promote dress associated with other identity groups, specifically to challenge cultural constructions of environmental activist stereotypes (see also Roces). For example, Bloomfield and Doolins’s study of the NZ anti-GE group MAdGE (Mothers against Genetic Engineering in Food and the Environment) demonstrated how visual protest artifacts conveyed the protesters’ social identity as mothers and customers rather than environmental activists, claiming an alternative cultural mandate for challenging the authority of science (see also Einwohner et al.). The data suggest that Australian activists are seeking to avoid this stereotype as well. The absence of a consistent fashion promoted within the dataset may reflect awareness of problematic stereotypes that activists may be then deliberately seeking to avoid. Maynard (Dress), for example, has noted how the everyday dress of Australian protesters serves to deflect stereotypical labelling of participants. This strategy is also mirrored by the changing nature of groups within the Australian environmental movement. The event database demonstrates that an increasing number of environmental groups are emerging with names highlighting non-stereotypical environmental identities: groups such as ‘Engineers Declare’ and ‘Bushfire Survivors for Climate Action’. Beyond these identity processes, the frequent use of costumed street theatre protest suggests that activists recognise the value of using fashion as a vehicle for communicating messages, despite the challenges of interpretation described above. Much of the language used to promote street theatre in the Facebook event listings suggests that these costumes were deliberately designed to signify a particular meaning, with individuals encouraged to dress up to be ‘a vehicle for myth and symbol’ (Lavender 11). It may be that costumes are also utilised in protest due to their suitability as an image event, convenient for dissemination by mass media seeking colourful and engaging imagery (Delicath and Deluca; Doerr). Furthermore, costumes, as with text or colours presented on t-shirts, may offer activists an avenue to clearly convey a visual message which is more resistant to stereotyping. This is especially relevant given that fashion can be re-interpreted and misinterpreted by audiences, as well as reframed and reinterpreted by the media (Maynard, Dress). While the prevalence of costumed performance and infrequent mentions of fashion in the dataset may be explained by stereotype avoidance and messaging clarity, sustainable fashion practices were more straightforward in intent. Groups used multiple approaches to educate audiences about sustainable fashion, whether through fostering sustainable fashion practices or raising awareness of fashion industry problems. In this regard, fashion in protest in Australia closely resembles Asian sustainable fashion activism (see e.g. Chon et al. regarding the Singaporean context). In particular, the large number of ‘crafternoons’ suggests their importance as sites of activism and community building. Craftivism – acts such as quilting banners, yarn bombing, and cross stitching feminist slogans – are used by many groups to draw attention to social, political and environmental issues (McGovern and Barnes). This type of ‘creative activism’ (Filippello) has been used to challenge aesthetic and political norms across a variety of contested socio-political landscapes. These activities not only develop activism skills, but also foster community (Barry and Drak). For environmental groups, these community building events can play a critical role in sustaining and supporting ongoing environmental activism (Gulliver et al., Understanding) as well as demonstrating solidarity with workers across Asia experiencing labour injustices linked to the fashion industry (Chung and Yim). Conclusion Studies examining protest fashion demonstrate that clothing provides a canvas for sharing protest messages and identities in both Asia and Australia (Benda; Yangzom; Craik). However, despite the fashion’s utility as communication tool for social and environmental movements, empirical studies of how fashion is used by activists in these contexts remain rare. This analysis demonstrates that Australian environmental activists use fashion in their action repertoire primarily through costumed street theatre performances and promoting sustainable fashion practices. By doing so they may be seeking to use fashion as a means of conveying messages, while avoiding stereotypes that can demobilise supporters and reduce support for their cause. Furthermore, sustainable fashion activism offers opportunities for activists to achieve multiple goals: to subvert the fast fashion industry, to provide participation avenues for new activists, to help build activist communities, and to express solidarity with those experiencing fast fashion-related labour injustices. These findings suggest that the use of fashion in protest actions can move beyond identity messaging to also enact sustainable practices while co-opting and resisting hegemonic ideas of consumerism. By integrating fashion into the vibrant and diverse actions promoted by environmental movements across Australia and Asia, activists can construct and perform identities while fostering the community bonds and networks from which movements demanding environmental change derive their strength. Ethics Approval Statement This study was approved by the Research Ethics Committee of the University of Queensland (2018000963). Data Availability A detailed methodology explaining how the dataset was constructed and analysed is available on the Open Science Framework: <https://osf.io/sq5dz/?view_only=9bc0d3945caa443084361f10b6720589>. References Barnard, Malcolm. “Fashion as Communication Revisited.” Popular Communication 18.4 (2020): 259–271. ———. “Fashion Statements: Communication and Culture.” Fashion Statements. Eds. Ron Scapp and Brian Seitz. Routledge, 2010. ———. “Looking Sharp: Fashion Studies.” The Handbook of Visual Culture. Eds. Ian Heywood and Barry Sandywell. Bloomsbury Publishing, 2017. Barry, Ben, and Daniel Drak. “Intersectional Interventions into Queer and Trans Liberation: Youth Resistance against Right-Wing Populism through Fashion Hacking.” Fashion Theory – Journal of Dress Body and Culture 23.6 (2019): 679–709. Bashir, Nadia Y., et al. “The Ironic Impact of Activists: Negative Stereotypes Reduce Social Change Influence.” European Journal of Social Psychology 43.7 (2013): 614–626. Behnke, Andreas. The International Politics of Fashion: Being Fab in a Dangerous World. Routledge, 2016. Benda, Camille. Dressing the Resistance: The Visual Language of Protest. Chronicle Books, 2021. Bloomfield, Brian P., and Bill Doolin. “Symbolic Communication in Public Protest over Genetic Modification: Visual Rhetoric, Symbolic Excess, and Social Mores.” Science Communication 35.4 (2013): 502–527. Chon, H., et al. “Designing Resilience: Mapping Singapore’s Sustainable Fashion Movements.” Design Culture(s) Conference. La Sapienza University of Rome, 16-19 June 2020. <https://ualresearchonline.arts.ac.uk/id/eprint/18742/1/DCs-Designing%20Resilience.pdf>. Chung, Soojin, and Eunhyuk Yim. “Fashion Activism for Sustainability on Social Media.” The Research Journal of the Costume Culture 28.6 (2020): 815–829 Coghlan, Jo. “Dissent Dressing: The Colour and Fabric of Political Rage.” M/C Journal 22.1 (2019). Craik, Jennifer. Fashion: The Key Concepts. Berg Publishers, 2009. Crane, Diana. Fashion and Its Social Agendas: Class, Gender, and Identity in Clothing. U of Chicago P, 2012. Dalton, Russell J., et al. “The Environmental Movement and the Modes of Political Action.” Comparative Political Studies 36.7 (2003): 743–772. Delicath, John W., and Kevin Michael Deluca. “Image Events, the Public Sphere, and Argumentative Practice: The Case of Radical Environmental Groups.” Argumentation 17.3 (2003): 315–333. Doerr, Nicole. “Fashion in Social Movements.” Protest Cultures. Eds. Kathrin Fahlenbrach, Martin Klimke, and Joachim Scharloth. 2016. ———. “Toward a Visual Analysis of Social Movements, Conflict, and Political Mobilization.” Advances in the Visual Analysis of Social Movements. Eds. Nicole Doerr, Alice Mattoni, and Simon Teune. Emerald Group, 2013. Edwards, Tim. Fashion in Focus: Concepts, Practices and Politics. Routledge, 2010. Einwohner, Rachel L., et al. “Engendering Social Movements: Cultural Images and Movement Dynamics.” Gender & Society 14.5 (2000): 679–699. Filippello, Roberto. “Fashion Statements in a Site of Conflict.” Fashion Theory – Journal of Dress Body and Culture (2022): 1–31. Gaugele, Elke. “The New Obscurity in Style. Alt-Right Faction, Populist Normalization, and the Cultural War on Fashion from the Far Right.” Fashion Theory – Journal of Dress Body and Culture 23.6 (2019): 711–731. Gaugele, Elke, and Monica Titton. “Letter from the Editors: Fashion as Politics: Dressing Dissent.” Fashion Theory – Journal of Dress Body and Culture 23.6 (2019): 615–618. Gerbaudo, Paolo, and Emiliano Treré. “In Search of the ‘We’ of Social Media Activism: Introduction to the Special Issue on Social Media and Protest Identities.” Information, Communication & Society 18.8 (2015): 865–871. Goodnow, Trischa. “On Black Panthers, Blue Ribbon, & Peace Signs: The Function of Symbols in Social Campaigns.” Visual Communication Quarterly 13.3 (2006): 166-179. Gulliver, Robyn E., et al. “The Characteristics, Activities and Goals of Environmental Organizations Engaged in Advocacy within the Australian Environmental Movement.” Environmental Communication 14.5 (2020): 614–627. ———. “Understanding the Outcomes of Climate Change Campaigns in the Australian Environmental Movement.” Case Studies in the Environment 3.1 (2019): 1-9. Hirscher, Anja Lisa. “Fashion Activism Evaluation and Application of Fashion Activism Strategies to Ease Transition towards Sustainable Consumption Behaviour.” Research Journal of Textile and Apparel 17.1 (2013): 23–38. Houston, Donna, and Laura Pulido. “The Work of Performativity: Staging Social Justice at the University of Southern California.” Environment and Planning D: Society and Space 20.4 (2002): 401–424. Khan, Rimi, and Harriette Richards. “Fashion in ‘Crisis’: Consumer Activism and Brand (Ir)responsibility in Lockdown.” Cultural Studies 35.2 (2021): 432–443. Kim, Tae Sik. “Defining the Occupy Movement: Visual Analysis of Facebook Profile Images Posted by Local Occupy Movement Groups.” Visual Communication Quarterly 22.3 (2015): 174–186. Lavender, Andy. “Theatricalizing Protest: The Chorus of the Commons.” Performance Research 24.8 (2019): 4–11. Lennon, Theresa L., et al. “Is Clothing Probative of Attitude or Intent? Implications for Rape and Sexual Harassment Cases.” From Law & Inequality: A Journal of Theory and Practice 11.2 (1993): 39–43. Lester, Libby, and Brett Hutchins. “The Power of the Unseen: Environmental Conflict, the Media and Invisibility.” Media, Culture and Society 34.7 (2012): 847–863. Loscialpo, Flavia. “‘I Am an Immigrant’: Fashion, Immigration and Borders in the Contemporary Trans-Global Landscape.” Fashion Theory – Journal of Dress Body and Culture 23.6 (2019): 619–653. Maynard, Margaret. Blankets: The Visible Politics of Indigenous Clothing in Australia. Berg, 2002. ———. “Dress for Dissent: Reading the Almost Unreadable.” Journal of Australian Studies 30.89 (2006): 103–112. McGovern, Alyce, and Clementine Barnes. “Visible Mending, Street Stitching, and Embroidered Handkerchiefs: How Craftivism Is Being Used to Challenge the Fashion Industry.” International Journal for Crime, Justice and Social Democracy 11.2 (2022): 87–101. Repo, Jemima. “Feminist Commodity Activism: The New Political Economy of Feminist Protest.” International Political Sociology 14.2 (2020): 215–232. Roach-Higgins, Mary Ellen, and Joanne B. Eicher. “Dress and Identity.” Clothing and Textiles Research Journal 10.4 (1992): 1–8. Roces, Mina. “Dress as Symbolic Resistance in Asia.” International Quarterly for Asian Studies 53.1 (2022): 5–14. Stuart, Avelie, et al. “‘I Don’t Really Want to Be Associated with the Self-Righteous Left Extreme’: Disincentives to Participation in Collective Action.” Journal of Social and Political Psychology 6.1 (2018): 242–270. Thompson, Charles J. “College Students’ Fashion Activism in the Age of Trump.” The Routledge Companion to Fashion Studies. Eds. Eugenia Paulicelli, Veronica Manlow, and Elizabeth Wissinger. Routledge, 2021. Titton, Monica. “Afterthought: Fashion, Feminism and Radical Protest.” Fashion Theory – Journal of Dress Body and Culture 23.6 (2019): 747–756. Tulloch, Carol. The Birth of Cool: Style Narratives of the African Diaspora. Bloomsbury Publishing, 2016. Turbet, Hanna Mills. “‘We Are Overexposed’: Climate Activists Strip, March through City Streets.” The Age, 12 Oct. 2019. <https://www.theage.com.au/national/victoria/we-are-overexposed-climate-activists-strip-march-through-city-streets-20191012-p5301f.html>. Von Busch, Otto. “Engaged Design and the Practice of Fashion Hacking: The Examples of Giana Gonzalez and Dale Sko.” Fashion Practice 1.2 (2009): 163–185. Yangzom, Dicky. “Clothing and Social Movements: Tibet and the Politics of Dress.” Social Movement Studies 15.6 (2016): 622–633.

APA, Harvard, Vancouver, ISO, and other styles

30

Chen, Peter. "Community without Flesh." M/C Journal 2, no.3 (May1, 1999). http://dx.doi.org/10.5204/mcj.1750.

Full text

Abstract:

On Wednesday 21 April the Minister for Communications, Information Technology and the Arts introduced a piece of legislation into the Australian Senate to regulate the way Australians use the Internet. This legislation is presented within Australia's existing system of content regulation, a scheme that the Minister describes is not censorship, but merely regulation (Alston 55). Underlying Senator Alston's rhetoric about the protection of children from snuff film makers, paedophiles, drug pushers and other criminals, this long anticipated bill is aimed at reducing the amount of pornographic materials available via computer networks, a censorship regime in an age when regulation and classification are the words we prefer to use when society draws the line under material we want to see, but dare not allow ourselves access to. Regardless of any noble aspirations expressed by free-speech organisations such as Electronic Frontiers Australia relating to the defence of personal liberty and freedom of expression, this legislation is about porn. Under the Bill, Australia would proscribe our citizens from accessing: explicit depictions of sexual acts between consenting adults; mild non-violent fetishes; depictions of sexual violence, coercion or non-consent of any kind; depictions of child sexual abuse, bestiality, sexual acts accompanied by offensive fetishes, or exploitative incest fantasies; unduly detailed and/or relished acts of extreme violence or cruelty; explicit or unjustifiable depictions of sexual violence against non-consenting persons; and detailed instruction or encouragement in matters of crime or violence or the abuse of proscribed drugs. (OFLC) The Australian public, as a whole, favour the availability of sexually explicit materials in some form, with OFLC data indicating a relatively high degree of public support for X rated videos, the "high end" of the porn market (Paterson et al.). In Australia strict regulation of X rated materials in conventional media has resulted in a larger illegal market for these materials than the legalised sex industries of the ACT and Northern Territory (while 1.2 million X rated videos are legally sold out of the territories, 2 million are sold illegally in other jurisdictions, according to Patten). In Australia, censorship of media content has traditionally been based on the principles of the protection of society from moral harm and individual degradation, with specific emphasis on the protection of innocents from material they are not old enough for, or mentally capable of dealing with (Joint Select Committee on Video Material). Even when governments distanced themselves from direct personal censorship (such as Don Chipp's approach to the censorship of films and books in the late 1960s and early 1970s) and shifted the rationale behind censorship from prohibition to classification, the publicly stated aims of these decisions have been the support of existing community standards, rather than the imposition of strict legalistic moral values upon an unwilling society. In the debates surrounding censorship, and especially the level of censorship applied (rather than censorship as a whole), the question "what is the community we are talking about here?" has been a recurring theme. The standards that are applied to the regulation of media content, both online and off, are often the focus of community debate (a pluralistic community that obviously lacks "standards" by definition of the word). In essence the problem of maintaining a single set of moral and ethical values for the treatment of media content is a true political dilemma: a problem that lacks any form of solution acceptable to all participants. Since the introduction of the Internet as a "mass" medium (or more appropriately, a "popular" one), government indecision about how best to treat this new technology has precluded any form or content regulation other than the ad hoc use of existing non-technologically specific law to deal with areas of criminal or legally sanctionable intent (such as the use of copyright law, or the powers under the Crimes Act relating to the improper use of telecommunications services). However, indecision in political life is often associated with political weakness, and in the face of pressure to act decisively (motivated again by "community concern"), the Federal government has decided to extend the role of the Australian Broadcasting Authority to regulate and impose a censorship regime on Australian access of morally harmful materials. It is important to note the government's intention to censor access, rather than content of the Internet. While material hosted in Australia (ignoring, of course, the "cyberspace" definitions of non-territorial existence of information stored in networks) will be censored (removed from Australia computers), the government, lacking extraterritorial powers to compel the owners of machines located offshore, intends to introduce of some form of refused access list to materials located in other nations. What is interesting to consider in this context is the way that slight shifts of definitional paradigm alter the way this legislation can be considered. If information flows (upon which late capitalism is becoming more dependent) were to be located within the context of international law governing the flow of waterways, does the decision to prevent travel of morally dubious material through Australia's informational waterways impinge upon the riparian rights of other nations (the doctrine of fair usage without impeding flow; Godana 50)? Similarly, if we take Smith's extended definition of community within electronic transactional spaces (the maintenance of members' commitment to the group, monitoring and sanctioning behaviour and the production and distribution of resources), then the current Bill proposes the regulation of the activities of one community by another (granted, a larger community that incorporates the former). Seen in this context, this legislation is the direct intervention in an established social order by a larger and less homogeneous group. It may be trite to quote the Prime Minister's view of community in this context, where he states ...It is free individuals, strong communities and the rule of law which are the best defence against the intrusive power of the state and against those who think they know what is best for everyone else. (Howard 21) possibly because the paradigm in which this new legislation is situated does not classify those Australians online (who number up to 3 million) as a community in their own right. In a way the Internet users of Australia have never identified themselves as a community, nor been asked to act in a communitarian manner. While discussions about the value of community models when applied to the Internet are still divided, there are those who argue that their use of networked services can be seen in this light (Worthington). What this new legislation does, however, is preclude the establishment of public communities in order to meet the desires of government for some limits to be placed on Internet content. The Bill does allow for the development of "restricted access systems" that would allow pluralistic communities to develop and engage in a limited amount of self-regulation. These systems include privately accessible Intranets, or sites that restrict access through passwords or some other form of age verification technique. Thus, ignoring the minimum standards that will be required for these communities to qualify for some measure of self-regulatory freedom, what is unspoken here is that specific subsections of the Internet population may exist, provided they keep well away from the public gaze. A ghetto without physical walls. Under the Bill, a co-regulatory approach is endorsed by the government, favouring the establishment of industry codes of practice by ISPs and (or) the establishment of a single code of practice by the content hosting industry (content developers are relegated to yet undetermined complementary state legislation). However, this section of the Bill, in mandating a range of minimum requirements for these codes of practice, and denying plurality to the content providers, places an administrative imperative above any communitarian spirit. That is, that the Internet should have no more than one community, it should be an entity bound by a single guiding set of principles and be therefore easier to administer by Australian censors. This administrative imperative re-encapsulates the dilemma faced by governments dealing with the Internet: that at heart, the broadcast and print press paradigms of existing censorship regimes face massive administrative problems when presented with a communications technology that allows for wholesale publication of materials by individuals. Whereas the limited numbers of broadcasters and publishers have allowed the development of Australia's system of classification of materials (on a sliding scale from G to RC classifications or the equivalent print press version), the new legislation introduced into the Senate uses the classification scheme simply as a censorship mechanism: Internet content is either "ok" or "not ok". From a public administration perspective, this allows government to drastically reduce the amount of work required by regulators and eases the burden of compliance costs by ISPs, by directing clear and unambiguous statements about the acceptability of existing materials placed online. However, as we have seen in other areas of social policy (such as the rationalisation of Social Security services or Health), administrative expedience is often antipathetic to small communities that have special needs, or cultural sensitivities outside of mainstream society. While it is not appropriate to argue that public administration creates negative social impacts through expedience, what can be presented is that, where expedience is a core aim of legislation, poor administration may result. For many Australian purveyors of pornography, my comments will be entirely unhelpful as they endeavour to find effective ways to spoof offshore hosts or bone up (no pun intended) on tunnelling techniques. Given the easy way in which material can be reconstituted and relocated on the Internet, it seems likely that some form of regulatory avoidance will occur by users determined not to have their content removed or blocked. For those regulators given the unenviable task of censoring Internet access it may be worthwhile quoting from Sexing the Cherry, in which Jeanette Winterson describes the town: whose inhabitants are so cunning that to escape the insistence of creditors they knock down their houses in a single night and rebuild them elsewhere. So the number of buildings in the city is always constant but they are never in the same place from one day to the next. (43) Thus, while Winterson saw this game as a "most fulfilling pastime", it is likely to present real administrative headaches to ABA regulators when attempting to enforce the Bill's anti-avoidance clauses. The Australian government, in adapting existing regulatory paradigms to the Internet, has overlooked the informal communities who live, work and play within the virtual world of cyberspace. In attempting to meet a perceived social need for regulation with political and administrative expedience, it has ignored the potentially cohesive role of government in developing self-regulating communities who need little government intervention to produce socially beneficial outcomes. In proscribing activity externally to the realm in which these communities reside, what we may see is a new type of community, one whose desire for a feast of flesh leads them to evade the activities of regulators who operate in the "meat" world. What this may show us is that in a virtual environment, the regulators' net is no match for a world wide web. References Alston, Richard. "Regulation is Not Censorship." The Australian 13 April 1999: 55. Paterson, K., et. al. Classification Issues: Film, Video and Television. Sydney: The Office of Film and Literature Classification, 1993. Patten, F. Personal interview. 9 Feb. 1999. Godana, B.A. Africa's Shared Water Resources: Legal and Institutional Aspects of the Nile, Niger and Senegal River Systems. London: Frances Pinter, 1985. Howard, John. The Australia I Believe In: The Values, Directions and Policy Priorities of a Coalition Government Outlined in 1995. Canberra: Liberal Party, 1995. Joint Select Committee On Video Material. Report of the Joint Select Committee On Video Material. Canberra: APGS, 1988. Office of Film and Literature Classification. Cinema & Video Ratings Guide. 1999. 1 May 1999 <http://www.oflc.gov.au/classinfo.php>. Smith, Marc A. "Voices from the WELL: The Logic of the Virtual Commons." 1998. 2 Mar. 1999 <http://www.sscnet.ucla.edu/soc/csoc/papers/voices/Voices.htm>. Winterson, Jeanette. Sexing the Cherry. New York: Vintage Books. 1991. Worthington, T. Testimony before the Senate Select Committee on Information Technologies. Unpublished, 1999. Citation reference for this article MLA style: Peter Chen. "Community without Flesh: First Thoughts on the New Broadcasting Services Amendment (Online Services) Bill 1999." M/C: A Journal of Media and Culture 2.3 (1999). [your date of access] <http://www.uq.edu.au/mc/9905/bill.php>. Chicago style: Peter Chen, "Community without Flesh: First Thoughts on the New Broadcasting Services Amendment (Online Services) Bill 1999," M/C: A Journal of Media and Culture 2, no. 3 (1999), <http://www.uq.edu.au/mc/9905/bill.php> ([your date of access]). APA style: Author. (1999) Community without flesh: first thoughts on the new broadcasting services amendment (online services) bill 1999. M/C: A Journal of Media and Culture 2(3). <http://www.uq.edu.au/mc/9905/bill.php> ([your date of access]).

APA, Harvard, Vancouver, ISO, and other styles

31

Holloway, Donell, Lelia Green, and Robyn Quin. "What Porn?" M/C Journal 7, no.4 (October1, 2004). http://dx.doi.org/10.5204/mcj.2381.

Full text

Abstract:

The negative implications of children’s use of the Internet, particularly their loss of innocence through access to pornography, is a topic frequently addressed in public discussions and debate. These debates often take on a technologically determinist point of view and assume that technology directly influences children, usually in a harmful fashion. But what is really happening in the Australian family home? Are parents fearful of these risks, and if so what are they doing about it? A recent exploration of the everyday Internet lives of Australian families indicates that families manage these perceived risks in a variety of ways and are not overly troubled about this issue. Findings from the research project indicate that Australian parents are more concerned about some children’s excessive use of the Internet than about pornography. They construct the Internet as interfering with time available to carry out homework, chores, getting adequate sleep or participating in outdoor (fresh air) activities. This disparity, between public discourse regarding the protection of children in the online environment and the actual significance of this issue in the everyday lives of Australian families, reflects the domestic dynamics within the “moral economy of the household” (Silverstone et al. 15) whereby family relationships and household practices inform the manner in which technology is consumed within any given household. The research project described here (Family Internet: Theorising Domestic Internet Consumption, Production and Use Within Australian Families) is funded by an Australian Research Council Discovery Grant and investigates Internet use within Australian homes with specific reference to families with school-aged children. It explores how individual family members make sense of their family’s engagement with the Internet and investigates ways in which the Internet is integrated within Australian family life. Public Debates The relationship between children and technology is often addressed in public debates regarding children’s health, safety, social and educational development. Within these debates technology is usually held responsible for a variety of harmful consequences to children. These technological ‘effects’ range from the decline of children’s social relationships (with both peers and family); through sedentary lifestyles which impinge on fitness levels and the weight (body mass index) of children; to the corruption of children (and their loss of innocence) through access to unsuitable materials. These unsuitable texts include “soft and hardcore porn, Neo Nazi groups, paedophiles, racial and ethnic hatred” (Valentine et al. 157). Other digital technologies, such as computer and video games, are sometimes seen as exacerbating these problems and raise the spectre of the ‘Nintendo kid’, friendless and withdrawn (Marshall 73), lacking in social skills and unable to relate to others except through multi-player games – although this caricature appears far removed from children’s normal experience of computer gaming (Aisbett: Durkin and Aisbett). Such debates about the negative implications of the Internet and video games run simultaneously alongside government, educational and commercial promotion of these technologies, and the positioning of digital skills and connectivity as the key to children’s future education and employment. In this pro-technology discourse the family: …is being constructed as an entry point for the development of new computer-related literacies and social practices in young people … what is discursively produced within the global cultural economy as digital fun and games for young people, is simultaneously constructed as serious business for parents (Nixon 23). Thus, two conflicting discourses about children’s Internet use exist simultaneously whereby children are considered both “technically competent and at risk from their technical skills” (Valentine et al. 157). This anxiety is further exacerbated by the fear that parents are losing control of their children’s Internet activities because their own (the parents’) technical competencies are being surpassed by their children. Such fear may well be based on misleading information, particularly in the Australian context. The Australian Broadcasting Authority’s 2001 Internet@ home report “challenges the popular belief that parents lag behind their children in their interest and proficiency with online technology. Most often the household Internet ‘expert’ is an adult” (Aisbett 4). Nonetheless, this public anxiety is underscored by a concern that parents may not be sufficiently Internet-savvy to prevent their children’s access to pornography and other undesirable Internet content. This leads to the fundamental anxiety that parents’ natural power base will be diminished (Valentine et al. 157). In the case of children’s access to Internet porn it may well be that: although parents still occupy the role of initiated with regard to sexuality, if they are uninitiated technologically then they lose the power base from which to set the markers for progressive socialisation (Evans and Butkus 68). These popular fears do not take into consideration the context of Internet use in the real world—of children’s and parents’ actual experiences with and uses of the Internet. Parents have developed a variety of ways to manage these perceived risks in the home and are not usually overly concerned about their children’s exposure to unsuitable or inappropriate content on the Internet. Families’ everyday experiences of Internet consumption The home Internet is one site where most parents exercise some degree of care and control of their children, supervising both the quantity and quality of their children’s Internet experiences. When supervising their children’s access to particular Internet sites, parents in this study use a variety of strategies and approaches. These approaches range from a child-empowering ‘autonomous’ approach (which recognises children’s autonomy and competencies) to more authoritarian approaches (with the use of more direct supervision in order to restrict and protect children). At the same time children may use the Internet to affirm their autonomy or independence from their parents, as parents in this study affirm: He used to let me see the [onscreen] conversations but he won’t let me see them now. But that’s fine. If I come up and talk to him, he clicks the button and takes the screen off. (Kathy, pseudonyms used for interviewee contributions) Parents who tend to favour a child-empowering approach recognise their children’s autonomy, while at the same time having relatively high expectations of their children’s psychosocial competence and ability to handle a variety of media texts in a relatively sophisticated manner. When asked about her son’s access to adult Internet content, single mum Lisa indicated that Henry (17) had openly accessed Internet pornography a few years earlier. She expected (and allowed for) some exploration by her son. At the same time, she was not overly concerned that these materials would corrupt or harm him as she expected these explorations to be a transitory phase in his life: It doesn’t bother me at all. If he wants to do that then he can do it because he’ll get sick of it and I think initially it was ‘let’s see what we can do’. I remember once, he called me in and says ‘Mum, come and look at her boobs’ and I looked at it and I said ‘it’s disgusting’ or something and walked away and he laughed his head off. But I’ve never come in [lately] and found him looking at that stuff … It’s just not something that I’m … really worried about. It’s up to him (Lisa). As with this exchange, families often use media texts as tools in the socialisation of children. The provision of shared topics of conversation allows for discussions between generations: Such materials serve an agenda-setting role … [playing] an important role in providing a socioemotional context for the household within which learning takes place. Technoculture is consequently a critical tool for socialisation … ICTs also construct a framework on/with which to differentiate one member from another, to differentiate between generations, and to differentiate ways in which power and control can be asserted (Green 58). In this case, Lisa’s comment to her teenage son (‘it’s disgusting’) and her actions (in walking away) doubtlessly provided Henry with a social cue, an alternative attitude to his choice of online content. Further, in initiating this exchange with his mother, Henry is likely to have been making a statement about his own autonomy and transition into (heterosexual) manhood. In his interview, Henry openly acknowledged his earlier exploration of adult porn sites but (as his mother anticipated) he seems to have moved on from this particular phase. When asked whether he visited adult sites on the Internet Henry responded in his own succinct manner: Henry: Like porn and stuff? Not really. I probably did when I was a bit younger but it’s not really very exciting. Interviewer: That was when you first got it [the Internet] or when? Henry: Yeah, [two to three years earlier] all your friends come around and you check out the sites. It’s nothing exciting anymore. Sexual experiences and knowledge are an important currency within teenage boy culture (Holland et al. 1998) and like other teenage boys, Henry and his friends are likely to have used this technology in order to “negotiate their masculinity within the heterosexual economy of [their] peer group social relations”(Valentine et al. 160). In this case, it seemed to be a transitory stage within Henry’s peer (or community of interest) group and became less important as the teenagers grew into maturity. Many children and young people are also exploring the social world of Internet chat, with the potential risk of unwanted (and unsafe) face-to-face contact. Leonie, mother of teenage girls, explained her daughters’ ability to negotiate these potentially unsafe contacts: I suppose you just get a bit concerned about the chat lines and who they’re talking to sometimes but really they usually tell me … [to 17-year old daughter in the room] Like on the chat lines you, when, had that idiot … that one that was going to come over here. Just some idiots on there. A lot of the kids are teenagers. I know Shani’s [14] gotten on there a few times on the chat line and there’s been obviously someone asking them lewd questions and she’s usually blocked them and cut them off …(Leonie). Daughter Shani also discusses her experiences with unsafe (unwanted) Internet contact: “They go on about stuff that you don’t really want to talk about and it’s just ‘No, I don’t think so’” (Shani, 14). Shani went on to explain that she now prefers to use instant messaging with known (offline) friends—a preference now taken up by many teenagers (Holloway and Green: Livingstone and Bober). Electronic media play an important role in children’s transition to adulthood. The ubiquitousness of the World Wide Web, however, makes restriction and protection of children increasingly difficult to realise (Buckingham 84-5). Instead, many parents in this study are placing more importance on openness, consultation and discussion with their children about the media texts they encounter, rather than imposing restriction and regulation which these parents believe may well be “counter-productive” (Nightingale et al. 19). Of greater disquiet to many parents in this study than their children’s access to unsuitable online content is concern about their children’s possible excessive use of the Internet. Parents were typically more concerned about the amount of time some of their children were spending chatting to friends and playing online games. One mother explains: They [my daughters] started to use MSN whilst they were doing school work and obviously kids are able to listen to music, watch television, do a project. They can multi-task without all the confusion that I [would have] but we actually now, they’re not able to do MSN during the school week at all … so we now said to them, “if you want to ring somebody, give them a call, that’s fine, we don’t mind, but during the week no MSN” … we’ve actually restricted them (Stephanie). Parental concern about children’s excessive use of the Internet was most marked for parents of teenage children: adolescence being a time when “rules about media consumption can be an early site of resistance for young adults keen to take more power for themselves and their own lives” (Green 30). Father of two, Xavier, expressed his concern about (what he perceived as) his teenage son’s excessive use of the Internet: Well I think there’s far too much time … Gavin’ll spend a whole day on it. I try to get him to come to the footy on Sunday. No. He’s available for friends [for online gaming and chat on the Internet]. He’ll spend all day on the computer (Xavier). Son Gavin (16), in a separate interview, anticipated that this criticism had been made and felt compelled to counter it: Well he [dad] makes comments like saying I’m not fit enough ‘cause I spent too much time on the computer but I play soccer a lot. Like, I do sport perhaps everyday at school … I mean, I think, such a piece of crap (Gavin). Thus, the incorporation of the Internet into the domestic sphere often sees previously established boundaries (who uses what, when, where and for how long) redefined, challenged, resisted and defended by various family members. In this way the Internet (and other new media) helps shape (and is shaped by) the temporal and spatial boundaries within the home. Conclusion While all parents in the Family Internet study construct the Internet as a site which requires some level of care and control over their children’s online use, they use a variety of approaches when carrying out this supervisory role. Some parents tend to allow for children’s free exploration of the Internet and are relatively confident that their children are able to negotiate adult texts such as pornography in a comparatively sophisticated manner. Other parents, those inclined to protect their children from the dangers of adult content and unsafe Internet contact, choose to monitor and restrict their children’s access to the Internet to varying degrees. More consistent is parental concern about excessive use of the Internet, and the assumption that this displaces constructive use of children’s time. Public anxieties about children’s use of the Internet make assumptions about children’s media practices. Children (and their families) are often assumed to be less able to differentiate between suitable and unsuitable Internet texts and to deal with these potential dangers in a sensible manner. These fears presuppose a variety of negative impacts on children’s and young peoples’ lives which may have little to do with daily reality. Our exploration of families’ everyday experiences of Internet consumption highlights the disparity between public anxieties about Internet use and the importance of these anxieties in the everyday lives of families. The major concern of families – ill-disciplined and excessive Internet use – barely registers on the same scale as the public moral panic over children’s possible access to online pornography. These findings say less about the Internet as a locale in cyberspace than they do about the domestic dynamics of the household, parenting styles, relationships between parent(s) and children, and the sociocultural context of family life. References Aisbett, Kate. The Internet at Home: A Report on Internet Use in the Home. Sydney: Australian Broadcasting Authority, 2001. Buckingham, David. After the Death of Childhood: Growing up in the Age of Electronic Media. Cambridge, UK: Polity Press, 2000. Durkin, Kevin and Kate Aisbett. Computer Games and Australians Today. Sydney: Office of Film and Literature Classification, 1999. Evans, Mark and Clarice Butkus. “Regulating the Emergent: Cyberporn and the Traditional Media.” Media International Australia 85 (1997): 62-9. Green, Lelia. Technoculture: >From Alphabet to Cybersex. Crows Nest Australia: Allen and Unwin, 2002. Holland, Janet and Caroline Ramazanoglu, Sue Sharpe and Rachel Thomson. The Male in the Head: Young People, Heterosexuality and Power. London: Tufnell Press, 1998. Holloway, Donell and Lelia Green. “Home Is Where You Hang Your @: Australian Women on the Net.” Communications Research Forum. Canberra: Department of Communications, Information Technology and the Arts, 2003. Livingstone, Sonia and Magdalena Bober. UK Children Go Online: Listening to Young People’s Experiences. London: London School of Economics and Political Science, 2003. Marshall, P. David. “Technophobia: Video Games, Computer Hacks and Cybernetics.” Media International Australia 85 (1997): 70-8. Nightingale, Virginia, Dianne Dickenson and Catherine Griff. “Harm: Children’s Views About Media Harm and Program Classification.” Forum. Sydney, Australia, 2000. Nixon, Helen. “Fun and Games Are Serious Business.” Digital Diversions: Youth Culture in the Age of Multi-Media. Ed. J Sefton-Green. London: UCL Press, 1998. Silverstone, Roger, Eric Hirsch and David Morley. “Information and Communication and the Moral Economy of the Household.” Consuming Technologies: Media and Information in Domestic Spaces. Eds. Roger Silverstone and Eric Hirsch. London: Routledge, 1992. 17-31. Valentine, Gill, Sarah Holloway and Nick Bingham. “Transforming Cyberspace: Children’s Interventions in the New Public Sphere.” Children’s Geographies: Playing, Living, Learning. Eds. Sarah L. Holloway and Gill Valentine. London: Routledge, 2000. 156 – 93. MLA Style Holloway, Donell, Lelia Green & Robyn Quin. "What Porn?: Children and the Family Internet." M/C Journal 7.4 (2004). 10 October 2004 <http://www.media-culture.org.au/0410/02_children.php>. APA Style Holloway, D., Green, L. & Quin, R. (2004 Oct 11). What Porn?: Children and the Family Internet, M/C Journal, 7(4). Retrieved Oct 10 2004 from <http://www.media-culture.org.au/0410/02_children.php>

APA, Harvard, Vancouver, ISO, and other styles

32

Starrs, Bruno. "Hyperlinking History and Illegitimate Imagination: The Historiographic Metafictional E-novel." M/C Journal 17, no.5 (October25, 2014). http://dx.doi.org/10.5204/mcj.866.

Full text

Abstract:

‘Historiographic Metafiction’ (HM) is a literary term first coined by creative writing academic Linda Hutcheon in 1988, and which refers to the postmodern practice of a fiction author inserting imagined--or illegitimate--characters into narratives that are intended to be received as authentic and historically accurate, that is, ostensibly legitimate. Such adventurous and bold authorial strategies frequently result in “novels which are both intensely self-reflexive and yet paradoxically also lay claim to historical events and personages” (Hutcheon, A Poetics 5). They can be so entertaining and engaging that the overtly intertextual, explicitly inventive work of biographical HM can even change the “hegemonic discourse of history” (Nunning 353) for, as Philippa Gregory, the author of HM novel The Other Boleyn Girl (2001), has said regarding this genre of creative writing: “Fiction is about imagined feelings and thoughts. History depends on the outer life. The novel is always about the inner life. Fiction can sometimes do more than history. It can fill the gaps” (University of Sussex). In a way, this article will be filling one of the gaps regarding HM.Forrest Gump (Robert Zemeckis, 1994) is possibly the best known cinematic example of HM, and this film version of the 1986 novel by Winston Groom particularly excels in seamlessly inserting images of a fictional character into verified history, as represented by well-known television newsreel footage. In Zemeckis’s adaptation, gaps were created in the celluloid artefact and filled digitally with images of the actor, Tom Hanks, playing the eponymous role. Words are often deemed less trustworthy than images, however, and fiction is considered particularly unreliable--although there are some exceptions conceded. In addition to Gregory’s novel; Midnight’s Children (1980) by Salman Rushdie; The Name of the Rose (1983) by Umberto Eco; and The Flashman Papers (1969-2005) by George MacDonald Fraser, are three well-known, loved and lauded examples of literary HM, which even if they fail to convince the reader of their bona fides, nevertheless win a place in many hearts. But despite the genre’s popularity, there is nevertheless a conceptual gap in the literary theory of Hutcheon given her (perfectly understandable) inability in 1988 to predict the future of e-publishing. This article will attempt to address that shortcoming by exploring the potential for authors of HM e-novels to use hyperlinks which immediately direct the reader to fact providing webpages such as those available at the website Wikipedia, like a much speedier (and more independent) version of the footnotes in Fraser’s Flashman novels.Of course, as Roland Barthes declared in 1977, “the text is a tissue of quotations drawn from innumerable centres of culture” (146) and, as per any academic work that attempts to contribute to knowledge, a text’s sources--its “quotations”--must be properly identified and acknowledged via checkable references if credibility is to be securely established. Hence, in explaining the way claims to fact in the HM novel can be confirmed by independently published experts on the Internet, this article will also address the problem Hutcheon identifies, in that for many readers the entirety of the HM novel assumes questionable authenticity, that is, the novel’s “meta-fictional self-reflexivity (and intertextuality) renders their claims to historical veracity somewhat problematic, to say the least” ("Historiographic Metafiction: Parody", 3). This article (and the PhD in creative writing I am presently working on at Murdoch University in Perth, Western Australia) will possibly develop the concept of HM to a new level: one at which the Internet-connected reader of the hyperlinked e-novel is made fully (and even instantly) aware of those literary elements of the narrative that are legitimate and factual as distinct from those that are fictional, that is, illegitimate. Furthermore, utilising examples from my own (yet-to-be published) hyperlinked HM e-novel, this article demonstrates that such hyperlinking can add an ironic sub-text to a fictional character’s thoughts and utterances, through highlighting the reality concerning their mistaken or naïve beliefs, thus creating HM narratives that serve an entertainingly complex yet nevertheless truly educational purpose.As a relatively new and under-researched genre of historical writing, HM differs dramatically from the better known style of standard historical or biographical narrative, which typically tends to emphasise mimesis, the cataloguing of major “players” in historical events and encyclopaedic accuracy of dates, deaths and places. Instead, HM involves the re-contextualisation of real-life figures from the past, incorporating the lives of entirely (or, as in the case of Gregory’s Mary Boleyn, at least partly) fictitious characters into their generally accepted famous and factual activities, and/or the invention of scenarios that gel realistically--but entertainingly--within a landscape of well-known and well-documented events. As Hutcheon herself states: “The formal linking of history and fiction through the common denominators of intertextuality and narrativity is usually offered not as a reduction, as a shrinking of the scope and value of fiction, but rather as an expansion of these” ("Intertextuality", 11). Similarly, Gregory emphasises the need for authors of HM to extend themselves beyond the encyclopaedic archive: “Archives are not history. The trouble with archives is that the material is often random and atypical. To have history, you have to have a narrative” (University of Sussex). Functionally then, HM is an intertextual narrative genre which serves to communicate to a contemporary audience an expanded story or stories of the past which present an ultimately more self-reflective, personal and unpredictable authorship: it is a distinctly auteurial mode of biographical history writing for it places the postmodern author’s imaginative “signature” front and foremost.Hutcheon later clarified that the quest for historical truth in fiction cannot possibly hold up to the persuasive powers of a master novelist, as per the following rationale: “Fact is discourse-defined: an event is not” ("Historiographic Metafiction", 843). This means, in a rather simplistic nutshell, that the new breed of HM novel writer is not constrained by what others may call fact: s/he knows that the alleged “fact” can be renegotiated and redefined by an inventive discourse. An event, on the other hand, is responsible for too many incontrovertible consequences for it to be contested by her/his mere discourse. So-called facts are much easier for the HM writer to play with than world changing events. This notion was further popularised by Ansgar Nunning when he claimed the overtly explicit work of HM can even change the “hegemonic discourse of history” (353). HM authors can radically alter, it seems, the way the reader perceives the facts of history especially when entertaining, engaging and believable characters are deliberately devised and manipulated into the narrative by the writer. Little wonder, then, that Hutcheon bemoans the unfortunate reality that for many readers the entirety of a HM work assumes questionable “veracity” due to its author’s insertion of imaginary and therefore illegitimate personages.But there is an advantage to be found in this, the digital era, and that is the Internet’s hyperlink. In our ubiquitously networked electronic information age, novels written for publication as e-books may, I propose, include clickable links on the names of actual people and events to Wikipedia entries or the like, thus strengthening the reception of the work as being based on real history (the occasional unreliability of Wikipedia notwithstanding). If picked up for hard copy publication this function of the HM e-novel can be replicated with the inclusion of icons in the printed margins that can be scanned by smartphones or similar gadgets. This small but significant element of the production reinforces the e-novel’s potential status as a new form of HM and addresses Hutcheon’s concern that for HM novels, their imaginative but illegitimate invention of characters “renders their claims to historical veracity somewhat problematic, to say the least” ("Historiographic Metafiction: Parody", 3).Some historic scenarios are so little researched or so misunderstood and discoloured by the muddy waters of time and/or rumour that such hyperlinking will be a boon to HM writers. Where an obscure facet of Australian history is being fictionalised, for example, these edifying hyperlinks can provide additional background information, as Glenda Banks and Martin Andrew might have wished for when they wrote regarding Bank’s Victorian goldfields based HM novel A Respectable Married Woman. This 2012 printed work explores the lives of several under-researched and under-represented minorities, such as settler women and Aboriginal Australians, and the author Banks lamented the dearth of public awareness regarding these peoples. Indeed, HM seems tailor-made for exposing the subaltern lives of those repressed individuals who form the human “backdrop” to the lives of more famous personages. Banks and Andrew explain:To echo the writings of Homi K. Bhaba (1990), this sets up a creative site for interrogating the dominant, hegemonic, ‘normalised’ master narratives about the Victorian goldfields and ‘re-membering’ a marginalised group - the women of the goldfields, the indigenous [sic], the Chinese - and their culture (2013).In my own hyperlinked short story (presently under consideration for publishing elsewhere), which is actually a standalone version of the first chapter of a full-length HM e-novel about Aboriginal Australian activists Eddie Mabo and Chicka Dixon and the history of the Aboriginal Tent Embassy in Canberra, entitled The Bullroarers, I have focussed on a similarly under-represented minority, that being light-complexioned, mixed race Aboriginal Australians. My second novel to deal with Indigenous Australian issues (see Starrs, That Blackfella Bloodsucka Dance), it is my first attempt at writing HM. Hopefully avoiding overkill whilst alerting readers to those Wikipedia pages with relevance to the narrative theme of non-Indigenous attitudes towards light-complexioned Indigenous Australians, I have inserted a total of only six hyperlinks in this 2200-word piece, plus the explanatory foreword stating: “Note, except where they are well-known place names or are indicated as factual by the insertion of Internet hyperlinks verifying such, all persons, organisations, businesses and places named in this text are entirely fictitious.”The hyperlinks in my short story all take the reader not to stubs but to well-established Wikipedia pages, and provide for the uninformed audience the following near-unassailable facts (i.e. events):The TV program, A Current Affair, which the racist character of the short story taken from The Bullroarers, Mrs Poulter, relies on for her prejudicial opinions linking Aborigines with the dealing of illegal drugs, is a long-running, prime-time Channel Nine production. Of particular relevance in the Wikipedia entry is the comment: “Like its main rival broadcast on the Seven Network, Today Tonight, A Current Affair is often considered by media critics and the public at large to use sensationalist journalism” (Wikipedia, “A Current Affair”).The Aboriginal Tent Embassy, located on the lawns opposite the Old Parliament House in Canberra, was established in 1972 and ever since has been the focus of Aboriginal Australian land rights activism and political agitation. In 1995 the Australian Register of the National Estate listed it as the only Aboriginal site in Australia that is recognised nationally for representing Aboriginal and Torres Strait Islander people and their political struggles (Wikipedia, “The Aboriginal Tent Embassy”).In 1992, during an Aboriginal land rights case known as Mabo, the High Court of Australia issued a judgment constituting a direct overturning of terra nullius, which is a Latin term meaning “land belonging to no one”, and which had previously formed the legal rationale and justification for the British invasion and colonisation of Aboriginal Australia (Wikipedia, “Terra Nullius”).Aboriginal rights activist and Torres Strait Islander, Eddie Koiki Mabo (1936 to 1992), was instrumental in the High Court decision to overturn the doctrine of terra nullius in 1992. In that same year, Eddie Mabo was posthumously awarded the Australian Human Rights Medal in the Human Rights and Equal Opportunity Commission Awards (Wikipedia, “Eddie Mabo”).The full name of what Mrs Poulter blithely refers to as “the Department of Families and that” is the Australian Government’s Department of Families, Housing, Community Services and Indigenous Affairs (Wikipedia, “The Department of Families, Housing, Community Services and Indigenous Affairs”).The British colonisation of Australia was a bloody, murderous affair: “continuous Aboriginal resistance for well over a century belies the ‘myth’ of peaceful settlement in Australia. Settlers in turn often reacted to Aboriginal resistance with great violence, resulting in numerous indiscriminate massacres by whites of Aboriginal men, women and children” (Wikipedia, “History of Australia (1788 - 1850)”).Basically, what is not evidenced empirically with regard to the subject matter of my text, that is, the egregious attitudes of non-Indigenous Australians towards Indigenous Australians, can be extrapolated thanks to the hyperlinks. This resonates strongly with Linda Tuhiwai Smith’s assertion in 2012 that those under-represented by mainstream, patriarchal epistemologies need to be engaged in acts of “reclaiming, reformulating and reconstituting” (143) so as to be re-presented as authentic identities in these HM artefacts of literary research.Exerting auteurial power as an Aboriginal Australian author myself, I have sought to imprint on my writing a multi-levelled signature pertaining to my people’s under-representation: there is not just the text I have created but another level to be considered by the reader, that being my careful choice of Wikipedia pages to hyperlink certain aspects of the creative writing to. These electronic footnotes serve as politically charged acts of “reclaiming, reformulating and reconstituting” Aboriginal Australian history, to reuse the words of Smith, for when we Aboriginal Australian authors reiterate, when we subjugated savages wrestle the keyboard away from the colonising overseers, our readers witness the Other writing back, critically. As I have stated previously (see Starrs, "Writing"), receivers of our words see the distorted and silencing master discourse subverted and, indeed, inverted. Our audiences are subjectively repositioned to see the British Crown as the monster. The previously presumed rational, enlightened and civil coloniser is instead depicted as the author and perpetrator of a violently racist, criminal discourse, until, eventually, s/he is ultimately eroded and made into the Other: s/he is rendered the villainous, predatory savage by the auteurial signatures in revisionist histories such as The Bullroarers.Whilst the benefit in these hyperlinks as electronic educational footnotes in my short story is fairly obvious, what may not be so obvious is the ironic commentary they can make, when read in conjunction with the rest of The Bullroarers. Although one must reluctantly agree with Wayne C. Booth’s comment in his classic 1974 study A Rhetoric of Irony that, in some regards, “the very spirit and value [of irony] are violated by the effort to be clear about it” (ix), I will nevertheless strive for clarity and understanding by utilizing Booth’s definition of irony “as something that under-mines clarities, opens up vistas of chaos, and either liberates by destroying all dogmas or destroys by revealing the inescapable canker of negation at the heart of every affirmation” (ix). The reader of The Bullroarers is not expecting the main character, Mrs Poulter, to be the subject of erosive criticism that destroys her “dogmas” about Aboriginal Australians--certainly not so early in the narrative when it is unclear if she is or is not the protagonist of the story--and yet that’s exactly what the hyperlinks do. They expose her as hopelessly unreliable, laughably misinformed and yes, unforgivably stupid. They reveal the illegitimacy of her beliefs. Perhaps the most personally excoriating of these revelations is provided by the link to the Wikipedia entry on the Australian Government’s Department of Families, Housing, Community Services and Indigenous Affairs, which is where her own daughter, Roxy, works, but which Mrs Poulter knows, gormlessly, as “the Department of Families and that”. The ignorant woman spouts racist diatribes against Aboriginal Australians without even realising how inextricably linked she and her family, who live at the deliberately named Boomerang Crescent, really are. Therein lies the irony I am trying to create with my use of hyperlinks: an independent, expert adjudication reveals my character, Mrs Poulter, and her opinions, are hiding an “inescapable canker of negation at the heart of every affirmation” (Booth ix), despite the air of easy confidence she projects.Is the novel-reading public ready for these HM hyperlinked e-novels and their potentially ironic sub-texts? Indeed, the question must be asked: can the e-book ever compete with the tactile sensations a finely crafted, perfectly bound hardcover publication provides? Perhaps, if the economics of book buying comes into consideration. E-novels are cheap to publish and cheap to purchase, hence they are becoming hugely popular with the book buying public. Writes Mark Coker, the founder of Smashwords, a successful online publisher and distributor of e-books: “We incorporated in 2007, and we officially launched the business in May 2008. In our first year, we published 140 books from 90 authors. Our catalog reached 6,000 books in 2009, 28,800 in 2010, 92,000 in 2011, 191,000 in 2012 and as of this writing (November 2013) stands at over 250,000 titles” (Coker 2013). Coker divulged more about his company’s success in an interview with Forbes online magazine: “‘It costs essentially the same to pump 10,000 new books a month through our network as it will cost to do 100,000 a month,’ he reasons. Smashwords book retails, on average, for just above $3; 15,000 titles are free” (Colao 2012).In such a burgeoning environment of technological progress in publishing I am tempted to say that yes, the time of the hyperlinked e-novel has come, and to even predict that HM will be a big part of this new wave of postmodern literature. The hyperlinked HM e-novel’s strategy invites the reader to reflect on the legitimacy and illegitimacy of different forms of narrative, possibly concluding, thanks to ironic electronic footnoting, that not all the novel’s characters and their commentary are to be trusted. Perhaps my HM e-novel will, with its untrustworthy Mrs Poulter and its little-known history of the Aboriginal Tent Embassy addressed by gap-filling hyperlinks, establish a legitimising narrative for a people who have traditionally in white Australian society been deemed the Other and illegitimate. Perhaps The Bullroarers will someday alter attitudes of non-Indigenous Australians to the history and political activities of this country’s first peoples, to the point even, that as Nunning warns, we witness a change in the “hegemonic discourse of history” (353). If that happens we must be thankful for our Internet-enabled information age and its concomitant possibilities for hyperlinked e-publications, for technology may be separated from the world of art, but it can nevertheless be effectively used to recreate, enhance and access that world, to the extent texts previously considered illegitimate achieve authenticity and veracity.ReferencesBanks, Glenda. A Respectable Married Woman. Melbourne: Lacuna, 2012.Banks, Glenda, and Martin Andrew. “Populating a Historical Novel: A Case Study of a Practice-led Research Approach to Historiographic Metafiction.” Bukker Tillibul 7 (2013). 19 Sep. 2014 ‹http://bukkertillibul.net/Text.html?VOL=7&INDEX=2›.Barthes, Roland. Image, Music, Text. Trans. Stephen Heath. London: Fontana Press, 1977.Booth, Wayne C. A Rhetoric of Irony. Chicago: U of Chicago P, 1974.Colao, J.J. “Apple’s Biggest (Unknown) Supplier of E-books.” Forbes 7 June 2012. 19 Sep. 2014 ‹http://www.forbes.com/sites/jjcolao/2012/06/07/apples-biggest-unknown-supplier-of-e-books/›.Coker, Mark. “Q & A with Smashwords Founder, Mark Coker.” About Smashwords 2013. 19 Sep. 2014 ‹https://www.smashwords.com/about›.Eco, Umberto. The Name of the Rose. Trans. William Weaver, San Diego: Harcourt, 1983.Forrest Gump. Dir. Robert Zemeckis. Paramount Pictures, 1994.Fraser, George MacDonald. The Flashman Papers. Various publishers, 1969-2005.Groom, Winston. Forrest Gump. NY: Doubleday, 1986.Gregory, Philippa. The Other Boleyn Girl. UK: Scribner, 2001.Hutcheon, Linda. A Poetics of Postmodernism: History, Theory, Fiction, 2nd ed. Abingdon, UK: Taylor and Francis, 1988.---. “Intertextuality, Parody, and the Discourses of History: A Poetics of Postmodernism History, Theory, Fiction.” 1988. 19 Sep. 2014 ‹http://ieas.unideb.hu/admin/file_3553.pdf›.---. “Historiographic Metafiction: Parody and the Intertextuality of History.” Eds. P. O’Donnell and R.C. Davis, Intertextuality and Contemporary American Fiction. Baltimore, Maryland: John Hopkins UP, 1989. 3-32.---. “Historiographic Metafiction.” Ed. Michael McKeon, Theory of the Novel: A Historical Approach Baltimore, Maryland: Johns Hopkins UP, 2000. 830-50.Nunning, Ansgar. “Where Historiographic Metafiction and Narratology Meet.” Style 38.3 (2004): 352-75.Rushdie, Salman. Midnight’s Children. London: Jonathan Cape, 1980.Starrs, D. Bruno. That Blackfella Bloodsucka Dance! Saarbrücken, Germany: Just Fiction Edition (paperback), 2011; Starrs via Smashwords (e-book), 2012.---. “Writing Indigenous Vampires: Aboriginal Gothic or Aboriginal Fantastic?” M/C Journal 17.4 (2014). 19 Sep. 2014 ‹http://journal.media-culture.org.au/index.php/mcjournal/article/viewArticle/834›.Tuhiwai Smith, Linda. Decolonizing Methodologies. London & New York: Zed Books, 2012.University of Sussex. “Philippa Gregory Fills the Historical Gaps.” University of Sussex Alumni Magazine 51 (2012). 19 Sep. 2014 ‹http://www.scribd.com/doc/136033913/University-of-Sussex-Alumni-Magazine-Falmer-issue-51›.Wikipedia. “A Current Affair.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/A_Current_Affair›.---. “Aboriginal Tent Embassy.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Aboriginal_Tent_Embassy›.---. “Department of Families, Housing, Community Services and Indigenous Affairs.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Department_of_Families,_Housing,_Community_Services_and_Indigenous_Affairs›.---. “Eddie Mabo.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Eddie_Mabo›.---. “History of Australia (1788 – 1850).” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/History_of_Australia_(1788%E2%80%931850)#Aboriginal_resistance›.---. “Terra Nullius.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Terra_nullius›.

APA, Harvard, Vancouver, ISO, and other styles

33

Nielsen,HanneE.F., Chloe Lucas, and Elizabeth Leane. "Rethinking Tasmania’s Regionality from an Antarctic Perspective: Flipping the Map." M/C Journal 22, no.3 (June19, 2019). http://dx.doi.org/10.5204/mcj.1528.

Full text

Abstract:

IntroductionTasmania hangs from the map of Australia like a drop in freefall from the substance of the mainland. Often the whole state is mislaid from Australian maps and logos (Reddit). Tasmania has, at least since federation, been considered peripheral—a region seen as isolated, a ‘problem’ economically, politically, and culturally. However, Tasmania not only cleaves to the ‘north island’ of Australia but is also subject to the gravitational pull of an even greater land mass—Antarctica. In this article, we upturn the political conventions of map-making that place both Antarctica and Tasmania in obscure positions at the base of the globe. We show how a changing global climate re-frames Antarctica and the Southern Ocean as key drivers of worldwide environmental shifts. The liquid and solid water between Tasmania and Antarctica is revealed not as a homogenous barrier, but as a dynamic and relational medium linking the Tasmanian archipelago with Antarctica. When Antarctica becomes the focus, the script is flipped: Tasmania is no longer on the edge, but core to a network of gateways into the southern land. The state’s capital of Hobart can from this perspective be understood as an “Antarctic city”, central to the geopolitics, economy, and culture of the frozen continent (Salazar et al.). Viewed from the south, we argue, Tasmania is not a problem, but an opportunity for a form of ecological, cultural, economic, and political sustainability that opens up the southern continent to science, discovery, and imagination.A Centre at the End of the Earth? Tasmania as ParadoxThe islands of Tasmania owe their existence to climate change: a period of warming at the end of the last ice age melted the vast sheets of ice covering the polar regions, causing sea levels to rise by more than one hundred metres (Tasmanian Climate Change Office 8). Eleven thousand years ago, Aboriginal people would have witnessed the rise of what is now called Bass Strait, turning what had been a peninsula into an archipelago, with the large island of Tasmania at its heart. The heterogeneous practices and narratives of Tasmanian regional identity have been shaped by the geography of these islands, and their connection to the Southern Ocean and Antarctica. Regions, understood as “centres of collective consciousness and sociospatial identities” (Paasi 241) are constantly reproduced and reimagined through place-based social practices and communications over time. As we will show, diverse and contradictory narratives of Tasmanian regionality often co-exist, interacting in complex and sometimes complementary ways. Ecocritical literary scholar C.A. Cranston considers duality to be embedded in the textual construction of Tasmania, writing “it was hell, it was heaven, it was penal, it was paradise” (29). Tasmania is multiply polarised: it is both isolated and connected; close and far away; rich in resources and poor in capital; the socially conservative birthplace of radical green politics (Hay 60). The weather, as if sensing the fine balance of these paradoxes, blows hot and cold at a moment’s notice.Tasmania has wielded extraordinary political influence at times in its history—notably during the settlement of Melbourne in 1835 (Boyce), and during protests against damming the Franklin River in the early 1980s (Mercer). However, twentieth-century historical and political narratives of Tasmania portray the Bass Strait as a barrier, isolating Tasmanians from the mainland (Harwood 61). Sir Bede Callaghan, who headed one of a long line of federal government inquiries into “the Tasmanian problem” (Harwood 106), was clear that Tasmania was a victim of its own geography:the major disability facing the people of Tasmania (although some residents may consider it an advantage) is that Tasmania is an island. Separation from the mainland adversely affects the economy of the State and the general welfare of the people in many ways. (Callaghan 3)This perspective may stem from the fact that Tasmania has maintained the lowest Gross Domestic Product per capita of all states since federation (Bureau of Infrastructure Transport and Regional Economics 9). Socially, economically, and culturally, Tasmania consistently ranks among the worst regions of Australia. Statistical comparisons with other parts of Australia reveal the population’s high unemployment, low wages, poor educational outcomes, and bad health (West 31). The state’s remoteness and isolation from the mainland states and its reliance on federal income have contributed to the whole of Tasmania, including Hobart, being classified as ‘regional’ by the Australian government, in an attempt to promote immigration and economic growth (Department of Infrastructure and Regional Development 1). Tasmania is indeed both regional and remote. However, in this article we argue that, while regionality may be cast as a disadvantage, the island’s remote location is also an asset, particularly when viewed from a far southern perspective (Image 1).Image 1: Antarctica (Orthographic Projection). Image Credit: Wikimedia Commons, Modified Shading of Tasmania and Addition of Captions by H. Nielsen.Connecting Oceans/Collapsing DistanceTasmania and Antarctica have been closely linked in the past—the future archipelago formed a land bridge between Antarctica and northern land masses until the opening of the Tasman Seaway some 32 million years ago (Barker et al.). The far south was tangible to the Indigenous people of the island in the weather blowing in from the Southern Ocean, while the southern lights, or “nuyina”, formed a visible connection (Australia’s new icebreaker vessel is named RSV Nuyina in recognition of these links). In the contemporary Australian imagination, Tasmania tends to be defined by its marine boundaries, the sea around the islands represented as flat, empty space against which to highlight the topography of its landscape and the isolation of its position (Davies et al.). A more relational geographic perspective illuminates the “power of cross-currents and connections” (Stratford et al. 273) across these seascapes. The sea country of Tasmania is multiple and heterogeneous: the rough, shallow waters of the island-scattered Bass Strait flow into the Tasman Sea, where the continental shelf descends toward an abyssal plain studded with volcanic seamounts. To the south, the Southern Ocean provides nutrient-rich upwellings that attract fish and cetacean populations. Tasmania’s coast is a dynamic, liminal space, moving and changing in response to the global currents that are driven by the shifting, calving and melting ice shelves and sheets in Antarctica.Oceans have long been a medium of connection between Tasmania and Antarctica. In the early colonial period, when the seas were the major thoroughfares of the world and inland travel was treacherous and slow, Tasmania’s connection with the Southern Ocean made it a valuable hub for exploration and exploitation of the south. Between 1642 and 1900, early European explorers were followed by British penal colonists, convicts, sealers, and whalers (Kriwoken and Williamson 93). Tasmania was well known to polar explorers, with expeditions led by Jules Dumont d’Urville, James Clark Ross, Roald Amundsen, and Douglas Mawson all transiting through the port of Hobart. Now that the city is no longer a whaling hub, growing populations of cetaceans continue to migrate past the islands on their annual journeys from the tropics, across the Sub-Antarctic Front and Antarctic circumpolar current, and into the south polar region, while southern species such as leopard seals are occasionally seen around Tasmania (Tasmania Parks and Wildlife). Although the water surrounding Tasmania and Antarctica is at times homogenised as a ‘barrier’, rendering these places isolated, the bodies of water that surround both are in fact permeable, and regularly crossed by both humans and marine species. The waters are diverse in their physical characteristics, underlying topography, sea life, and relationships, and serve to connect many different ocean regions, ecosystems, and weather patterns.Views from the Far SouthWhen considered in terms of its relative proximity to Antarctic, rather than its distance from Australia’s political and economic centres, Tasmania’s identity undergoes a significant shift. A sign at Cockle Creek, in the state’s far south, reminds visitors that they are closer to Antarctica than to Cairns, invoking a discourse of connectedness that collapses the standard ten-day ship voyage to Australia’s closest Antarctic station into a unit comparable with the routinely scheduled 5.5 hour flight to North Queensland. Hobart is the logistical hub for the Australian Antarctic Division and the French Institut Polaire Francais (IPEV), and has hosted Antarctic vessels belonging to the USA, South Korea, and Japan in recent years. From a far southern perspective, Hobart is not a regional Australian capital but a global polar hub. This alters the city’s geographic imaginary not only in a latitudinal sense—from “top down” to “bottom up”—but also a longitudinal one. Via its southward connection to Antarctica, Hobart is also connected east and west to four other recognized gateways: Cape Town in South Africa, Christchurch in New Zealand; Punta Arenas in Chile; and Ushuaia in Argentina (Image 2). The latter cities are considered small by international standards, but play an outsized role in relation to Antarctica.Image 2: H. Nielsen with a Sign Announcing Distances between Antarctic ‘Gateway’ Cities and Antarctica, Ushuaia, Argentina, 2018. Image Credit: Nicki D'Souza.These five cities form what might be called—to adapt geographer Klaus Dodds’ term—a ‘Southern Rim’ around the South Polar region (Dodds Geopolitics). They exist in ambiguous relationship to each other. Although the five cities signed a Statement of Intent in 2009 committing them to collaboration, they continue to compete vigorously for northern hemisphere traffic and the brand identity of the most prominent global gateway. A state government brochure spruiks Hobart, for example, as the “perfect Antarctic Gateway” emphasising its uniqueness and “natural advantages” in this regard (Tasmanian Government, 2016). In practice, the cities are automatically differentiated by their geographic position with respect to Antarctica. Although the ‘ice continent’ is often conceived as one entity, it too has regions, in both scientific and geographical senses (Terauds and Lee; Antonello). Hobart provides access to parts of East Antarctica, where the Australian, French, Japanese, and Chinese programs (among others) have bases; Cape Town is a useful access point for Europeans going to Dronning Maud Land; Christchurch is closest to the Ross Sea region, site of the largest US base; and Punta Arenas and Ushuaia neighbour the Antarctic Peninsula, home to numerous bases as well as a thriving tourist industry.The Antarctic sector is important to the Tasmanian economy, contributing $186 million (AUD) in 2017/18 (Wells; Gutwein; Tasmanian Polar Network). Unsurprisingly, Tasmania’s gateway brand has been actively promoted, with the 2016 Australian Antarctic Strategy and 20 Year Action Plan foregrounding the need to “Build Tasmania’s status as the premier East Antarctic Gateway for science and operations” and the state government releasing a “Tasmanian Antarctic Gateway Strategy” in 2017. The Chinese Antarctic program has been a particular focus: a Memorandum of Understanding focussed on Australia and China’s Antarctic relations includes a “commitment to utilise Australia, including Tasmania, as an Antarctic ‘gateway’.” (Australian Antarctic Division). These efforts towards a closer relationship with China have more recently come under attack as part of a questioning of China’s interests in the region (without, it should be noted, a concomitant questioning of Australia’s own considerable interests) (Baker 9). In these exchanges, a global power and a state of Australia generally classed as regional and peripheral are brought into direct contact via the even more remote Antarctic region. This connection was particularly visible when Chinese President Xi Jinping travelled to Hobart in 2014, in a visit described as both “strategic” and “incongruous” (Burden). There can be differences in how this relationship is narrated to domestic and international audiences, with issues of sovereignty and international cooperation variously foregrounded, laying the ground for what Dodds terms “awkward Antarctic nationalism” (1).Territory and ConnectionsThe awkwardness comes to a head in Tasmania, where domestic and international views of connections with the far south collide. Australia claims sovereignty over almost 6 million km2 of the Antarctic continent—a claim that in area is “roughly the size of mainland Australia minus Queensland” (Bergin). This geopolitical context elevates the importance of a regional part of Australia: the claims to Antarctic territory (which are recognised only by four other claimant nations) are performed not only in Antarctic localities, where they are made visible “with paraphernalia such as maps, flags, and plaques” (Salazar 55), but also in Tasmania, particularly in Hobart and surrounds. A replica of Mawson’s Huts in central Hobart makes Australia’s historic territorial interests in Antarctica visible an urban setting, foregrounding the figure of Douglas Mawson, the well-known Australian scientist and explorer who led the expeditions that proclaimed Australia’s sovereignty in the region of the continent roughly to its south (Leane et al.). Tasmania is caught in a balancing act, as it fosters international Antarctic connections (such hosting vessels from other national programs), while also playing a key role in administering what is domestically referred to as the Australian Antarctic Territory. The rhetoric of protection can offer common ground: island studies scholar Godfrey Baldacchino notes that as island narratives have moved “away from the perspective of the ‘explorer-discoverer-colonist’” they have been replaced by “the perspective of the ‘custodian-steward-environmentalist’” (49), but reminds readers that a colonising disposition still lurks beneath the surface. It must be remembered that terms such as “stewardship” and “leadership” can undertake sovereignty labour (Dodds “Awkward”), and that Tasmania’s Antarctic connections can be mobilised for a range of purposes. When Environment Minister Greg Hunt proclaimed at a press conference that: “Hobart is the gateway to the Antarctic for the future” (26 Apr. 2016), the remark had meaning within discourses of both sovereignty and economics. Tasmania’s capital was leveraged as a way to position Australia as a leader in the Antarctic arena.From ‘Gateway’ to ‘Antarctic City’While discussion of Antarctic ‘Gateway’ Cities often focuses on the economic and logistical benefit of their Antarctic connections, Hobart’s “gateway” identity, like those of its counterparts, stretches well beyond this, encompassing geological, climatic, historical, political, cultural and scientific links. Even the southerly wind, according to cartoonist Jon Kudelka, “has penguins in it” (Image 3). Hobart residents feel a high level of connection to Antarctica. In 2018, a survey of 300 randomly selected residents of Greater Hobart was conducted under the umbrella of the “Antarctic Cities” Australian Research Council Linkage Project led by Assoc. Prof. Juan Francisco Salazar (and involving all three present authors). Fourteen percent of respondents reported having been involved in an economic activity related to Antarctica, and 36% had attended a cultural event about Antarctica. Connections between the southern continent and Hobart were recognised as important: 71.9% agreed that “people in my city can influence the cultural meanings that shape our relationship to Antarctica”, while 90% agreed or strongly agreed that Hobart should play a significant role as a custodian of Antarctica’s future, and 88.4% agreed or strongly agreed that: “How we treat Antarctica is a test of our approach to ecological sustainability.” Image 3: “The Southerly” Demonstrates How Weather Connects Hobart and Antarctica. Image Credit: Jon Kudelka, Reproduced with Permission.Hobart, like the other gateways, activates these connections in its conscious place-branding. The city is particularly strong as a centre of Antarctic research: signs at the cruise-ship terminal on the waterfront claim that “There are more Antarctic scientists based in Hobart […] than at any other one place on earth, making Hobart a globally significant contributor to our understanding of Antarctica and the Southern Ocean.” Researchers are based at the Institute for Marine and Antarctic Studies (IMAS), the Commonwealth Scientific and Industrial Research Organisation (CSIRO), and the Australian Antarctic Division (AAD), with several working between institutions. Many Antarctic researchers located elsewhere in the world also have a connection with the place through affiliations and collaborations, leading journalist Jo Chandler to assert that “the breadth and depth of Hobart’s knowledge of ice, water, and the life forms they nurture […] is arguably unrivalled anywhere in the world” (86).Hobart also plays a significant role in Antarctica’s governance, as the site of the secretariats for the Commission for the Conservation of Antarctic Marine Living Resources (CCAMLR) and the Agreement on the Conservation of Albatrosses and Petrels (ACAP), and as host of the Antarctic Consultative Treaty Meetings on more than one occasion (1986, 2012). The cultural domain is active, with Tasmanian Museum and Art Gallery (TMAG) featuring a permanent exhibit, “Islands to Ice”, emphasising the ocean as connecting the two places; the Mawson’s Huts Replica Museum aiming (among other things) to “highlight Hobart as the gateway to the Antarctic continent for the Asia Pacific region”; and a biennial Australian Antarctic Festival drawing over twenty thousand visitors, about a sixth of them from interstate or overseas (Hingley). Antarctic links are evident in the city’s natural and built environment: the dolerite columns of Mt Wellington, the statue of the Tasmanian Antarctic explorer Louis Bernacchi on the waterfront, and the wharfs that regularly accommodate icebreakers such as the Aurora Australis and the Astrolabe. Antarctica is figured as a southern neighbour; as historian Tom Griffiths puts it, Tasmanians “grow up with Antarctica breathing down their necks” (5). As an Antarctic City, Hobart mediates access to Antarctica both physically and in the cultural imaginary.Perhaps in recognition of the diverse ways in which a region or a city might be connected to Antarctica, researchers have recently been suggesting critical approaches to the ‘gateway’ label. C. Michael Hall points to a fuzziness in the way the term is applied, noting that it has drifted from its initial definition (drawn from economic geography) as denoting an access and supply point to a hinterland that produces a certain level of economic benefits. While Hall looks to keep the term robustly defined to avoid empty “local boosterism” (272–73), Gabriela Roldan aims to move the concept “beyond its function as an entry and exit door”, arguing that, among other things, the local community should be actively engaged in the Antarctic region (57). Leane, examining the representation of Hobart as a gateway in historical travel texts, concurs that “ingress and egress” are insufficient descriptors of Tasmania’s relationship with Antarctica, suggesting that at least discursively the island is positioned as “part of an Antarctic rim, itself sharing qualities of the polar region” (45). The ARC Linkage Project described above, supported by the Hobart City Council, the State Government and the University of Tasmania, as well as other national and international partners, aims to foster the idea of the Hobart and its counterparts as ‘Antarctic cities’ whose citizens act as custodians for the South Polar region, with a genuine concern for and investment in its future.Near and Far: Local Perspectives A changing climate may once again herald a shift in the identity of the Tasmanian islands. Recognition of the central role of Antarctica in regulating the global climate has generated scientific and political re-evaluation of the region. Antarctica is not only the planet’s largest heat sink but is the engine of global water currents and wind patterns that drive weather patterns and biodiversity across the world (Convey et al. 543). For example, Tas van Ommen’s research into Antarctic glaciology shows the tangible connection between increased snowfall in coastal East Antarctica and patterns of drought southwest Western Australia (van Ommen and Morgan). Hobart has become a global centre of marine and Antarctic science, bringing investment and development to the city. As the global climate heats up, Tasmania—thanks to its low latitude and southerly weather patterns—is one of the few regions in Australia likely to remain temperate. This is already leading to migration from the mainland that is impacting house prices and rental availability (Johnston; Landers 1). The region’s future is therefore closely entangled with its proximity to the far south. Salazar writes that “we cannot continue to think of Antarctica as the end of the Earth” (67). Shifting Antarctica into focus also brings Tasmania in from the margins. As an Antarctic city, Hobart assumes a privileged positioned on the global stage. This allows the city to present itself as central to international research efforts—in contrast to domestic views of the place as a small regional capital. The city inhabits dual identities; it is both on the periphery of Australian concerns and at the centre of Antarctic activity. Tasmania, then, is not in freefall, but rather at the forefront of a push to recognise Antarctica as entangled with its neighbours to the north.AcknowledgementsThis work was supported by the Australian Research Council under LP160100210.ReferencesAntonello, Alessandro. “Finding Place in Antarctica.” Antarctica and the Humanities. Eds. Peder Roberts, Lize-Marie van der Watt, and Adrian Howkins. London: Palgrave Macmillan, 2016. 181–204.Australian Government. Australian Antarctic Strategy and 20 Year Action Plan. Canberra: Commonwealth of Australia, 2016. 15 Apr. 2019. <http://www.antarctica.gov.au/__data/assets/pdf_file/0008/180827/20YearStrategy_final.pdf>.Australian Antarctic Division. “Australia-China Collaboration Strengthens.” Australian Antarctic Magazine 27 Dec. 2014. 15 Apr. 2019. <http://www.antarctica.gov.au/magazine/2011-2015/issue-27-december-2014/in-brief/australia-china-collaboration-strengthens>.Baker, Emily. “Worry at Premier’s Defence of China.” The Mercury 15 Sep. 2018: 9.Baldacchino, G. “Studying Islands: On Whose Terms?” Island Studies Journal 3.1 (2008): 37–56.Barker, Peter F., Gabriel M. Filippelli, Fabio Florindo, Ellen E. Martin, and Howard D. Schere. “Onset and Role of the Antarctic Circumpolar Current.” Deep Sea Research Part II: Topical Studies in Oceanography. 54.21–22 (2007): 2388–98.Bergin, Anthony. “Australia Needs to Strengthen Its Strategic Interests in Antarctica.” Australian Strategic Policy Institute. 29 Apr. 2016. 21 Feb. 2019 <https://www.aspi.org.au/index.php/opinion/australia-needs-strengthen-its-strategic-interests-antarctica>.Boyce, James. 1835: The Founding of Melbourne and the Conquest of Australia. Melbourne: Black Inc., 2011.Burden, Hilary. “Xi Jinping's Tasmania Visit May Seem Trivial, But Is Full of Strategy.” The Guardian 18 Nov. 2014. 19 May 2019 <https://www.theguardian.com/world/2014/nov/18/xi-jinpings-tasmania-visit-lacking-congruity-full-of-strategy>.Bureau of Infrastructure Transport and Regional Economics (BITRE). A Regional Economy: A Case Study of Tasmania. Canberra: Commonwealth of Australia, 2008. 14 May 2019 <http://www.bitre.gov.au/publications/86/Files/report116.pdf>.Chandler, Jo. “The Science Laboratory: From Little Things, Big Things Grow.” Griffith Review: Tasmania: The Tipping Point? 29 (2013) 83–101.Christchurch City Council. Statement of Intent between the Southern Rim Gateway Cities to the Antarctic: Ushuaia, Punta Arenas, Christchurch, Hobart and Cape Town. 25 Sep. 2009. 11 Apr. 2019 <http://archived.ccc.govt.nz/Council/proceedings/2009/September/CnclCover24th/Clause8Attachment.pdf>.Convey, P., R. Bindschadler, G. di Prisco, E. Fahrbach, J. Gutt, D.A. Hodgson, P.A. Mayewski, C.P. Summerhayes, J. Turner, and ACCE Consortium. “Antarctic Climate Change and the Environment.” Antarctic Science 21.6 (2009): 541–63.Cranston, C. “Rambling in Overdrive: Travelling through Tasmanian Literature.” Tasmanian Historical Studies 8.2 (2003): 28–39.Davies, Lynn, Margaret Davies, and Warren Boyles. Mapping Van Diemen’s Land and the Great Beyond: Rare and Beautiful Maps from the Royal Society of Tasmania. Hobart: The Royal Society of Tasmania, 2018.Department of Infrastructure and Regional Development. Guidelines for Analysing Regional Australia Impacts and Developing a Regional Australia Impact Statement. Canberra: Commonwealth of Australia, 2017. 11 Apr. 2019 <https://regional.gov.au/regional/information/rais/>.Dodds, Klaus. “Awkward Antarctic Nationalism: Bodies, Ice Cores and Gateways in and beyond Australian Antarctic Territory/East Antarctica.” Polar Record 53.1 (2016): 16–30.———. Geopolitics in Antarctica: Views from the Southern Oceanic Rim. Chichester: John Wiley, 1997.Griffiths, Tom. “The Breath of Antarctica.” Tasmanian Historical Studies 11 (2006): 4–14.Gutwein, Peter. “Antarctic Gateway Worth $186 Million to Tasmanian Economy.” Hobart: Tasmanian Government, 20 Feb. 2019. 21 Feb. 2019 <http://www.premier.tas.gov.au/releases/antarctic_gateway_worth_$186_million_to_tasmanian_economy>.Hall, C. Michael. “Polar Gateways: Approaches, Issues and Review.” The Polar Journal 5.2 (2015): 257–77. Harwood Andrew. “The Political Constitution of Islandness: The ‘Tasmanian Problem’ and Ten Days on the Island.” PhD Thesis. U of Tasmania, 2011. <http://eprints.utas.edu.au/11855/%5Cninternal-pdf://5288/11855.html>.Hay, Peter. “Destabilising Tasmanian Politics: The Key Role of the Greens.” Bulletin of the Centre for Tasmanian Historical Studies 3.2 (1991): 60–70.Hingley, Rebecca. Personal Communication, 28 Nov. 2018.Johnston, P. “Is the First Wave of Climate Migrants Landing in Hobart?” The Fifth Estate 11 Sep. 2018. 15 Mar. 2019 <https://www.thefifthestate.com.au/urbanism/climate-change-news/climate-migrants-landing-hobart>.Kriwoken, L., and J. Williamson. “Hobart, Tasmania: Antarctic and Southern Ocean Connections.” Polar Record 29.169 (1993): 93–102.Kudelka, John. “The Southerly.” Kudelka Cartoons. 27 Jun. 2014. 21 Feb. 2019 <https://www.kudelka.com.au/2014/06/the-southerly/>.Leane, E., T. Winter, and J.F. Salazar. “Caught between Nationalism and Internationalism: Replicating Histories of Antarctica in Hobart.” International Journal of Heritage Studies 22.3 (2016): 214–27. Leane, Elizabeth. “Tasmania from Below: Antarctic Travellers’ Accounts of a Southern ‘Gateway’.” Studies in Travel Writing 20.1 (2016): 34-48.Mawson’s Huts Replica Museum. “Mission Statement.” 15 Apr. 2019 <http://www.mawsons-huts-replica.org.au/>.Mercer, David. "Australia's Constitution, Federalism and the ‘Tasmanian Dam Case’." Political Geography Quarterly 4.2 (1985): 91–110.Paasi, A. “Deconstructing Regions: Notes on the Scales of Spatial Life.” Environment and Planning A: Economy and Space 23.2 (1991) 239–56.Reddit. “Maps without Tasmania.” 15 Apr. 2019 <https://www.reddit.com/r/MapsWithoutTasmania/>.Roldan, Gabriela. “'A Door to the Ice?: The Significance of the Antarctic Gateway Cities Today.” Journal of Antarctic Affairs 2 (2015): 57–70.Salazar, Juan Francisco. “Geographies of Place-Making in Antarctica: An Ethnographic Epproach.” The Polar Journal 3.1 (2013): 53–71.———, Elizabeth Leane, Liam Magee, and Paul James. “Five Cities That Could Change the Future of Antarctica.” The Conversation 5 Oct. 2016. 19 May 2019 <https://theconversation.com/five-cities-that-could-change-the-future-of-antarctica-66259>.Stratford, Elaine, Godfrey Baldacchino, Elizabeth McMahon, Carol Farbotko, and Andrew Harwood. “Envisioning the Archipelago.” Island Studies Journal 6.2 (2011): 113–30.Tasmanian Climate Change Office. Derivation of the Tasmanian Sea Level Rise Planning Allowances. Aug. 2012. 17 Apr. 2019 <http://www.dpac.tas.gov.au/__data/assets/pdf_file/0003/176331/Tasmanian_SeaLevelRisePlanningAllowance_TechPaper_Aug2012.pdf>.Tasmanian Government Department of State Growth. “Tasmanian Antarctic Gateway Strategy.” Hobart: Tasmanian Government, 12 Dec. 2017. 21 Feb. 2019 <https://www.antarctic.tas.gov.au/__data/assets/pdf_file/0004/164749/Tasmanian_Antarctic_Gateway_Strategy_12_Dec_2017.pdf>.———. “Tasmania Delivers…” Apr. 2016. 15 Apr. 2019 <https://www.antarctic.tas.gov.au/__data/assets/pdf_file/0005/66461/Tasmania_Delivers_Antarctic_Southern_Ocean_web.pdf>.———. “Antarctic Tasmania.” 17 Feb. 2019. 15 Apr. 2019 <https://www.antarctic.tas.gov.au/about/hobarts_antarctic_attractions>.Tasmanian Polar Network. “Welcome to the Tasmanian Polar Network.” 28 Feb. 2019 <https://www.tasmanianpolarnetwork.com.au/>.Terauds, Aleks, and Jasmine Lee. “Antarctic Biogeography Revisited: Updating the Antarctic Conservation Biogeographic Regions.” Diversity and Distributions 22 (2016): 836–40.Van Ommen, Tas, and Vin Morgan. “Snowfall Increase in Coastal East Antarctica Linked with Southwest Western Australian Drought.” Nature Geoscience 3 (2010): 267–72.Wells Economic Analysis. The Contribution of the Antarctic and Southern Ocean Sector to the Tasmanian Economy 2017. 18 Nov. 2018. 15 Apr. 2019 <https://www.stategrowth.tas.gov.au/__data/assets/pdf_file/0010/185671/Wells_Report_on_the_Value_of_the_Antarctic_Sector_2017_18.pdf>.West, J. “Obstacles to Progress: What’s Wrong with Tasmania, Really?” Griffith Review: Tasmania: The Tipping Point? 39 (2013): 31–53.

APA, Harvard, Vancouver, ISO, and other styles

34

Franks, Rachel. "A True Crime Tale: Re-imagining Governor Arthur’s Proclamation to the Aborigines." M/C Journal 18, no.6 (March7, 2016). http://dx.doi.org/10.5204/mcj.1036.

Full text

Abstract:

Special Care Notice This paper discusses trauma and violence inflicted upon the Indigenous peoples of Tasmania through the process of colonisation. Content within this paper may be distressing to some readers. Introduction The decimation of the First Peoples of Van Diemen’s Land (now Tasmania) was systematic and swift. First Contact was an emotionally, intellectually, physically, and spiritually confronting series of encounters for the Indigenous inhabitants. There were, according to some early records, a few examples of peaceful interactions (Morris 84). Yet, the inevitable competition over resources, and the intensity with which colonists pursued their “claims” for food, land, and water, quickly transformed amicable relationships into hostile rivalries. Jennifer Gall has written that, as “European settlement expanded in the late 1820s, violent exchanges between settlers and Aboriginal people were frequent, brutal and unchecked” (58). Indeed, the near-annihilation of the original custodians of the land was, if viewed through the lens of time, a process that could be described as one that was especially efficient. As John Morris notes: in 1803, when the first settlers arrived in Van Diemen’s Land, the Aborigines had already inhabited the island for some 25,000 years and the population has been estimated at 4,000. Seventy-three years later, Truganinni, [often cited as] the last Tasmanian of full Aboriginal descent, was dead. (84) Against a backdrop of extreme violence, often referred to as the Black War (Clements 1), there were some, admittedly dubious, efforts to contain the bloodshed. One such effort, in the late 1820s, was the production, and subsequent distribution, of a set of Proclamation Boards. Approximately 100 Proclamation Boards (the Board) were introduced by the Lieutenant Governor of the day, George Arthur (after whom Port Arthur on the Tasman Peninsula is named). The purpose of these Boards was to communicate, via a four-strip pictogram, to the Indigenous peoples of the island colony that all people—black and white—were considered equal under the law. “British Justice would protect” everyone (Morris 84). This is reflected in the narrative of the Boards. The first image presents Indigenous peoples and colonists living peacefully together. The second, and central, image shows “a conciliatory handshake between the British governor and an Aboriginal ‘chief’, highly reminiscent of images found in North America on treaty medals and anti-slavery tokens” (Darian-Smith and Edmonds 4). The third and fourth images depict the repercussions for committing murder, with an Indigenous man hanged for spearing a colonist and a European man also hanged for shooting an Aborigine. Both men executed under “gubernatorial supervision” (Turnbull 53). Image 1: Governor Davey's [sic - actually Governor Arthur's] Proclamation to the Aborigines, 1816 [sic - actually c. 1828-30]. Image Credit: Mitchell Library, State Library of NSW (Call Number: SAFE / R 247). The Board is an interesting re-imagining of one of the traditional methods of communication for Indigenous peoples; the leaving of images on the bark of trees. Such trees, often referred to as scarred trees, are rare in modern-day Tasmania as “the expansion of settlements, and the impact of bush fires and other environmental factors” resulted in many of these trees being destroyed (Aboriginal Heritage Tasmania online). Similarly, only a few of the Boards, inspired by these trees, survive today. The Proclamation Board was, in the 1860s, re-imagined as the output of a different Governor: Lieutenant Governor Davey (after whom Port Davey, on the south-west coast of Tasmania is named). This re-imagining of the Board’s creator was so effective that the Board, today, is popularly known as Governor Davey’s Proclamation to the Aborigines. This paper outlines several other re-imaginings of this Board. In addition, this paper offers another, new, re-imagining of the Board, positing that this is an early “pamphlet” on crime, justice and punishment which actually presents as a pre-cursor to the modern Australian true crime tale. In doing so this work connects the Proclamation Board to the larger genre of crime fiction. One Proclamation Board: Two Governors Labelled Van Diemen’s Land and settled as a colony of New South Wales in 1803, this island state would secede from the administration of mainland Australia in 1825. Another change would follow in 1856 when Van Diemen’s Land was, in another process of re-imagining, officially re-named Tasmania. This change in nomenclature was an initiative to, symbolically at least, separate the contemporary state from a criminal and violent past (Newman online). Tasmania’s violent history was, perhaps, inevitable. The island was claimed by Philip Gidley King, the Governor of New South Wales, in the name of His Majesty, not for the purpose of building a community, but to “prevent the French from gaining a footing on the east side of that island” and also to procure “timber and other natural products, as well as to raise grain and to promote the seal industry” (Clark 36). Another rationale for this land claim was to “divide the convicts” (Clark 36) which re-fashioned the island into a gaol. It was this penal element of the British colonisation of Australia that saw the worst of the British Empire forced upon the Aboriginal peoples. As historian Clive Turnbull explains: the brutish state of England was reproduced in the English colonies, and that in many ways its brutishness was increased, for now there came to Australia not the humanitarians or the indifferent, but the men who had vested interests in the systems of restraint; among those who suffered restraint were not only a vast number who were merely unfortunate and poverty-stricken—the victims of a ‘depression’—but brutalised persons, child-slaughterers and even potential cannibals. (Turnbull 25) As noted above the Black War of Tasmania saw unprecedented aggression against the rightful occupants of the land. Yet, the Aboriginal peoples were “promised the white man’s justice, the people [were] exhorted to live in amity with them, the wrongs which they suffer [were] deplored” (Turnbull 23). The administrators purported an egalitarian society, one of integration and peace but Van Diemen’s Land was colonised as a prison and as a place of profit. So, “like many apologists whose material benefit is bound up with the systems which they defend” (Turnbull 23), assertions of care for the health and welfare of the Aboriginal peoples were made but were not supported by sufficient policies, or sufficient will, and the Black War continued. Colonel Thomas Davey (1758-1823) was the second person to serve as Lieutenant Governor of Van Diemen’s Land; a term of office that began in 1813 and concluded in 1817. The fourth Lieutenant Governor of the island was Colonel Sir George Arthur (1784-1854); his term of office, significantly longer than Davey’s, being from 1824 to 1836. The two men were very different but are connected through this intriguing artefact, the Proclamation Board. One of the efforts made to assert the principle of equality under the law in Van Diemen’s Land was an outcome of work undertaken by Surveyor General George Frankland (1800-1838). Frankland wrote to Arthur in early 1829 and suggested the Proclamation Board (Morris 84), sometimes referred to as a Picture Board or the Tasmanian Hieroglyphics, as a tool to support Arthur’s various Proclamations. The Proclamation, signed on 15 April 1828 and promulgated in the The Hobart Town Courier on 19 April 1828 (Arthur 1), was one of several notices attempting to reduce the increasing levels of violence between Indigenous peoples and colonists. The date on Frankland’s correspondence clearly situates the Proclamation Board within Arthur’s tenure as Lieutenant Governor. The Board was, however, in the 1860s, re-imagined as the output of Davey. The Clerk of the Tasmanian House of Assembly, Hugh M. Hull, asserted that the Board was the work of Davey and not Arthur. Hull’s rationale for this, despite archival evidence connecting the Board to Frankland and, by extension, to Arthur, is predominantly anecdotal. In a letter to the editor of The Hobart Mercury, published 26 November 1874, Hull wrote: this curiosity was shown by me to the late Mrs Bateman, neé Pitt, a lady who arrived here in 1804, and with whom I went to school in 1822. She at once recognised it as one of a number prepared in 1816, under Governor Davey’s orders; and said she had seen one hanging on a gum tree at Cottage Green—now Battery Point. (3) Hull went on to assert that “if any old gentleman will look at the picture and remember the style of military and civil dress of 1810-15, he will find that Mrs Bateman was right” (3). Interestingly, Hull relies upon the recollections of a deceased school friend and the dress codes depicted by the artist to date the Proclamation Board as a product of 1816, in lieu of documentary evidence dating the Board as a product of 1828-1830. Curiously, the citation of dress can serve to undermine Hull’s argument. An early 1840s watercolour by Thomas Bock, of Mathinna, an Aboriginal child of Flinders Island adopted by Lieutenant Governor John Franklin (Felton online), features the young girl wearing a brightly coloured, high-waisted dress. This dress is very similar to the dresses worn by the children on the Proclamation Board (the difference being that Mathinna wears a red dress with a contrasting waistband, the children on the Board wear plain yellow dresses) (Bock). Acknowledging the simplicity of children's clothing during the colonial era, it could still be argued that it would have been unlikely the Governor of the day would have placed a child, enjoying at that time a life of privilege, in a situation where she sat for a portrait wearing an old-fashioned garment. So effective was Hull’s re-imagining of the Board’s creator that the Board was, for many years, popularly known as Governor Davey’s Proclamation to the Aborigines with even the date modified, to 1816, to fit Davey’s term of office. Further, it is worth noting that catalogue records acknowledge the error of attribution and list both Davey and Arthur as men connected to the creation of the Proclamation Board. A Surviving Board: Mitchell Library, State Library of New South Wales One of the surviving Proclamation Boards is held by the Mitchell Library. The Boards, oil on Huon pine, were painted by “convict artists incarcerated in the island penal colony” (Carroll 73). The work was mass produced (by the standards of mass production of the day) by pouncing, “a technique [of the Italian Renaissance] of pricking the contours of a drawing with a pin. Charcoal was then dusted on to the drawing” (Carroll 75-76). The images, once outlined, were painted in oil. Of approximately 100 Boards made, several survive today. There are seven known Boards within public collections (Gall 58): five in Australia (Mitchell Library, State Library of NSW, Sydney; Museum Victoria, Melbourne; National Library of Australia, Canberra; Tasmanian Museum and Art Gallery, Hobart; and Queen Victoria Museum and Art Gallery, Launceston); and two overseas (The Peabody Museum of Archaeology and Ethnology, Harvard University and the Museum of Archaeology and Ethnology, University of Cambridge). The catalogue record, for the Board held by the Mitchell Library, offers the following details:Paintings: 1 oil painting on Huon pine board, rectangular in shape with rounded corners and hole at top centre for suspension ; 35.7 x 22.6 x 1 cm. 4 scenes are depicted:Aborigines and white settlers in European dress mingling harmoniouslyAboriginal men and women, and an Aboriginal child approach Governor Arthur to shake hands while peaceful soldiers look onA hostile Aboriginal man spears a male white settler and is hanged by the military as Governor Arthur looks onA hostile white settler shoots an Aboriginal man and is hanged by the military as Governor Arthur looks on. (SAFE / R 247) The Mitchell Library Board was purchased from J.W. Beattie in May 1919 for £30 (Morris 86), which is approximately $2,200 today. Importantly, the title of the record notes both the popular attribution of the Board and the man who actually instigated the Board’s production: “Governor Davey’s [sic – actually Governor Arthur] Proclamation to the Aborigines, 1816 [sic – actually c. 1828-30].” The date of the Board is still a cause of some speculation. The earlier date, 1828, marks the declaration of martial law (Turnbull 94) and 1830 marks the Black Line (Edmonds 215); the attempt to form a human line of white men to force many Tasmanian Aboriginals, four of the nine nations, onto the Tasman Peninsula (Ryan 3). Frankland’s suggestion for the Board was put forward on 4 February 1829, with Arthur’s official Conciliator to the Aborigines, G.A. Robinson, recording his first sighting of a Board on 24 December 1829 (Morris 84-85). Thus, the conception of the Board may have been in 1828 but the Proclamation project was not fully realised until 1830. Indeed, a news item on the Proclamation Board did appear in the popular press, but not until 5 March 1830: We are informed that the Government have given directions for the painting of a large number of pictures to be placed in the bush for the contemplation of the Aboriginal Inhabitants. […] However […] the causes of their hostility must be more deeply probed, or their taste as connoisseurs in paintings more clearly established, ere we can look for any beneficial result from this measure. (Colonial Times 2) The remark made in relation to becoming a connoisseur of painting, though intended to be derogatory, makes some sense. There was an assumption that the Indigenous peoples could easily translate a European-styled execution by hanging, as a visual metaphor for all forms of punishment. It has long been understood that Indigenous “social organisation and religious and ceremonial life were often as complex as those of the white invaders” (McCulloch 261). However, the Proclamation Board was, in every sense, Eurocentric and made no attempt to acknowledge the complexities of Aboriginal culture. It was, quite simply, never going to be an effective tool of communication, nor achieve its socio-legal aims. The Board Re-imagined: Popular Media The re-imagining of the Proclamation Board as a construct of Governor Davey, instead of Governor Arthur, is just one of many re-imaginings of this curious object. There are, of course, the various imaginings of the purpose of the Board. On the surface these images are a tool for reconciliation but as “the story of these paintings unfolds […] it becomes clear that the proclamations were in effect envoys sent back to Britain to exhibit the ingenious attempts being applied to civilise Australia” (Carroll 76). In this way the Board was re-imagined by the Administration that funded the exercise, even before the project was completed, from a mechanism to assist in the bringing about of peace into an object that would impress colonial superiors. Khadija von Zinnenburg Carroll has recently written about the Boards in the context of their “transnational circulation” and how “objects become subjects and speak of their past through the ventriloquism of contemporary art history” (75). Carroll argues the Board is an item that couples “military strategy with a fine arts propaganda campaign” (Carroll 78). Critically the Boards never achieved their advertised purpose for, as Carroll explains, there were “elaborate rituals Aboriginal Australians had for the dead” and, therefore, “the display of a dead, hanging body is unthinkable. […] being exposed to the sight of a hanged man must have been experienced as an unimaginable act of disrespect” (92). The Proclamation Board would, in sharp contrast to feelings of unimaginable disrespect, inspire feelings of pride across the colonial population. An example of this pride being revealed in the selection of the Board as an object worthy of reproduction, as a lithograph, for an Intercolonial Exhibition, held in Melbourne in 1866 (Morris 84). The lithograph, which identifies the Board as Governor Davey’s Proclamation to the Aborigines and dated 1816, was listed as item 572, of 738 items submitted by Tasmania, for the event (The Commissioners 69-85). This type of reproduction, or re-imagining, of the Board would not be an isolated event. Penelope Edmonds has described the Board as producing a “visual vernacular” through a range of derivatives including lantern slides, lithographs, and postcards. These types of tourist ephemera are in addition to efforts to produce unique re-workings of the Board as seen in Violet Mace’s Proclamation glazed earthernware, which includes a jug (1928) and a pottery cup (1934) (Edmonds online). The Board Re-imagined: A True Crime Tale The Proclamation Board offers numerous narratives. There is the story that the Board was designed and deployed to communicate. There is the story behind the Board. There is also the story of the credit for the initiative which was transferred from Governor Arthur to Governor Davey and subsequently returned to Arthur. There are, too, the provenance stories of individual Boards. There is another story the Proclamation Board offers. The story of true crime in colonial Australia. The Board, as noted, presents through a four-strip pictogram an idea that all are equal under the rule of law (Arthur 1). Advocating for a society of equals was a duplicitous practice, for while Aborigines were hanged for allegedly murdering settlers, “there is no record of whites being charged, let alone punished, for murdering Aborigines” (Morris 84). It would not be until 1838 that white men would be punished for the murder of Aboriginal people (on the mainland) in the wake of the Myall Creek Massacre, in northern New South Wales. There were other examples of attempts to bring about a greater equity under the rule of law but, as Amanda Nettelbeck explains, there was wide-spread resistance to the investigation and charging of colonists for crimes against the Indigenous population with cases regularly not going to trial, or, if making a courtroom, resulting in an acquittal (355-59). That such cases rested on “legally inadmissible Aboriginal testimony” (Reece in Nettelbeck 358) propped up a justice system that was, inherently, unjust in the nineteenth century. It is important to note that commentators at the time did allude to the crime narrative of the Board: when in the most civilized country in the world it has been found ineffective as example to hang murderers in chains, it is not to be expected a savage race will be influenced by the milder exhibition of effigy and caricature. (Colonial Times 2) It is argued here that the Board was much more than an offering of effigy and caricature. The Proclamation Board presents, in striking detail, the formula for the modern true crime tale: a peace disturbed by the act of murder; and the ensuing search for, and delivery of, justice. Reinforcing this point, are the ideas of justice seen within crime fiction, a genre that focuses on the restoration of order out of chaos (James 174), are made visible here as aspirational. The true crime tale does not, consistently, offer the reassurances found within crime fiction. In the real world, particularly one as violent as colonial Australia, we are forced to acknowledge that, below the surface of the official rhetoric on justice and crime, the guilty often go free and the innocent are sometimes hanged. Another point of note is that, if the latter date offered here, of 1830, is taken as the official date of the production of these Boards, then the significance of the Proclamation Board as a true crime tale is even more pronounced through a connection to crime fiction (both genres sharing a common literary heritage). The year 1830 marks the release of Australia’s first novel, Quintus Servinton written by convicted forger Henry Savery, a crime novel (produced in three volumes) published by Henry Melville of Hobart Town. Thus, this paper suggests, 1830 can be posited as a year that witnessed the production of two significant cultural artefacts, the Proclamation Board and the nation’s first full-length literary work, as also being the year that established the, now indomitable, traditions of true crime and crime fiction in Australia. Conclusion During the late 1820s in Van Diemen’s Land (now Tasmania) a set of approximately 100 Proclamation Boards were produced by the Lieutenant Governor of the day, George Arthur. The official purpose of these items was to communicate, to the Indigenous peoples of the island colony, that all—black and white—were equal under the law. Murderers, be they Aboriginal or colonist, would be punished. The Board is a re-imagining of one of the traditional methods of communication for Indigenous peoples; the leaving of drawings on the bark of trees. The Board was, in the 1860s, in time for an Intercolonial Exhibition, re-imagined as the output of Lieutenant Governor Davey. This re-imagining of the Board was so effective that surviving artefacts, today, are popularly known as Governor Davey’s Proclamation to the Aborigines with the date modified, to 1816, to fit the new narrative. The Proclamation Board was also reimagined, by its creators and consumers, in a variety of ways: as peace offering; military propaganda; exhibition object; tourism ephemera; and contemporary art. This paper has also, briefly, offered another re-imagining of the Board, positing that this early “pamphlet” on justice and punishment actually presents a pre-cursor to the modern Australian true crime tale. The Proclamation Board tells many stories but, at the core of this curious object, is a crime story: the story of mass murder. Acknowledgements The author acknowledges the Palawa peoples: the traditional custodians of the lands known today as Tasmania. The author acknowledges, too, the Gadigal people of the Eora nation upon whose lands this paper was researched and written. The author extends thanks to Richard Neville, Margot Riley, Kirsten Thorpe, and Justine Wilson of the State Library of New South Wales for sharing their knowledge and offering their support. The author is also grateful to the reviewers for their careful reading of the manuscript and for making valuable suggestions. ReferencesAboriginal Heritage Tasmania. “Scarred Trees.” Aboriginal Cultural Heritage, 2012. 12 Sep. 2015 ‹http://www.aboriginalheritage.tas.gov.au/aboriginal-cultural-heritage/archaeological-site-types/scarred-trees›.Arthur, George. “Proclamation.” The Hobart Town Courier 19 Apr. 1828: 1.———. Governor Davey’s [sic – actually Governor Arthur’s] Proclamation to the Aborigines, 1816 [sic – actually c. 1828-30]. Graphic Materials. Sydney: Mitchell Library, State Library of NSW, c. 1828-30.Bock, Thomas. Mathinna. Watercolour and Gouache on Paper. 23 x 19 cm (oval), c. 1840.Carroll, Khadija von Zinnenburg. Art in the Time of Colony: Empires and the Making of the Modern World, 1650-2000. Farnham, UK: Ashgate Publishing, 2014.Clark, Manning. History of Australia. Abridged by Michael Cathcart. Melbourne: Melbourne University Press, 1997 [1993]. Clements, Nicholas. The Black War: Fear, Sex and Resistance in Tasmania. St Lucia, Qld.: U of Queensland P, 2014.Colonial Times. “Hobart Town.” Colonial Times 5 Mar. 1830: 2.The Commissioners. Intercolonial Exhibition Official Catalogue. 2nd ed. Melbourne: Blundell & Ford, 1866.Darian-Smith, Kate, and Penelope Edmonds. “Conciliation on Colonial Frontiers.” Conciliation on Colonial Frontiers: Conflict, Performance and Commemoration in Australia and the Pacific Rim. Eds. Kate Darian-Smith and Penelope Edmonds. New York: Routledge, 2015. 1–14. Edmonds, Penelope. “‘Failing in Every Endeavour to Conciliate’: Governor Arthur’s Proclamation Boards to the Aborigines, Australian Conciliation Narratives and Their Transnational Connections.” Journal of Australian Studies 35.2 (2011): 201–18.———. “The Proclamation Cup: Tasmanian Potter Violet Mace and Colonial Quotations.” reCollections 5.2 (2010). 20 May 2015 ‹http://recollections.nma.gov.au/issues/vol_5_no_2/papers/the_proclamation_cup_›.Felton, Heather. “Mathinna.” Companion to Tasmanian History. Hobart: Centre for Tasmanian Historical Studies, University of Tasmania, 2006. 29 Sep. 2015 ‹http://www.utas.edu.au/library/companion_to_tasmanian_history/M/Mathinna.htm›.Gall, Jennifer. Library of Dreams: Treasures from the National Library of Australia. Canberra: National Library of Australia, 2011.Hull, Hugh M. “Tasmanian Hieroglyphics.” The Hobart Mercury 26 Nov. 1874: 3.James, P.D. Talking about Detective Fiction. New York: Alfred A. Knopf, 2009.Mace, Violet. Violet Mace’s Proclamation Jug. Glazed Earthernware. Launceston: Queen Victoria Museum and Art Gallery, 1928.———. Violet Mace’s Proclamation Cup. Glazed Earthernware. Canberra: National Museum of Australia, 1934.McCulloch, Samuel Clyde. “Sir George Gipps and Eastern Australia’s Policy toward the Aborigine, 1838-46.” The Journal of Modern History 33.3 (1961): 261–69.Morris, John. “Notes on a Message to the Tasmanian Aborigines in 1829, popularly called ‘Governor Davey’s Proclamation to the Aborigines, 1816’.” Australiana 10.3 (1988): 84–7.Nettelbeck, Amanda. “‘Equals of the White Man’: Prosecution of Settlers for Violence against Aboriginal Subjects of the Crown, Colonial Western Australia.” Law and History Review 31.2 (2013): 355–90.Newman, Terry. “Tasmania, the Name.” Companion to Tasmanian History, 2006. 16 Sep. 2015 ‹http://www.utas.edu.au/library/companion_to_tasmanian_history/T/Tasmania%20name.htm›.Reece, Robert H.W., in Amanda Nettelbeck. “‘Equals of the White Man’: Prosecution of Settlers for Violence against Aboriginal Subjects of the Crown, Colonial Western Australia.” Law and History Review 31.2 (2013): 355–90.Ryan, Lyndall. “The Black Line in Van Diemen’s Land: Success or Failure?” Journal of Australian Studies 37.1 (2013): 3–18.Savery, Henry. Quintus Servinton: A Tale Founded upon Events of Real Occurrence. Hobart Town: Henry Melville, 1830.Turnbull, Clive. Black War: The Extermination of the Tasmanian Aborigines. Melbourne: Sun Books, 1974 [1948].

APA, Harvard, Vancouver, ISO, and other styles

35

Brien, Donna Lee. "Demon Monsters or Misunderstood Casualties?" M/C Journal 24, no.5 (October5, 2021). http://dx.doi.org/10.5204/mcj.2845.

Full text

Abstract:

Over the past century, many books for general readers have styled sharks as “monsters of the deep” (Steele). In recent decades, however, at least some writers have also turned to representing how sharks are seriously threatened by human activities. At a time when media coverage of shark sightings seems ever increasing in Australia, scholarship has begun to consider people’s attitudes to sharks and how these are formed, investigating the representation of sharks (Peschak; Ostrovski et al.) in films (Le Busque and Litchfield; Neff; Schwanebeck), newspaper reports (Muter et al.), and social media (Le Busque et al., “An Analysis”). My own research into representations of surfing and sharks in Australian writing (Brien) has, however, revealed that, although reporting of shark sightings and human-shark interactions are prominent in the news, and sharks function as vivid and commanding images and metaphors in art and writing (Ellis; Westbrook et al.), little scholarship has investigated their representation in Australian books published for a general readership. While recognising representations of sharks in other book-length narrative forms in Australia, including Australian fiction, poetry, and film (Ryan and Ellison), this enquiry is focussed on non-fiction books for general readers, to provide an initial review. Sampling holdings of non-fiction books in the National Library of Australia, crosschecked with Google Books, in early 2021, this investigation identified 50 Australian books for general readers that are principally about sharks, or that feature attitudes to them, published from 1911 to 2021. Although not seeking to capture all Australian non-fiction books for general readers that feature sharks, the sampling attempted to locate a wide range of representations and genres across the time frame from the earliest identified text until the time of the survey. The books located include works of natural and popular history, travel writing, memoir, biography, humour, and other long-form non-fiction for adult and younger readers, including hybrid works. A thematic analysis (Guest et al.) of the representation of sharks in these texts identified five themes that moved from understanding sharks as fishes to seeing them as monsters, then prey, and finally to endangered species needing conservation. Many books contained more than one theme, and not all examples identified have been quoted in the discussion of the themes below. Sharks as Part of the Natural Environment Drawing on oral histories passed through generations, two memoirs (Bradley et al.; Fossa) narrate Indigenous stories in which sharks play a central role. These reveal that sharks are part of both the world and a wider cosmology for Aboriginal and Torres Strait Islander people (Clua and Guiart). In these representations, sharks are integrated with, and integral to, Indigenous life, with one writer suggesting they are “creator beings, ancestors, totems. Their lifecycles reflect the seasons, the landscape and sea country. They are seen in the movement of the stars” (Allam). A series of natural history narratives focus on zoological studies of Australian sharks, describing shark species and their anatomy and physiology, as well as discussing shark genetics, behaviour, habitats, and distribution. A foundational and relatively early Australian example is Gilbert P. Whitley’s The Fishes of Australia: The Sharks, Rays, Devil-fish, and Other Primitive Fishes of Australia and New Zealand, published in 1940. Ichthyologist at the Australian Museum in Sydney from the early 1920s to 1964, Whitley authored several books which furthered scientific thought on sharks. Four editions of his Australian Sharks were published between 1983 and 1991 in English, and the book is still held in many libraries and other collections worldwide. In this text, Whitley described a wide variety of sharks, noting shared as well as individual features. Beautiful drawings contribute information on shape, colouring, markings, and other recognisable features to assist with correct identification. Although a scientist and a Fellow and then President of the Royal Zoological Society of New South Wales, Whitley recognised it was important to communicate with general readers and his books are accessible, the prose crisp and clear. Books published after this text (Aiken; Ayling; Last and Stevens; Tricas and Carwardine) share Whitley’s regard for the diversity of sharks as well as his desire to educate a general readership. By 2002, the CSIRO’s Field Guide to Australian Sharks & Rays (Daley et al.) also featured numerous striking photographs of these creatures. Titles such as Australia’s Amazing Sharks (Australian Geographic) emphasise sharks’ unique qualities, including their agility and speed in the water, sensitive sight and smell, and ability to detect changes in water pressure around them, heal rapidly, and replace their teeth. These books also emphasise the central role that sharks play in the marine ecosystem. There are also such field guides to sharks in specific parts of Australia (Allen). This attention to disseminating accurate zoological information about sharks is also evident in books written for younger readers including very young children (Berkes; Kear; Parker and Parker). In these and other similar books, sharks are imaged as a central and vital component of the ocean environment, and the narratives focus on their features and qualities as wondrous rather than monstrous. Sharks as Predatory Monsters A number of books for general readers do, however, image sharks as monsters. In 1911, in his travel narrative Peeps at Many Lands: Australia, Frank Fox describes sharks as “the most dangerous foes of man in Australia” (23) and many books have reinforced this view over the following century. This can be seen in titles that refer to sharks as dangerous predatory killers (Fox and Ruhen; Goadby; Reid; Riley; Sharpe; Taylor and Taylor). The covers of a large proportion of such books feature sharks emerging from the water, jaws wide open in explicit homage to the imaging of the monster shark in the film Jaws (Spielberg). Shark!: Killer Tales from the Dangerous Depths (Reid) is characteristic of books that portray encounters with sharks as terrifying and dramatic, using emotive language and stories that describe sharks as “the world’s most feared sea creature” (47) because they are such “highly efficient killing machines” (iv, see also 127, 129). This representation of sharks is also common in several books for younger readers (Moriarty; Rohr). Although the risk of being injured by an unprovoked shark is extremely low (Chapman; Fletcher et al.), fear of sharks is prevalent and real (Le Busque et al., “People’s Fear”) and described in a number of these texts. Several of the memoirs located describe surfers’ fear of sharks (Muirhead; Orgias), as do those of swimmers, divers, and other frequent users of the sea (Denness; de Gelder; McAloon), even if the author has never encountered a shark in the wild. In these texts, this fear of sharks is often traced to viewing Jaws, and especially to how the film’s huge, bloodthirsty great white shark persistently and determinedly attacks its human hunters. Pioneer Australian shark expert Valerie Taylor describes such great white sharks as “very big, powerful … and amazingly beautiful” but accurately notes that “revenge is not part of their thought process” (Kindle version). Two books explicitly seek to map and explain Australians’ fear of sharks. In Sharks: A History of Fear in Australia, Callum Denness charts this fear across time, beginning with his own “shark story”: a panicked, terror-filled evacuation from the sea, following the sighting of a shadow which turned out not to be a shark. Blake Chapman’s Shark Attacks: Myths, Misunderstandings and Human Fears explains commonly held fearful perceptions of sharks. Acknowledging that sharks are a “highly emotive topic”, the author of this text does not deny “the terror [that] they invoke in our psyche” but makes a case that this is “only a minor characteristic of what makes them such intriguing animals” (ix). In Death by Coconut: 50 Things More Dangerous than a Shark and Why You Shouldn’t Be Afraid of the Ocean, Ruby Ashby Orr utilises humour to educate younger readers about the real risk humans face from sharks and, as per the book’s title, why they should not be feared, listing champagne corks and falling coconuts among the many everyday activities more likely to lead to injury and death in Australia than encountering a shark. Taylor goes further in her memoir – not only describing her wonder at swimming with these creatures, but also her calm acceptance of the possibility of being injured by a shark: "if we are to be bitten, then we are to be bitten … . One must choose a life of adventure, and of mystery and discovery, but with that choice, one must also choose the attendant risks" (2019: Kindle version). Such an attitude is very rare in the books located, with even some of the most positive about these sea creatures still quite sensibly fearful of potentially dangerous encounters with them. Sharks as Prey There is a long history of sharks being fished in Australia (Clark). The killing of sharks for sport is detailed in An American Angler in Australia, which describes popular adventure writer Zane Grey’s visit to Australia and New Zealand in the 1930s to fish ‘big game’. This text includes many bloody accounts of killing sharks, which are justified with explanations about how sharks are dangerous. It is also illustrated with gruesome pictures of dead sharks. Australian fisher Alf Dean’s biography describes him as the “World’s Greatest Shark Hunter” (Thiele), this text similarly illustrated with photographs of some of the gigantic sharks he caught and killed in the second half of the twentieth century. Apart from being killed during pleasure and sport fishing, sharks are also hunted by spearfishers. Valerie Taylor and her late husband, Ron Taylor, are well known in Australia and internationally as shark experts, but they began their careers as spearfishers and shark hunters (Taylor, Ron Taylor’s), with the documentary Shark Hunters gruesomely detailing their killing of many sharks. The couple have produced several books that recount their close encounters with sharks (Taylor; Taylor, Taylor and Goadby; Taylor and Taylor), charting their movement from killers to conservationists as they learned more about the ocean and its inhabitants. Now a passionate campaigner against the past butchery she participated in, Taylor’s memoir describes her shift to a more respectful relationship with sharks, driven by her desire to understand and protect them. In Australia, the culling of sharks is supposedly carried out to ensure human safety in the ocean, although this practice has long been questioned. In 1983, for instance, Whitley noted the “indiscriminate” killing of grey nurse sharks, despite this species largely being very docile and of little threat to people (Australian Sharks, 10). This is repeated by Tony Ayling twenty-five years later who adds the information that the generally harmless grey nurse sharks have been killed to the point of extinction, as it was wrongly believed they preyed on surfers and swimmers. Shark researcher and conservationist Riley Elliott, author of Shark Man: One Kiwi Man’s Mission to Save Our Most Feared and Misunderstood Predator (2014), includes an extremely critical chapter on Western Australian shark ‘management’ through culling, summing up the problems associated with this approach: it seems to me that this cull involved no science or logic, just waste and politics. It’s sickening that the people behind this cull were the Fisheries department, which prior to this was the very department responsible for setting up the world’s best acoustic tagging system for sharks. (Kindle version, Chapter 7) Describing sharks as “misunderstood creatures”, Orr is also clear in her opposition to killing sharks to ‘protect’ swimmers noting that “each year only around 10 people are killed in shark attacks worldwide, while around 73 million sharks are killed by humans”. She adds the question and answer, “sounds unfair? Of course it is, but when an attack is all over the news and the people are baying for shark blood, it’s easy to lose perspective. But culling them? Seriously?” (back cover). The condemnation of culling is also evident in David Brooks’s recent essay on the topic in his collection of essays about animal welfare, conservation and the relationship between humans and other species, Animal Dreams. This disapproval is also evident in narratives by those who have been injured by sharks. Navy diver Paul de Gelder and surfer Glen Orgias were both bitten by sharks in Sydney in 2009 and both their memoirs detail their fear of sharks and the pain they suffered from these interactions and their lengthy recoveries. However, despite their undoubted suffering – both men lost limbs due to these encounters – they also attest to their ongoing respect for these creatures and specify a shared desire not to see them culled. Orgias, instead, charts the life story of the shark who bit him alongside his own story in his memoir, musing at the end of the book, not about himself or his injury, but about the fate of the shark he had encountered: great whites are portrayed … as pathological creatures, and as malevolent. That’s rubbish … they are graceful, mighty beasts. I respect them, and fear them … [but] the thought of them fighting, dying, in a net upsets me. I hope this great white shark doesn’t end up like that. (271–271) Several of the more recent books identified in this study acknowledge that, despite growing understanding of sharks, the popular press and many policy makers continue to advocate for shark culls, these calls especially vocal after a shark-related human death or injury (Peppin-Neff). The damage to shark species involved caused by their killing – either directly by fishing, spearing, finning, or otherwise hunting them, or inadvertently as they become caught in nets or affected by human pollution of the ocean – is discussed in many of the more recent books identified in this study. Sharks as Endangered Alongside fishing, finning, and hunting, human actions and their effects such as beach netting, pollution and habitat change are killing many sharks, to the point where many shark species are threatened. Several recent books follow Orr in noting that an estimated 100 million sharks are now killed annually across the globe and that this, as well as changes to their habitats, are driving many shark species to the status of vulnerable, threatened or towards extinction (Dulvy et al.). This is detailed in texts about biodiversity and climate change in Australia (Steffen et al.) as well as in many of the zoologically focussed books discussed above under the theme of “Sharks as part of the natural environment”. The CSIRO’s Field Guide to Australian Sharks & Rays (Daley et al.), for example, emphasises not only that several shark species are under threat (and protected) (8–9) but also that sharks are, as individuals, themselves very fragile creatures. Their skeletons are made from flexible, soft cartilage rather than bone, meaning that although they are “often thought of as being incredibly tough; in reality, they need to be handled carefully to maximise their chance of survival following capture” (9). Material on this theme is included in books for younger readers on Australia’s endangered animals (Bourke; Roc and Hawke). Shark Conservation By 1991, shark conservation in Australia and overseas was a topic of serious discussion in Sydney, with an international workshop on the subject held at Taronga Zoo and the proceedings published (Pepperell et al.). Since then, the movement to protect sharks has grown, with marine scientists, high-profile figures and other writers promoting shark conservation, especially through attempts to educate the general public about sharks. De Gelder’s memoir, for instance, describes how he now champions sharks, promoting shark conservation in his work as a public speaker. Peter Benchley, who (with Carl Gottlieb) recast his novel Jaws for the film’s screenplay, later attested to regretting his portrayal of sharks as aggressive and became a prominent spokesperson for shark conservation. In explaining his change of heart, he stated that when he wrote the novel, he was reflecting the general belief that sharks would both seek out human prey and attack boats, but he later discovered this to be untrue (Benchley, “Without Malice”). Many recent books about sharks for younger readers convey a conservation message, underscoring how, instead of fearing or killing sharks, or doing nothing, humans need to actively assist these vulnerable creatures to survive. In the children’s book series featuring Bindi Irwin and her “wildlife adventures”, there is a volume where Bindi and a friend are on a diving holiday when they find a dead shark whose fin has been removed. The book not only describes how shark finning is illegal, but also how Bindi and friend are “determined to bring the culprits to justice” (Browne). This narrative, like the other books in this series, has a dual focus; highlighting the beauty of wildlife and its value, but also how the creatures described need protection and assistance. Concluding Discussion This study was prompted by the understanding that the Earth is currently in the epoch known as the Anthropocene, a time in which humans have significantly altered, and continue to alter, the Earth by our activities (Myers), resulting in numerous species becoming threatened, endangered, or extinct. It acknowledges the pressing need for not only natural science research on these actions and their effects, but also for such scientists to publish their findings in more accessible ways (see, Paulin and Green). It specifically responds to demands for scholarship outside the relevant areas of science and conservation to encourage widespread thinking and action (Mascia et al.; Bennett et al.). As understanding public perceptions and overcoming widely held fear of sharks can facilitate their conservation (Panoch and Pearson), the way sharks are imaged is integral to their survival. The five themes identified in this study reveal vastly different ways of viewing and writing about sharks. These range from seeing sharks as nothing more than large fishes to be killed for pleasure, to viewing them as terrifying monsters, to finally understanding that they are amazing creatures who play an important role in the world’s environment and are in urgent need of conservation. This range of representation is important, for if sharks are understood as demon monsters which hunt humans, then it is much more ‘reasonable’ to not care about their future than if they are understood to be fascinating and fragile creatures suffering from their interactions with humans and our effect on the environment. Further research could conduct a textual analysis of these books. In this context, it is interesting to note that, although in 1949 C. Bede Maxwell suggested describing human deaths and injuries from sharks as “accidents” (182) and in 2013 Christopher Neff and Robert Hueter proposed using “sightings, encounters, bites, and the rare cases of fatal bites” (70) to accurately represent “the true risk posed by sharks” to humans (70), the majority of the books in this study, like mass media reports, continue to use the ubiquitous and more dramatic terminology of “shark attack”. The books identified in this analysis could also be compared with international texts to reveal and investigate global similarities and differences. While the focus of this discussion has been on non-fiction texts, a companion analysis of representation of sharks in Australian fiction, poetry, films, and other narratives could also be undertaken, in the hope that such investigations contribute to more nuanced understandings of these majestic sea creatures. References Aitken, Kelvin. Sharks & Rays of Australia. New Holland, 1998. Allam, Lorena. “Indigenous Cultural Views of the Shark.” Earshot, ABC Radio, 24 Sep. 2015. 1 Mar. 2021 <https://www.abc.net.au/radionational/programs/earshot/indigenous-cultural-views-of-the-shark/6798174>. Allen, Gerald R. Field Guide to Marine Fishes of Tropical Australia and South-East Asia. 4th ed. Welshpool: Western Australian Museum, 2009. Australian Geographic. Australia’s Amazing Sharks. Bauer Media, 2020. Ayling, Tony. Sharks & Rays. Steve Parish, 2008. Benchley, Peter. Jaws. New York: Doubleday, 1974. Benchley, Peter. “Without Malice: In Defence of the Shark.” The Guardian 9 Nov. 2000. 1 Mar. 2021 <https://www.theguardian.com/theguardian/2000/nov/09/features11.g22>. Bennett, Nathan J., Robin Roth, Sarah C. Klain, Kai M.A. Chan, Douglas A. Clark, Georgina Cullman, Graham Epstein, Michael Paul Nelson, Richard Stedman, Tara L. Teel, Rebecca E. W. Thomas, Carina Wyborn, Deborah Curran, Alison Greenberg, John Sandlos, and Diogo Veríssimo. “Mainstreaming the Social Sciences in Conservation.” Conservation Biology 31.1 (2017): 56–66. Berkes, Marianne. Over in Australia: Amazing Animals Down Under. Sourcebooks, 2011. Bourke, Jane. Endangered Species of Australia. Ready-Ed Publications, 2006. Bradley, John, and Yanyuwa Families. Singing Saltwater Country: Journey to the Songlines of Carpentaria. Allen & Unwin, 2010. Brien, Donna Lee. “Surfing with Sharks: A Survey of Australian Non-Fiction Writing about Surfing and Sharks.” TEXT: Journal of Writing and Writing Programs, forthcoming. Brooks, David. Animal Dreams. Sydney: Sydney University Press, 2021. Browne, Ellie. Island Ambush. Random House Australia, 2011. Chapman, Blake. Shark Attacks: Myths, Misunderstandings and Human Fears. CSIRO, 2017. Clark, Anna. The Catch: The Story of Fishing in Australia. National Library of Australia, 2017. Clua, Eric, and Jean Guiart. “Why the Kanak Don’t Fear Sharks: Myths as a Coherent but Dangerous Mirror of Nature.” Oceania 90 (2020): 151–166. Daley, R.K., J.D. Stevens, P.R. Last, and G.R. Yearsly. Field Guide to Australian Sharks & Rays. CSIRO Marine Research, 2002. De Gelder, Paul. No Time For Fear: How a Shark Attack Survivor Beat the Odds. Penguin, 2011. Denness, Callum. Sharks: A History of Fear in Australia. Affirm Press, 2019. Dulvy, Nicholas K., Sarah L. Fowler, John A. Musick, Rachel D. Cavanagh, Peter M. Kyne, Lucy R. Harrison, John K. Carlson, Lindsay N.K. Davidson, Sonja V. Fordham, Malcolm P. Francis, Caroline M. Pollock, Colin A. Simpfendorfer, George H. Burgess, Kent E. Carpenter, Leonard J.V. Compagno, David A. Ebert, Claudine Gibson, Michelle R. Heupel, Suzanne R. Livingstone, Jonnell C. Sanciangco, John D. Stevens, Sarah Valenti, and William T. White. “Extinction Risk and Conservation of the World’s Sharks and Rays.” eLife 3 (2014): e00590. DOI: 10.7554/eLife.00590. Elliott, Riley. Shark Man: One Kiwi Man’s Mission to Save Our Most Feared and Misunderstood Predator. Penguin Random House New Zealand, 2014. Ellis, Richard. Shark: A Visual History. New York: Lyons Press, 2012. Fletcher, Garth L., Erich Ritter, Raid Amin, Kevin Cahn, and Jonathan Lee. “Against Common Assumptions, the World’s Shark Bite Rates are Decreasing.” Journal of Marine Biology 2019: art ID 7184634. <https://doi.org/10.1155/2019/7184634>. Fossa, Ada. Stories, Laughter and Tears Through Bygone Years in Shark Bay. Morrisville, Lulu.com, 2017. Fox, Frank. Peeps at Many Lands: Australia. Adam and Charles Black, 1911. Fox, Rodney, and Olaf Ruhen. Shark Attacks and Adventures with Rodney Fox. O’Neill Wetsuits, 1975. Gerhardt, Karin. Indigenous Knowledge and Cultural Values of Hammerhead Sharks in Northern Australia. James Cook University, 2018. Goadby, Peter. Sharks and Other Predatory Fish of Australia. 2nd ed. Jacaranda Press, 1968. Grey, Zane. An American Angler in Australia. 1st ed. 1937. Derrydale Press, 2002. Guest, Greg, Kathleen M. MacQueen, and Emily E. Namey. Applied Thematic Analysis. Sage, 2012. Jaws. Dir. Steven Spielberg. Universal Pictures, 1975. Kear, Katie. Baby Shark: Adventure Down Under. North Sydney: Puffin/Penguin Random House, 2020. Last, Peter R., and John Donald Stevens. Sharks and Rays of Australia. CSIRO, 2009. Le Busque, Brianna, and Carla Litchfield. “Sharks on Film: An Analysis of How Shark-Human Interactions Are Portrayed in Films.” Human Dimensions of Wildlife (2021). DOI: 10.1080/10871209.2021.1951399. Le Busque, Brianna, Philip Roetman, Jillian Dorrian, and Carla Litchfield. “An Analysis of Australian News and Current Affair Program Coverage of Sharks on Facebook.” Conservation Science and Practice 1.11 (2019): e111. <https://doi.org/10.1111/csp2.111>. Le Busque, Brianna, Philip Roetman, Jillian Dorrian, and Carl Litchfield. “People’s Fear of Sharks: A Qualitative Analysis.” Journal of Environmental Studies and Sciences 11 (2021): 258–265. Lucrezi, Serena, Suria Ellis, and Enrico Gennari. “A Test of Causative and Moderator Effects in Human Perceptions of Sharks, Their Control and Framing.” Marine Policy 109 (2019): art 103687. <https://doi.org/10.1016/j.marpol.2019.103687>. Mascia, Michael B., C. Anne Claus, and Robin Naidoo. “Impacts of Marine Protected Areas on Fishing Communities.” Conservation Biology 24.5 (2010): 1424–1429. Maxwell, C. Bede. Surf: Australians against the Sea. Angus and Robertson, 1949. McAloon, Brendan. Sharks Never Sleep: First-Hand Encounters with Killers of the Sea. Updated ed. Hardie Grant, 2018. Moriarty, Ros. Ten Scared Fish. Sydney, Allen & Unwin, 2012. Muirhead, Desmond. Surfing in Hawaii: A Personal Memoir. Northland, 1962. Muter, Bret A., Meredith L. Gore, Katie S. Gledhill, Christopher Lamont, and Charlie Huveneers. “Australian and U.S. News Media Portrayal of Sharks and Their Conservation.” Conservation Biology 27 (2012): 187–196. Myers, Joe. “What Is the Anthropocene? And Why Does It Matter?” World Economic Forum 31 Aug. 2016. 6 Aug. 2021 <https://www.weforum.org/agenda/2016/08/what-is-the-anthropocene-and-why-does-it-matter>. Neff, Christopher. “The Jaws Effect: How Movie Narratives Are Used to Influence Policy Responses to Shark Bites in Western Australia.” Australian Journal of Political Science 50.1 (2015): 114–127. Neff, Christopher, and Robert Hueter. “Science, Policy, and the Public Discourse of Shark 'Attack': A Proposal for Reclassifying Human–Shark Interactions.” Journal of Environmental Studies and Sciences 3 (2013): 65–73. Orgias, Glenn. Man in a Grey Suit: A Memoir of Surfing, Shark Attack and Survival. Penguin, 2012. Orr, Ruby Ashby. Death by Coconut: 50 Things More Dangerous than a Shark and Why You Shouldn’t Be Afraid of the Ocean. Affirm Press, 2015. Ostrovski, Raquel Lubambo, Guilherme Martins Violante, Mariana Reis de Brito, Jean Louis Valentin, and Marcelo Vianna. “The Media Paradox: Influence on Human Shark Perceptions and Potential Conservation Impacts.” Ethnobiology and Conservation 10.12 (2021): 1–15. Panoch, Rainera, and Elissa L. Pearson. “Humans and Sharks: Changing Public Perceptions and Overcoming Fear to Facilitate Shark Conservation.” Society & Animals 25.1 (2017): 57–76 Parker Steve, and Jane Parker. The Encyclopedia of Sharks. Universal International, 1999. Paulin, Mike, and David Green. “Mostly Harmless: Sharks We Have Met.” Junctures 19 (2018): 117–122. Pepin-Neff, Christopher L. Flaws: Shark Bites and Emotional Public Policymaking. Palgrave Macmilliam, 2019. Pepperell, Julian, John West, and Peter Woon, eds. Shark Conservation: Proceedings of an International Workshop on the Conservation of Elasmobranchs Held at Taronga Zoo, Sydney, Australia, 24 February 1991. Zoological Parks Board of New South Wales, 1993. Peschak, Thomas P. “Sharks and Shark Bites in the Media.” Finding a Balance: White Shark Conservation and Recreational Safety in the Inshore Waters of Cape Town, South Africa. Eds. Deon C. Nel and Thomas P. Peschak. Cape Town: World Wildlife Fund, 2006. 159–163. Reid, Robert. Shark!: Killer Tales from the Dangerous Depths. Allen & Unwin Kindle version, 2010. Riley, Kathy. Australia’s Most Dangerous Sharks. Australian Geographic, 2013. Roc, Margaret, and Kathleen Hawke. Australia’s Critically Endangered Animals. Heinemann Library, 2006. Rohr, Ian. Snappers, Stingers and Stabbers of Australia. Young Reed, 2006. Royal Zoological Society of New South Wales. “RZS NSW Fellows.” 2021. 6 Aug. 2021 <https://www.rzsnsw.org.au/about-us/rzs-nsw-fellows/rzs-nsw-fellows>. Ryan, Mark David, and Elizabeth Ellison. “Beaches in Australian Horror Films: Sites of Fear and Retreat.” Writing the Australian Beach Local Site, Global Idea. Eds. Elizabeth Ellison and Donna Lee Brien. Palgrave/Springer, 2020. 125–141. Schwanebeck, Wieland, ed. Der Weisse Hai revisited: Steven Spielberg’s Jaws und die Geburt eines amerikanischen Albtraums. Bertz & Fischer, 2015. Shark Hunters. Dirs. Ben Cropp and Ron Tayor. Sydney, 1962. Sharpe, Alan. Shark Down Under: The History Shark Attacks in Australian Waters. Dominion Publishing, 1976. Steele, Philip. Sharks and Other Monsters of the Deep. London: DK, 1998. Steffen, Will, Andrew A. Burbidge, Lesley Hughes, Roger Kitching, David Lindenmayer, Warren Musgrave, Mark Stafford Smith, and Patricia A. Werner. Australia’s Biodiversity and Climate Change. CSIRO Publishing, 2009. Taylor, Ron. Ron Taylor’s Shark Fighters: Underwater in Colour. John Harding Underwater Promotions, 1965. Taylor, Ron, and Valerie Taylor. Sharks: Silent Hunters of the Deep. Reader’s Digest, 1990. Taylor, Ron, Valerie Taylor, and Peter Goadby, eds. Great Shark Stories. Harper & Row, 1978. Repub. 1986 and 2000. Taylor, Valerie. Valerie Taylor: An Adventurous Life. Hachette Australia, 2019. Thiele, Colin. Maneater Man: Alf Dean, the World’s Greatest Shark Hunter. Rigby, 1979. Tricas, Timothy C., and Mark Carwardine. Sharks and Whales. Five Mile Press, 2002 Westbrook, Vivienne R., Shaun Collin, Dean Crawford, and Mark Nicholls. Sharks in the Arts: From Feared to Revered. Routledge, 2018. Whitley, Gilbert Percy. The Fishes of Australia: The Sharks, Rays, Devil-Fish, and other Primitive Fishes of Australia and New Zealand. Royal Zoological Society of New South Wales, 1940. Whitley, Gilbert Percy. Australian Sharks. Lloyd O’Neil, 1983.

APA, Harvard, Vancouver, ISO, and other styles

36

Dwyer, Tim. "Transformations." M/C Journal 7, no.2 (March1, 2004). http://dx.doi.org/10.5204/mcj.2339.

Full text

Abstract:

The Australian Government has been actively evaluating how best to merge the functions of the Australian Communications Authority (ACA) and the Australian Broadcasting Authority (ABA) for around two years now. Broadly, the reason for this is an attempt to keep pace with the communications media transformations we reduce to the term “convergence.” Mounting pressure for restructuring is emerging as a site of turf contestation: the possibility of a regulatory “one-stop shop” for governments (and some industry players) is an end game of considerable force. But, from a public interest perspective, the case for a converged regulator needs to make sense to audiences using various media, as well as in terms of arguments about global, industrial, and technological change. This national debate about the institutional reshaping of media regulation is occurring within a wider global context of transformations in social, technological, and politico-economic frameworks of open capital and cultural markets, including the increasing prominence of international economic organisations, corporations, and Free Trade Agreements (FTAs). Although the recently concluded FTA with the US explicitly carves out a right for Australian Governments to make regulatory policy in relation to existing and new media, considerable uncertainty remains as to future regulatory arrangements. A key concern is how a right to intervene in cultural markets will be sustained in the face of cultural, politico-economic, and technological pressures that are reconfiguring creative industries on an international scale. While the right to intervene was retained for the audiovisual sector in the FTA, by contrast, it appears that comparable unilateral rights to intervene will not operate for telecommunications, e-commerce or intellectual property (DFAT). Blurring Boundaries A lack of certainty for audiences is a by-product of industry change, and further blurs regulatory boundaries: new digital media content and overlapping delivering technologies are already a reality for Australia’s media regulators. These hypothetical media usage scenarios indicate how confusion over the appropriate regulatory agency may arise: 1. playing electronic games that use racist language; 2. being subjected to deceptive or misleading pop-up advertising online 3. receiving messaged imagery on your mobile phone that offends, disturbs, or annoys; 4. watching a program like World Idol with SMS voting that subsequently raises charging or billing issues; or 5. watching a new “reality” TV program where products are being promoted with no explicit acknowledgement of the underlying commercial arrangements either during or at the end of the program. These are all instances where, theoretically, regulatory mechanisms are in place that allow individuals to complain and to seek some kind of redress as consumers and citizens. In the last scenario, in commercial television under the sector code, no clear-cut rules exist as to the precise form of the disclosure—as there is (from 2000) in commercial radio. It’s one of a number of issues the peak TV industry lobby Commercial TV Australia (CTVA) is considering in their review of the industry’s code of practice. CTVA have proposed an amendment to the code that will simply formalise the already existing practice . That is, commercial arrangements that assist in the making of a program should be acknowledged either during programs, or in their credits. In my view, this amendment doesn’t go far enough in post “cash for comment” mediascapes (Dwyer). Audiences have a right to expect that broadcasters, production companies and program celebrities are open and transparent with the Australian community about these kinds of arrangements. They need to be far more clearly signposted, and people better informed about their role. In the US, the “Commercial Alert” <http://www.commercialalert.org/> organisation has been lobbying the Federal Communications Commission and the Federal Trade Commission to achieve similar in-program “visual acknowledgements.” The ABA’s Commercial Radio Inquiry (“Cash-for-Comment”) found widespread systemic regulatory failure and introduced three new standards. On that basis, how could a “standstill” response by CTVA, constitute best practice for such a pervasive and influential medium as contemporary commercial television? The World Idol example may lead to confusion for some audiences, who are unsure whether the issues involved relate to broadcasting or telecommunications. In fact, it could be dealt with as a complaint to the Telecommunication Industry Ombudsman (TIO) under an ACA registered, but Australian Communications Industry Forum (ACIF) developed, code of practice. These kind of cross-platform issues may become more vexed in future years from an audience’s perspective, especially if reality formats using on-screen premium rate service numbers invite audiences to participate, by sending MMS (multimedia messaging services) images or short video grabs over wireless networks. The political and cultural implications of this kind of audience interaction, in terms of access, participation, and more generally the symbolic power of media, may perhaps even indicate a longer-term shift in relations with consumers and citizens. In the Internet example, the Australian Competition and Consumer Commission’s (ACCC) Internet advertising jurisdiction would apply—not the ABA’s “co-regulatory” Internet content regime as some may have thought. Although the ACCC deals with complaints relating to Internet advertising, there won’t be much traction for them in a more complex issue that also includes, say, racist or religious bigotry. The DVD example would probably fall between the remits of the Office of Film and Literature Classification’s (OFLC) new “convergent” Guidelines for the Classification of Film and Computer Games and race discrimination legislation administered by the Human Rights and Equal Opportunity Commission (HREOC). The OFLC’s National Classification Scheme is really geared to provide consumer advice on media products that contain sexual and violent imagery or coarse language, rather than issues of racist language. And it’s unlikely that a single person would have the locus standito even apply for a reclassification. It may fall within the jurisdiction of the HREOC depending on whether it was played in public or not. Even then it would probably be considered exempt on free speech grounds as an “artistic work.” Unsolicited, potentially illegal, content transmitted via mobile wireless devices, in particular 3G phones, provide another example of content that falls between the media regulation cracks. It illustrates a potential content policy “turf grab” too. Image-enabled mobile phones create a variety of novel issues for content producers, network operators, regulators, parents and viewers. There is no one government media authority or agency with a remit to deal with this issue. Although it has elements relating to the regulatory activities of the ACA, the ABA, the OFLC, the TIO, and TISSC, the combination of illegal or potentially prohibited content and its carriage over wireless networks positions it outside their current frameworks. The ACA may argue it should have responsibility for this kind of content since: it now enforces the recently enacted Commonwealth anti-Spam laws; has registered an industry code of practice for unsolicited content delivered over wireless networks; is seeking to include ‘adult’ content within premium rate service numbers, and, has been actively involved in consumer education for mobile telephony. It has also worked with TISSC and the ABA in relation to telephone sex information services over voice networks. On the other hand, the ABA would probably argue that it has the relevant expertise for regulating wirelessly transmitted image-content, arising from its experience of Internet and free and subscription TV industries, under co-regulatory codes of practice. The OFLC can also stake its claim for policy and compliance expertise, since the recently implemented Guidelines for Classification of Film and Computer Games were specifically developed to address issues of industry convergence. These Guidelines now underpin the regulation of content across the film, TV, video, subscription TV, computer games and Internet sectors. Reshaping Institutions Debates around the “merged regulator” concept have occurred on and off for at least a decade, with vested interests in agencies and the executive jockeying to stake claims over new turf. On several occasions the debate has been given renewed impetus in the context of ruling conservative parties’ mooted changes to the ownership and control regime. It’s tended to highlight demarcations of remit, informed as they are by historical and legal developments, and the gradual accretion of regulatory cultures. Now the key pressure points for regulatory change include the mere existence of already converged single regulatory structures in those countries with whom we tend to triangulate our policy comparisons—the US, the UK and Canada—increasingly in a context of debates concerning international trade agreements; and, overlaying this, new media formats and devices are complicating existing institutional arrangements and legal frameworks. The Department of Communications, Information Technology & the Arts’s (DCITA) review brief was initially framed as “options for reform in spectrum management,” but was then widened to include “new institutional arrangements” for a converged regulator, to deal with visual content in the latest generation of mobile telephony, and other image-enabled wireless devices (DCITA). No other regulatory agencies appear, at this point, to be actively on the Government’s radar screen (although they previously have been). Were the review to look more inclusively, the ACCC, the OFLC and the specialist telecommunications bodies, the TIO and the TISSC may also be drawn in. Current regulatory arrangements see the ACA delegate responsibility for broadcasting services bands of the radio frequency spectrum to the ABA. In fact, spectrum management is the turf least contested by the regulatory players themselves, although the “convergent regulator” issue provokes considerable angst among powerful incumbent media players. The consensus that exists at a regulatory level can be linked to the scientific convention that holds the radio frequency spectrum is a continuum of electromagnetic bands. In this view, it becomes artificial to sever broadcasting, as “broadcasting services bands” from the other remaining highly diverse communications uses, as occurred from 1992 when the Broadcasting Services Act was introduced. The prospect of new forms of spectrum charging is highly alarming for commercial broadcasters. In a joint submission to the DCITA review, the peak TV and radio industry lobby groups have indicated they will fight tooth and nail to resist new regulatory arrangements that would see a move away from the existing licence fee arrangements. These are paid as a sliding scale percentage of gross earnings that, it has been argued by Julian Thomas and Marion McCutcheon, “do not reflect the amount of spectrum used by a broadcaster, do not reflect the opportunity cost of using the spectrum, and do not provide an incentive for broadcasters to pursue more efficient ways of delivering their services” (6). An economic rationalist logic underpins pressure to modify the spectrum management (and charging) regime, and undoubtedly contributes to the commercial broadcasting industry’s general paranoia about reform. Total revenues collected by the ABA and the ACA between 1997 and 2002 were, respectively, $1423 million and $3644.7 million. Of these sums, using auction mechanisms, the ABA collected $391 million, while the ACA collected some $3 billion. The sale of spectrum that will be returned to the Commonwealth by television broadcasters when analog spectrum is eventually switched off, around the end of the decade, is a salivating prospect for Treasury officials. The large sums that have been successfully raised by the ACA boosts their position in planning discussions for the convergent media regulatory agency. The way in which media outlets and regulators respond to publics is an enduring question for a democratic polity, irrespective of how the product itself has been mediated and accessed. Media regulation and civic responsibility, including frameworks for negotiating consumer and citizen rights, are fundamental democratic rights (Keane; Tambini). The ABA’s Commercial Radio Inquiry (‘cash for comment’) has also reminded us that regulatory frameworks are important at the level of corporate conduct, as well as how they negotiate relations with specific media audiences (Johnson; Turner; Gordon-Smith). Building publicly meaningful regulatory frameworks will be demanding: relationships with audiences are often complex as people are constructed as both consumers and citizens, through marketised media regulation, institutions and more recently, through hybridising program formats (Murdock and Golding; Lumby and Probyn). In TV, we’ve seen the growth of infotainment formats blending entertainment and informational aspects of media consumption. At a deeper level, changes in the regulatory landscape are symptomatic of broader tectonic shifts in the discourses of governance in advanced information economies from the late 1980s onwards, where deregulatory agendas created an increasing reliance on free market, business-oriented solutions to regulation. “Co-regulation” and “self-regulation’ became the preferred mechanisms to more direct state control. Yet, curiously contradicting these market transformations, we continue to witness recurring instances of direct intervention on the basis of censorship rationales (Dwyer and Stockbridge). That digital media content is “converging” between different technologies and modes of delivery is the norm in “new media” regulatory rhetoric. Others critique “visions of techno-glory,” arguing instead for a view that sees fundamental continuities in media technologies (Winston). But the socio-cultural impacts of new media developments surround us: the introduction of multichannel digital and interactive TV (in free-to-air and subscription variants); broadband access in the office and home; wirelessly delivered content and mobility, and, as Jock Given notes, around the corner, there’s the possibility of “an Amazon.Com of movies-on-demand, with the local video and DVD store replaced by online access to a distant server” (90). Taking a longer view of media history, these changes can be seen to be embedded in the global (and local) “innovation frontier” of converging digital media content industries and its transforming modes of delivery and access technologies (QUT/CIRAC/Cutler & Co). The activities of regulatory agencies will continue to be a source of policy rivalry and turf contestation until such time as a convergent regulator is established to the satisfaction of key players. However, there are risks that the benefits of institutional reshaping will not be readily available for either audiences or industry. In the past, the idea that media power and responsibility ought to coexist has been recognised in both the regulation of the media by the state, and the field of communications media analysis (Curran and Seaton; Couldry). But for now, as media industries transform, whatever the eventual institutional configuration, the evolution of media power in neo-liberal market mediascapes will challenge the ongoing capacity for interventions by national governments and their agencies. Works Cited Australian Broadcasting Authority. Commercial Radio Inquiry: Final Report of the Australian Broadcasting Authority. Sydney: ABA, 2000. Australian Communications Information Forum. Industry Code: Short Message Service (SMS) Issues. Dec. 2002. 8 Mar. 2004 <http://www.acif.org.au/__data/page/3235/C580_Dec_2002_ACA.pdf >. Commercial Television Australia. Draft Commercial Television Industry Code of Practice. Aug. 2003. 8 Mar. 2004 <http://www.ctva.com.au/control.cfm?page=codereview&pageID=171&menucat=1.2.110.171&Level=3>. Couldry, Nick. The Place of Media Power: Pilgrims and Witnesses of the Media Age. London: Routledge, 2000. Curran, James, and Jean Seaton. Power without Responsibility: The Press, Broadcasting and New Media in Britain. 6th ed. London: Routledge, 2003. Dept. of Communication, Information Technology and the Arts. Options for Structural Reform in Spectrum Management. Canberra: DCITA, Aug. 2002. ---. Proposal for New Institutional Arrangements for the ACA and the ABA. Aug. 2003. 8 Mar. 2004 <http://www.dcita.gov.au/Article/0,,0_1-2_1-4_116552,00.php>. Dept. of Foreign Affairs and Trade. Australia-United States Free Trade Agreement. Feb. 2004. 8 Mar. 2004 <http://www.dfat.gov.au/trade/negotiations/us_fta/outcomes/11_audio_visual.php>. Dwyer, Tim. Submission to Commercial Television Australia’s Review of the Commercial Television Industry’s Code of Practice. Sept. 2003. Dwyer, Tim, and Sally Stockbridge. “Putting Violence to Work in New Media Policies: Trends in Australian Internet, Computer Game and Video Regulation.” New Media and Society 1.2 (1999): 227-49. Given, Jock. America’s Pie: Trade and Culture After 9/11. Sydney: U of NSW P, 2003. Gordon-Smith, Michael. “Media Ethics After Cash-for-Comment.” The Media and Communications in Australia. Ed. Stuart Cunningham and Graeme Turner. Sydney: Allen and Unwin, 2002. Johnson, Rob. Cash-for-Comment: The Seduction of Journo Culture. Sydney: Pluto, 2000. Keane, John. The Media and Democracy. Cambridge: Polity, 1991. Lumby, Cathy, and Elspeth Probyn, eds. Remote Control: New Media, New Ethics. Melbourne: Cambridge UP, 2003. Murdock, Graham, and Peter Golding. “Information Poverty and Political Inequality: Citizenship in the Age of Privatized Communications.” Journal of Communication 39.3 (1991): 180-95. QUT, CIRAC, and Cutler & Co. Research and Innovation Systems in the Production of Digital Content and Applications: Report for the National Office for the Information Economy. Canberra: Commonwealth of Australia, Sept. 2003. Tambini, Damian. Universal Access: A Realistic View. IPPR/Citizens Online Research Publication 1. London: IPPR, 2000. Thomas, Julian and Marion McCutcheon. “Is Broadcasting Special? Charging for Spectrum.” Conference paper. ABA conference, Canberra. May 2003. Turner, Graeme. “Talkback, Advertising and Journalism: A cautionary tale of self-regulated radio”. International Journal of Cultural Studies 3.2 (2000): 247-255. ---. “Reshaping Australian Institutions: Popular Culture, the Market and the Public Sphere.” Culture in Australia: Policies, Publics and Programs. Ed. Tony Bennett and David Carter. Melbourne: Cambridge UP, 2001. Winston, Brian. Media, Technology and Society: A History from the Telegraph to the Internet. London: Routledge, 1998. Web Links http://www.aba.gov.au http://www.aca.gov.au http://www.accc.gov.au http://www.acif.org.au http://www.adma.com.au http://www.ctva.com.au http://www.crtc.gc.ca http://www.dcita.com.au http://www.dfat.gov.au http://www.fcc.gov http://www.ippr.org.uk http://www.ofcom.org.uk http://www.oflc.gov.au Links http://www.commercialalert.org/ Citation reference for this article MLA Style Dwyer, Tim. "Transformations" M/C: A Journal of Media and Culture <http://www.media-culture.org.au/0403/06-transformations.php>. APA Style Dwyer, T. (2004, Mar17). Transformations. M/C: A Journal of Media and Culture, 7, <http://www.media-culture.org.au/0403/06-transformations.php>

APA, Harvard, Vancouver, ISO, and other styles

37

Colvin, Neroli. "Resettlement as Rebirth: How Effective Are the Midwives?" M/C Journal 16, no.5 (August21, 2013). http://dx.doi.org/10.5204/mcj.706.

Full text

Abstract:

“Human beings are not born once and for all on the day their mothers give birth to them [...] life obliges them over and over again to give birth to themselves.” (Garcia Marquez 165) Introduction The refugee experience is, at heart, one of rebirth. Just as becoming a new, distinctive being—biological birth—necessarily involves the physical separation of mother and infant, so becoming a refugee entails separation from a "mother country." This mother country may or may not be a recognised nation state; the point is that the refugee transitions from physical connectedness to separation, from insider to outsider, from endemic to alien. Like babies, refugees may have little control over the timing and conditions of their expulsion. Successful resettlement requires not one rebirth but multiple rebirths—resettlement is a lifelong process (Layton)—which in turn require hope, imagination, and energy. In rebirthing themselves over and over again, people who have fled or been forced from their homelands become both mother and child. They do not go through this rebirthing alone. A range of agencies and individuals may be there to assist, including immigration officials, settlement services, schools and teachers, employment agencies and employers, English as a Second Language (ESL) resources and instructors, health-care providers, counsellors, diasporic networks, neighbours, church groups, and other community organisations. The nature, intensity, and duration of these “midwives’” interventions—and when they occur and in what combinations—vary hugely from place to place and from person to person, but there is clear evidence that post-migration experiences have a significant impact on settlement outcomes (Fozdar and Hartley). This paper draws on qualitative research I did in 2012 in a regional town in New South Wales to illuminate some of the ways in which settlement aides ease, or impede, refugees’ rebirth as fully recognised and participating Australians. I begin by considering what it means to be resilient before tracing some of the dimensions of the resettlement process. In doing so, I draw on data from interviews and focus groups with former refugees, service providers, and other residents of the town I shall call Easthaven. First, though, a word about Easthaven. As is the case in many rural and regional parts of Australia, Easthaven’s population is strongly dominated by Anglo Celtic and Saxon ancestries: 2011 Census data show that more than 80 per cent of residents were born in Australia (compared with a national figure of 69.8 per cent) and about 90 per cent speak only English at home (76.8 per cent). Almost twice as many people identify as Aboriginal or Torres Strait Islander as the national figure of 2.5 per cent (Australian Bureau of Statistics). For several years Easthaven has been an official “Refugee Welcome Zone”, welcoming hundreds of refugees from diverse countries in Africa and the Middle East as well as from Myanmar. This reflects the Department of Immigration and Citizenship’s drive to settle a fifth of Australia’s 13,750 humanitarian entrants a year directly in regional areas. In Easthaven’s schools—which is where I focused my research—almost all of the ESL students are from refugee backgrounds. Defining Resilience Much of the research on human resilience is grounded in psychology, with a capacity to “bounce back” from adverse experiences cited in many definitions of resilience (e.g. American Psychological Association). Bouncing back implies a relatively quick process, and a return to a state or form similar to that which existed before the encounter with adversity. Yet resilience often requires sustained effort and significant changes in identity. As Jerome Rugaruza, a former UNHCR refugee, says of his journey from the Democratic Republic of Congo to Australia: All the steps begin in the burning village: you run with nothing to eat, no clothes. You just go. Then you get to the refugee camp […] You have a little bread and you thank god you are safe. Then after a few years in the camp, you think about a future for your children. You arrive in Australia and then you learn a new language, you learn to drive. There are so many steps and not everyone can do it. (Milsom) Not everyone can do it, but a large majority do. Research by Graeme Hugo, for example, shows that although humanitarian settlers in Australia face substantial barriers to employment and initially have much higher unemployment rates than other immigrants, for most nationality groups this difference has disappeared by the second generation: “This is consistent with the sacrifice (or investment) of the first generation and the efforts extended to attain higher levels of education and English proficiency, thereby reducing the barriers over time.” (Hugo 35). Ingrid Poulson writes that “resilience is not just about bouncing. Bouncing […] is only a reaction. Resilience is about rising—you rise above it, you rise to the occasion, you rise to the challenge. Rising is an active choice” (47; my emphasis) I see resilience as involving mental and physical grit, coupled with creativity, aspiration and, crucially, agency. Dimensions of Resettlement To return to the story of 41-year-old Jerome Rugaruza, as related in a recent newspaper article: He [Mr Rugaruza] describes the experience of being a newly arrived refugee as being like that of a newborn baby. “You need special care; you have to learn to speak [English], eat the different food, create relationships, connections”. (Milsom) This is a key dimension of resettlement: the adult becomes like an infant again, shifting from someone who knows how things work and how to get by to someone who is likely to be, for a while, dependent on others for even the most basic things—communication, food, shelter, clothing, and social contact. The “special care” that most refugee arrivals need initially (and sometimes for a long time) often results in their being seen as deficient—in knowledge, skills, dispositions, and capacities as well as material goods (Keddie; Uptin, Wright and Harwood). As Fozdar and Hartley note: “The tendency to use a deficit model in refugee resettlement devalues people and reinforces the view of the mainstream population that refugees are a liability” (27). Yet unlike newborns, humanitarian settlers come to their new countries with rich social networks and extensive histories of experience and learning—resources that are in fact vital to their rebirth. Sisay (all names are pseudonyms), a year 11 student of Ethiopian heritage who was born in Kenya, told me with feeling: I had a life back in Africa [her emphasis]. It was good. Well, I would go back there if there’s no problems, which—is a fact. And I came here for a better life—yeah, I have a better life, there’s good health care, free school, and good environment and all that. But what’s that without friends? A fellow student, Celine, who came to Australia five years ago from Burundi via Uganda, told me in a focus group: Some teachers are really good but I think some other teachers could be a little bit more encouraging and understanding of what we’ve gone through, because [they] just look at you like “You’re year 11 now, you should know this” […] It’s really discouraging when [the teachers say] in front of the class, “Oh, you shouldn’t do this subject because you haven’t done this this this this” […] It’s like they’re on purpose to tell you “you don’t have what it takes; just give up and do something else.” As Uptin, Wright and Harwood note, “schools not only have the power to position who is included in schooling (in culture and pedagogy) but also have the power to determine whether there is room and appreciation for diversity” (126). Both Sisay and Celine were disheartened by the fact they felt some of their teachers, and many of their peers, had little interest in or understanding of their lives before they came to Australia. The teachers’ low expectations of refugee-background students (Keddie, Uptin, Wright and Harwood) contrasted with the students’ and their families’ high expectations of themselves (Brown, Miller and Mitchell; Harris and Marlowe). When I asked Sisay about her post-school ambitions, she said: “I have a good idea of my future […] write a documentary. And I’m working on it.” Celine’s response was: “I know I’m gonna do medicine, be a doctor.” A third girl, Lily, who came to Australia from Myanmar three years ago, told me she wanted to be an accountant and had studied accounting at the local TAFE last year. Joseph, a father of three who resettled from South Sudan seven years ago, stressed how important getting a job was to successful settlement: [But] you have to get a certificate first to get a job. Even the job of cleaning—when I came here I was told that somebody has to go to have training in cleaning, to use the different chemicals to clean the ground and all that. But that is just sweeping and cleaning with water—you don’t need the [higher-level] skills. Simple jobs like this, we are not able to get them. In regional Australia, employment opportunities tend to be limited (Fozdar and Hartley); the unemployment rate in Easthaven is twice the national average. Opportunities to study are also more limited than in urban centres, and would-be students are not always eligible for financial assistance to gain or upgrade qualifications. Even when people do have appropriate qualifications, work experience, and language proficiency, the colour of their skin may still mean they miss out on a job. Tilbury and Colic-Peisker have documented the various ways in which employers deflect responsibility for racial discrimination, including the “common” strategy (658) of arguing that while the employer or organisation is not prejudiced, they have to discriminate because of their clients’ needs or expectations. I heard this strategy deployed in an interview with a local businesswoman, Catriona: We were advertising for a new technician. And one of the African refugees came to us and he’d had a lot of IT experience. And this is awful, but we felt we couldn't give him the job, because we send our technicians into people's houses, and we knew that if a black African guy rocked up at someone’s house to try and fix their computer, they would not always be welcomed in all—look, it would not be something that [Easthaven] was ready for yet. Colic-Peisker and Tilbury (Refugees and Employment) note that while Australia has strict anti-discrimination legislation, this legislation may be of little use to the people who, because of the way they look and sound (skin colour, dress, accent), are most likely to face prejudice and discrimination. The researchers found that perceived discrimination in the labour market affected humanitarian settlers’ sense of satisfaction with their new lives far more than, for example, racist remarks, which were generally shrugged off; the students I interviewed spoke of racism as “expected,” but “quite rare.” Most of the people Colic-Peisker and Tilbury surveyed reported finding Australians “friendly and accepting” (33). Even if there is no active discrimination on the basis of skin colour in employment, education, or housing, or overt racism in social situations, visible difference can still affect a person’s sense of belonging, as Joseph recounts: I think of myself as Australian, but my colour doesn’t [laughs] […] Unfortunately many, many Australians are expecting that Australia is a country of Europeans … There is no need for somebody to ask “Where do you come from?” and “Do you find Australia here safe?” and “Do you enjoy it?” Those kind of questions doesn’t encourage that we are together. This highlights another dimension of resettlement: the journey from feeling “at home” to feeling “foreign” to, eventually, feeling at home again in the host country (Colic-Peisker and Tilbury, Refugees and Employment). In the case of visibly different settlers, however, this last stage may never be completed. Whether the questions asked of Joseph are well intentioned or not, their effect may be the same: they position him as a “forever foreigner” (Park). A further dimension of resettlement—one already touched on—is the degree to which humanitarian settlers actively manage their “rebirth,” and are allowed and encouraged to do so. A key factor will be their mastery of English, and Easthaven’s ESL teachers are thus pivotal in the resettlement process. There is little doubt that many of these teachers have gone to great lengths to help this cohort of students, not only in terms of language acquisition but also social inclusion. However, in some cases what is initially supportive can, with time, begin to undermine refugees’ maturity into independent citizens. Sharon, an ESL teacher at one of the schools, told me how she and her colleagues would give their refugee-background students lifts to social events: But then maybe three years down the track they have a car and their dad can drive, but they still won’t take them […] We arrive to pick them up and they’re not ready, or there’s five fantastic cars in the driveway, and you pick up the student and they say “My dad’s car’s much bigger and better than yours” [laughs]. So there’s an expectation that we’ll do stuff for them, but we’ve created that [my emphasis]. Other support services may have more complex interests in keeping refugee settlers dependent. The more clients an agency has, the more services it provides, and the longer clients stay on its books, the more lucrative the contract for the agency. Thus financial and employment imperatives promote competition rather than collaboration between service providers (Fozdar and Hartley; Sidhu and Taylor) and may encourage assumptions about what sorts of services different individuals and groups want and need. Colic-Peisker and Tilbury (“‘Active’ and ‘Passive’ Resettlement”) have developed a typology of resettlement styles—“achievers,” “consumers,” “endurers,” and “victims”—but stress that a person’s style, while influenced by personality and pre-migration factors, is also shaped by the institutions and individuals they come into contact with: “The structure of settlement and welfare services may produce a victim mentality, leaving members of refugee communities inert and unable to see themselves as agents of change” (76). The prevailing narrative of “the traumatised refugee” is a key aspect of this dynamic (Colic-Peisker and Tilbury, “‘Active’ and ‘Passive’ Resettlement”; Fozdar and Hartley; Keddie). Service providers may make assumptions about what humanitarian settlers have gone through before arriving in Australia, how they have been affected by their experiences, and what must be done to “fix” them. Norah, a long-time caseworker, told me: I think you get some [providers] who go, “How could you have gone through something like that and not suffered? There must be—you must have to talk about this stuff” […] Where some [refugees] just come with the [attitude] “We’re all born into a situation; that was my situation, but I’m here now and now my focus is this.” She cited failure to consider cultural sensitivities around mental illness and to recognise that stress and anxiety during early resettlement are normal (Tilbury) as other problems in the sector: [Newly arrived refugees] go through the “happy to be here” [phase] and now “hang on, I’ve thumped to the bottom and I’m missing my own foods and smells and cultures and experiences”. I think sometimes we’re just too quick to try and slot people into a box. One factor that appears to be vital in fostering and sustaining resilience is social connection. Norah said her clients were “very good on the mobile phone” and had links “everywhere,” including to family and friends in their countries of birth, transition countries, and other parts of Australia. A 2011 report for DIAC, Settlement Outcomes of New Arrivals, found that humanitarian entrants to Australia were significantly more likely to be members of cultural and/or religious groups than other categories of immigrants (Australian Survey Research). I found many examples of efforts to build both bonding and bridging capital (Putnam) in Easthaven, and I offer two examples below. Several people told me about a dinner-dance that had been held a few weeks before one of my visits. The event was organised by an African women’s group, which had been formed—with funding assistance—several years before. The dinner-dance was advertised in the local newspaper and attracted strong interest from a broad cross-section of Easthaveners. To Debbie, a counsellor, the response signified a “real turnaround” in community relations and was a big boon to the women’s sense of belonging. Erica, a teacher, told me about a cultural exchange day she had organised between her bush school—where almost all of the children are Anglo Australian—and ESL students from one of the town schools: At the start of the day, my kids were looking at [the refugee-background students] and they were scared, they were saying to me, "I feel scared." And we shoved them all into this tiny little room […] and they had no choice but to sit practically on top of each other. And by the end of the day, they were hugging each other and braiding their hair and jumping and playing together. Like Uptin, Wright and Harwood, I found that the refugee-background students placed great importance on the social aspects of school. Sisay, the girl I introduced earlier in this paper, said: “It’s just all about friendship and someone to be there for you […] We try to be friends with them [the non-refugee students] sometimes but sometimes it just seems they don’t want it.” Conclusion A 2012 report on refugee settlement services in NSW concludes that the state “is not meeting its responsibility to humanitarian entrants as well as it could” (Audit Office of New South Wales 2); moreover, humanitarian settlers in NSW are doing less well on indicators such as housing and health than humanitarian settlers in other states (3). Evaluating the effectiveness of formal refugee-centred programs was not part of my research and is beyond the scope of this paper. Rather, I have sought to reveal some of the ways in which the attitudes, assumptions, and everyday practices of service providers and members of the broader community impact on refugees' settlement experience. What I heard repeatedly in the interviews I conducted was that it was emotional and practical support (Matthews; Tilbury), and being asked as well as told (about their hopes, needs, desires), that helped Easthaven’s refugee settlers bear themselves into fulfilling new lives. References Audit Office of New South Wales. Settling Humanitarian Entrants in New South Wales—Executive Summary. May 2012. 15 Aug. 2013 ‹http://www.audit.nsw.gov.au/ArticleDocuments/245/02_Humanitarian_Entrants_2012_Executive_Summary.pdf.aspx?Embed=Y>. Australian Bureau of Statistics. 2011 Census QuickStats. Mar. 2013. 11 Aug. 2013 ‹http://www.censusdata.abs.gov.au/census_services/getproduct/census/2011/quickstat/0>. Australian Survey Research. Settlement Outcomes of New Arrivals—Report of Findings. Apr. 2011. 15 Aug. 2013 ‹http://www.immi.gov.au/media/publications/research/_pdf/settlement-outcomes-new-arrivals.pdf>. Brown, Jill, Jenny Miller, and Jane Mitchell. “Interrupted Schooling and the Acquisition of Literacy: Experiences of Sudanese Refugees in Victorian Secondary Schools.” Australian Journal of Language and Literacy 29.2 (2006): 150-62. Colic-Peisker, Val, and Farida Tilbury. “‘Active’ and ‘Passive’ Resettlement: The Influence of Supporting Services and Refugees’ Own Resources on Resettlement Style.” International Migration 41.5 (2004): 61-91. ———. Refugees and Employment: The Effect of Visible Difference on Discrimination—Final Report. Perth: Centre for Social and Community Research, Murdoch University, 2007. Fozdar, Farida, and Lisa Hartley. “Refugee Resettlement in Australia: What We Know and Need To Know.” Refugee Survey Quarterly 4 Jun. 2013. 12 Aug. 2013 ‹http://rsq.oxfordjournals.org/search?fulltext=fozdar&submit=yes&x=0&y=0>. Garcia Marquez, Gabriel. Love in the Time of Cholera. London: Penguin Books, 1989. Harris, Vandra, and Jay Marlowe. “Hard Yards and High Hopes: The Educational Challenges of African Refugee University Students in Australia.” International Journal of Teaching and Learning in Higher Education 23.2 (2011): 186-96. Hugo, Graeme. A Significant Contribution: The Economic, Social and Civic Contributions of First and Second Generation Humanitarian Entrants—Summary of Findings. Canberra: Department of Immigration and Citizenship, 2011. Keddie, Amanda. “Pursuing Justice for Refugee Students: Addressing Issues of Cultural (Mis)recognition.” International Journal of Inclusive Education 16.12 (2012): 1295-1310. Layton, Robyn. "Building Capacity to Ensure the Inclusion of Vulnerable Groups." Creating Our Future conference, Adelaide, 28 Jul. 2012. Milsom, Rosemarie. “From Hard Luck Life to the Lucky Country.” Sydney Morning Herald 20 Jun. 2013. 12 Aug. 2013 ‹http://www.smh.com.au/national/from-hard-luck-life-to-the-lucky-country-20130619-2oixl.html>. Park, Gilbert C. “’Are We Real Americans?’: Cultural Production of Forever Foreigners at a Diversity Event.” Education and Urban Society 43.4 (2011): 451-67. Poulson, Ingrid. Rise. Sydney: Pan Macmillan Australia, 2008. Putnam, Robert D. Bowling Alone: The Collapse and Revival of American Community. New York: Simon & Schuster, 2000. Sidhu, Ravinder K., and Sandra Taylor. “The Trials and Tribulations of Partnerships in Refugee Settlement Services in Australia.” Journal of Education Policy 24.6 (2009): 655-72. Tilbury, Farida. “‘I Feel I Am a Bird without Wings’: Discourses of Sadness and Loss among East Africans in Western Australia.” Identities: Global Studies in Culture and Power 14.4 (2007): 433-58. ———, and Val Colic-Peisker. “Deflecting Responsibility in Employer Talk about Race Discrimination.” Discourse & Society 17.5 (2006): 651-76. Uptin, Jonnell, Jan Wright, and Valerie Harwood. “It Felt Like I Was a Black Dot on White Paper: Examining Young Former Refugees’ Experience of Entering Australian High Schools.” The Australian Educational Researcher 40.1 (2013): 125-37.

APA, Harvard, Vancouver, ISO, and other styles

38

Green, Lelia Rosalind, and Kylie Justine Stevenson. "A Ten-Year-Old’s Use of Creative Content to Construct an Alternative Future for Herself." M/C Journal 20, no.1 (March15, 2017). http://dx.doi.org/10.5204/mcj.1211.

Full text

Abstract:

The ProjectThe Hand Up Linkage project focuses on the family as a communication context through which to explore the dynamics of intergenerational welfare dependency. In particular, it explores ways that creative life-course interventions might allow children in welfare dependent families to construct alternative realities for themselves and alternative views of their future. Formed through an alliance between a key Western Australian social welfare not-for-profit organisation, St Vincent de Paul WA (SVDPWA and also, in the context of volunteers, ‘Vinnies’), and Edith Cowan University, the project aims to address the organisation’s vision to provide “a hand up” (St Vincent 1) rather than ‘a hand out’, so that people can move forward with their lives without becoming dependent upon welfare. Prior to the start of the research, SVDPWA already had a whole of family focus in its outreach to poverty-impacted families including offering homework clubs and school holiday children’s camps run by their youth services division. Selected families supported by SVDPWA have been invited to participate in an in-depth interview for the project (Seidman), partly so that researchers can help identify “turning points” (King et al.) that might disrupt the communication of welfare dependency and inform more generalised intervention strategies; but also in order to explore the response to creative interventions within the children’s daily lives, including investigation of how strategies the child (and family) employed might help them to imagine alternative realities and futures for themselves. This paper closely examines the way that one 10 year old child from a non-English-speaking background family has employed alternative ways of viewing her life, through the camp program provided by the Linkage Partner St Vincent de Paul WA, and through reading novels such as Harry Potter and the Lemony Snicket Unfortunate Incidents series. Such activities help fuel hope for a different future which, in Snyder’s view has “two main components: the ability to plan pathways to desired goals despite obstacles, and agency or motivation to use those pathways” (Carr 96).The FamilyKani is a 10 year old girl living in a migrant sole parent family. The parents had moved to Australia from Bangladesh on student visas when Kani was 5 years old, however due to domestic violence the mother had recently separated from her husband, first into a women’s refuge then into private rental accommodation. The mother is in protracted negotiations with the Department of Immigration for permanent residency, which she had to recommence due to her separation. There are also family court negotiations for child custody and which restrict her leaving Australia. She receives no government benefits and minimal child support, works fulltime and pays full childcare fees for Kani’s 3 year old brother Adil and full primary school fees for Kani at a local religious school, given that Kani had experienced bullying and social aggression in previous schools. Kani was referred to SVDPWA by the women’s refuge and she began attending SVDPWA Kids’ Camps thereafter. (NB: Whilst the relevant specifics of this description are accurate, non-relevant material has been added or changed to protect the child’s and family’s identity.)Creative Life-Course InterventionsThe creative engagement that Kani experienced in the Hand Up project is constructed as one component in a larger model of creativity which includes “intrapersonal insights and interpretations, which often live only within the person who created them,” (Kaufman and Beghetto 4). Such an approach also acknowledges Csikszentmihalyi’s work on the concept of “flow”, whereby optimal experiences can result from positive absorption in a creative activity. Relevant Australian research such as the YouthWorx project has identified participatory engagement in creativity as one means of engaging with young people at risk (Hopkins; Podkalicka). The creative interventions in the Hand Up project take two forms; one is the predesigned and participatory creative activities delivered as part of the SVDPWA Kids’ Camp program. The second is a personalised intervention, identified by way of an in-depth interview with the child and parent, and is wholly dependent on the interests expressed by the child, the ability for the family to engage in that activity, and the budget restraints of the project.Reading as an Alternative RealityA key creative intervention embedded in the Hand Up Linkage project is determined by the interests expressed by the child during their in-depth interview. Also taken into account is the ability for the family to engage in that activity. For example, Kani’s mother works fulltime at a location which is an hour by public transport from home and does not have a car or driver’s license, so the choice of creative opportunity was restricted to a home-based activity or a weekend activity accessible by public transport. A further restriction is the limited budget available for this intervention in the project, along with an imperative that such interventions should be equitable between families and within families, and be of benefit to all the children in addition to the interviewed child. Fortunately, transport was not an issue because Kani expressed her interest very emphatically as books and reading. When asked what she liked doing most in life, Kani replied: “Reading. I like reading like big books, like really thick books and stuff. I have like 30 in my room. Like those really big books. And I'm starting to read Harry Potter now. Okay, the books that I like reading is Harry Potter, the entire set Roald Dahl books and the Baudelaire Orphans by Lemony Snicket. I like reading David Walliams. I like Little Women” (Kani). Her excitement in listing these books further animated the interview and was immediately emphasised because Kani took the interviewer (second author) and her mother into her room to demonstrate the truth of her statement. When asked again at the close of the interview “what’s a favourite thing that makes you feel good inside?” Kani’s answer was “Family and reading”. The energy and enthusiasm with which Kani talked about her reading and books made these the obvious choice as her creative intervention. However, participation in book-related courses or after-school activities was restricted by Kani’s mother’s transportation limitations. Taking into account how the financial constraints of her sole parent family impacted upon their capacity to buy books, and the joy that Kani clearly experienced from having books of her own, it was decided that a book voucher would be provided for her at a local bookstore easily accessible by bus. The research team negotiated with the bookstore to try to ensure that Kani could choose a book a month until the funds were expended so that the intervention would last most of the coming six months.What Kani was expressing in her love of books was partly related to the raw material they provide that help her to imagine the alternative reality of the fictional worlds she loved reading about. Kani’s passionate engagement in these alternative realities reflects theories of narrative immersion in one’s chosen medium: “One key element of an enjoyable media experience is that it takes individuals away from their mundane reality and into a story world. We call the process of becoming fully engaged in a story transportation into a narrative world” (Green et al. 311–12). Kani said: “Reading is everything, yeah. Like getting more books and like those kind of things and making me read more... ‘cause I really love reading, it’s like watching a movie. Do you know ... have you watched Harry Potter? … the book is nothing like the movie, nothing, they’ve missed so many parts so the book is more enjoyable than the movie. That’s why I like reading more. ‘Cause like I have my own adventures in my head.” This process of imagining her own adventures in her head echoes Green and Brock’s explanation of the process of being transported into alternative realities through reading as a result of “an integrative melding of attention, imagery, and feelings” (701).Constructing Alternative Realities for Herself and an Alternative Possible FutureLike many 10 year olds, Kani has a challenging time at school, exacerbated by the many school moves brought about by changes in her family circumstances. Even though she is in a school which supports her family’s faith, her experience is one of being made to feel an outsider: “all the boys and the girls in our class are like friends, they’re like ... it’s a group. But I’m not in their group. I have my friends in other classes and they’re [my classmates are] not happy with it, that’s why they tease me and stuff. And like whenever I play with my friends they’re like ... yeah”. The interviewer asked her what she liked about her special friends. “They’re fun. Creative like, enjoyable, yeah, those kind of things …they have lots of cool ideas like plans and stuff like that.” As Hawkins et al. argue, the capacity to develop and maintain good relationships with peers (and parents) is a key factor in helping children be resilient. It is likely that Kani also shares her creativity, ideas and plans with her friendship group as part of her shared contribution to its existence.A domestication of technology framework (Silverstone et al.) can be useful as part of the explanation for Kani’s use of imaginative experience in building her social relationships. Silverstone et al. argue that technology is domesticated via four interlocking activities: ‘appropriation’ (where it embraced, purchased, taken into the household), ‘objectification’ (where a physical space is found for it), ‘incorporation’ (the spaces through which it is inserted into the everyday activities of the household or users) and ‘conversion’ (whereby the experience and fact of the technology use – or lack of use – becomes material through which family members express themselves and their priorities to the social world beyond the home). Arguably, Kani ‘converts’ her engagement with books and associated imaginative experiences into social currency through which she builds relationships with the like-minded children with whom she makes friends. At the same time, those children feed into her ideas of what constitutes a creative approach to life and help energise her plans for the future.Kani’s views of her future (at the age of 10) are influenced by the traditional occupations favoured by high achieving students, and by the fact that her parents are themselves educational high achievers, entering Australia on student visas. “I want to be a doctor … my cousin wants to be a doctor too. Mum said lawyer but we want to be a doctors anywhere. We want to be a ...me and my cousin want to be doctors like ...we like being doctors and like helping people.” Noting the pressures on the household of the possible fees and costs of high school, Kani adds “I need to work even harder so I get a scholarship. ‘Cause like my mum can’t pay for like four terms, you know how much money that will be? Yeah.” Kani’s follow-on statement, partly to justify why she wants “a big house”, adds some poignancy to her reference to a cousin (one of many), who still lives in Bangladesh and whom Kani hasn’t seen since 2011. “Like I want to live with my mum and like yeah and like I live with my cousin too because like I have a cousin ... she’s a girl, yeah? And like yeah, she’s in Bangladesh, I haven’t seen her for very long time so yeah.” In the absence of her extended family overseas, Kani adds her pets to those with whom she shares her family life: “And my mum and my uncle and then our cat Dobby. I named it [for Harry Potter’s house elf] ...and the goldfish. The goldfish are Twinkle, Glitter, Glow and Bobby.”Kani’s mum notes the importance of an opportunity to dream a future into existence: “maybe she’s too young or she hasn’t really kind of made up her mind as yet as to what she wants to do in life but just going out and just you know doing stuff and just giving them the opportunity”. The SVDPWA Kids’ Camp is an important part of this “they [the refuge] kind of told us like ‘there’s this child camp’. … I was like yeah, sure, why not?” Providing Alternative Spaces at the SVDPWA Kids’ CampThe SVDPWA Kids’ Camps themselves constitute a creative intervention in offering visions of alternative realities to their young participants. Their benefit is delivered via anticipation, as well as the reality of the camp experience. As Kani said “I forget all about the things that’s just past, like all the hard things, you know like I go through and stuff and it just makes me forget it and it makes me like think about camp, things we’re going to do at camp”. The Kids’ Camps take place three times a year and are open to children aged between 8 and 13, with follow-on Teen Camps for older age groups. Once a child is part of the program she or he can continue to participate in successive camps while they are in the target age group. Consisting of a four day activity-based experience in a natural setting, conducted by Vinnies Youth and staffed by key SVDPWA employees and Youth volunteers, the camps offer children a varied schedule of activities in a safe and supported environment, with at least one volunteer for every two child participants. The camps are specifically made available to children from disadvantaged families and are provided virtually free to participants. (A nominal $10 enrolment fee is applied per child). Kani was initially reticent about attending her first camp. She explained: “I was shy, scared because I sleep with my mum so it’s different sleeping without Mum. I know it’s kind of embarrassing ‘cause, sleeping with my mum like, but I just get scared at night”. Kani went on to explain how the camp facilitators were able to allay her fears “I knew I was safe. And I had people I could talk to so yeah ...like the leader”. As one Vinnies Youth volunteer explains, the potential of offering children like Kani time out from the pressures of everyday life is demonstrated when “towards the end of every camp we always see that progression of, they came out of their shell … So I think it’s really just a journey for everyone and it’s understandable if they did feel stuck. It’s about what we can do to help them progress forward” (VY1). Kani was empowered to envision an alternative idea of herself at camp, one which was unexpectedly intuited by the research interviewer.When the interviewer closed the interview by expressing that it had been lovely to talk to Kani as she was “such a bundle of energy”, Kani grinned and replied “Do you know the warm fuzzies, yeah? [When positive thoughts about others are exchanged at the SVDPWA Kids’ Camp]. The bundle ... all the leaders say I’m a bundle of happiness”. The Kids’ Camp provided Kani with a fun and positive alternative reality to the one she experienced as a child handling the considerable challenges experienced by social isolation, domestic violence and parental separation, including the loss of her home, diminished connection to her overseas extended family, legal custody issues, and several school changes. Taking the role of cultural intermediary, by offering the possibility of alternative realities via their camp, SVDPWA offered Kani a chance that supported her work on creating a range of enticing possible futures for herself. This was in contrast to some commercial holiday camp experiences which might more centrally use their “cultural authority as shapers of taste and … new consumerist dispositions” (Nixon and Du Gay 497). Even so, Kani’s interview made clear that her experience with the SVDPWA Kids’ Camps were only part of the ways in which she was crafting a range of possible visions for her adult life, adding to this her love of books and reading, her fun, creative friends, and her vision for a successful future which would reunite her with her distant cousin and offer security to her mother. ConclusionUnderstandably, Kani at 10 lacks the critical insight required to interpret how her imaginative and creative life provides the raw materials from which she crafts her visions for the future. Further, the interviewer is careful not to introduce words like ‘creative’ into her work with the participant families, so that when Kani used it to talk about her friends she did so drawing upon her own store of descriptions and not as a result of having recently been reminded of creativity as a desirable attribute. The interview with this young person indicates, however, how greatly she values the imaginative and cultural inputs into her life and how she converts them in ways which help ensure access to further such creative currency. Apart from referencing her reading in the naming of her cat, Kani’s vision for herself reflects both the conventional idea of success (“a doctor”) and a very specific idea of her future living as an adult in house large enough to include her mum and her cousin.Kani’s love of reading, her pleasure in books, her choice of friends and her aspirations to scholarly excellence all offer her ways to escape the restricted options available to families who seek support from organisations such as SVDPWA. At the same time the Kids’ Camps themselves, like Kani’s books, provide an escape from the difficulties of the present. Kani’s appropriation of the cultural raw materials that she draws into her life, and her conversion of these inputs into a creative, social currency, offers her an opportunity to anticipate a better future, and some tools she can use to help bring it into existence.ReferencesCarr, A. Positive Psychology: The Science of Happiness and Human Strengths. 2nd ed. Hove, UK: Routledge, 2011.Csikszentmihalyi, M. Creativity: Flow and the Psychology of Discovery and Invention. New York: HarperCollins, 1996.Green, M., and T. Brock. “The Role of Transportation in the Persuasiveness of Public Narratives.”. Journal of Personality and Social Psychology 79 (2000): 701–21.———, T. Brock, and G. Kaufman. “Understanding Media Enjoyment: The Role of Transportation into Narrative Worlds." Communication Theory 14.4 (2004): 311–27.Hawkins, J.D., R. Kosterman, R.F. Catalano, K.G. Hill, and R.D. Abbott. “Promoting Positive Adult Functioning through Social Development Intervention in Childhood: Long-Term Effects from the Seattle Social Development Project.” Archives of Pediatrics & Adolescent Medicine 159.1 (2005): 25. Hopkins, L. “YouthWorx: Increasing Youth Participation through Media Production.” Journal of Sociology 47.2 (2011): 181–197. doi: 10.1177/1440783310386827.Kani. In-depth interview, de-identified, 2016.Kaufman, J. C., and R.A. Beghetto. “Beyond Big and Little: The Four C Model of Creativity.” Review of General Psychology 13.1 (2009): 1–12. <http://dx.doi.org/10.1037/a0013688>. King, G., T. Cathers, E. Brown, J.A. Specht, C. Willoughby, J.M. Polgar, and L. Havens. “Turning Points and Protective Processes in the Lives of People with Chronic Disabilities.” Qualitative Health Research 13.2 (2003): 184–206.Nixon, S., and P. Du Gay. “Who Needs Cultural Intermediaries?” Cultural Studies 16.4 (2002): 495–500.Podkalicka, A. “Young Listening: An Ethnography of YouthWorx Media’s Radio Project.” Continuum 23.4 (2009): 561–72.St Vincent de Paul Society (WA). St Vincent de Paul Society, Annual Report 2013. Perth, WA: St Vincent de Paul Society (WA), 2013. 5 Jan 2017 <http://www.vinnies.org.au/icms_docs/169819_Vinnies_WA_2012_Annual_Report.pdf>.Seidman, I. Interviewing as Qualitative Research: A Guide for Researchers in Education and the Social Sciences. New York: Teachers College Press, Columbia University, 2006.Silverstone, R., E. Hirsch, and D. Morley. “Information and Communication Technologies and the Moral Economy of the Household.” Consuming Technologies: Media and Information in Domestic Spaces. Eds. R. Silverstone and E. Hirsch. London: Routledge, 1992. 9–17.Snyder, C.R. Handbook of Hope. Orlando, FL: Academic Press, 2000.VY1. In-depth interview with Vinnies Youth volunteer, de-identified, 2016.

APA, Harvard, Vancouver, ISO, and other styles

39

Cushing, Nancy. "To Eat or Not to Eat Kangaroo: Bargaining over Food Choice in the Anthropocene." M/C Journal 22, no.2 (April24, 2019). http://dx.doi.org/10.5204/mcj.1508.

Full text

Abstract:

Kangatarianism is the rather inelegant word coined in the first decade of the twenty-first century to describe an omnivorous diet in which the only meat consumed is that of the kangaroo. First published in the media in 2010 (Barone; Zukerman), the term circulated in Australian environmental and academic circles including the Global Animal conference at the University of Wollongong in July 2011 where I first heard it from members of the Think Tank for Kangaroos (THINKK) group. By June 2017, it had gained enough attention to be named the Oxford English Dictionary’s Australian word of the month (following on from May’s “smashed avo,” another Australian food innovation), but it took the Nine Network reality television series Love Island Australia to raise kangatarian to trending status on social media (Oxford UP). During the first episode, aired in late May 2018, Justin, a concreter and fashion model from Melbourne, declared himself to have previously been a kangatarian as he chatted with fellow contestant, Millie. Vet nurse and animal lover Millie appeared to be shocked by his revelation but was tentatively accepting when Justin explained what kangatarian meant, and justified his choice on the grounds that kangaroo are not farmed. In the social media response, it was clear that eating only the meat of kangaroos as an ethical choice was an entirely new concept to many viewers, with one tweet stating “Kangatarian isn’t a thing”, while others variously labelled the diet brutal, intriguing, or quintessentially Australian (see #kangatarian on Twitter).There is a well developed literature around the arguments for and against eating kangaroo, and why settler Australians tend to be so reluctant to do so (see for example, Probyn; Cawthorn and Hoffman). Here, I will concentrate on the role that ethics play in this food choice by examining how the adoption of kangatarianism can be understood as a bargain struck to help to manage grief in the Anthropocene, and the limitations of that bargain. As Lesley Head has argued, we are living in a time of loss and of grieving, when much that has been taken for granted is becoming unstable, and “we must imagine that drastic changes to everyday life are in the offing” (313). Applying the classic (and contested) model of five stages of grief, first proposed by Elisabeth Kübler-Ross in her book On Death and Dying in 1969, much of the population of the western world seems to be now experiencing denial, her first stage of loss, while those in the most vulnerable environments have moved on to anger with developed countries for destructive actions in the past and inaction in the present. The next stages (or states) of grieving—bargaining, depression, and acceptance—are likely to be manifested, although not in any predictable sequence, as the grief over current and future losses continues (Haslam).The great expansion of food restrictive diets in the Anthropocene can be interpreted as part of this bargaining state of grieving as individuals attempt to respond to the imperative to reduce their environmental impact but also to limit the degree of change to their own diet required to do so. Meat has long been identified as a key component of an individual’s environmental footprint. From Frances Moore Lappé’s 1971 Diet for a Small Planet through the United Nations’ Food and Agriculture Organisation’s 2006 report Livestock’s Long Shadow to the 2019 report of the EAT–Lancet Commission on Healthy Diets from Sustainable Food Systems, the advice has been consistent: meat consumption should be minimised in, if not eradicated from, the human diet. The EAT–Lancet Commission Report quantified this to less than 28 grams (just under one ounce) of beef, lamb or pork per day (12, 25). For many this would be keenly felt, in terms of how meals are constructed, the sensory experiences associated with eating meat and perceptions of well-being but meat is offered up as a sacrifice to bring about the return of the beloved healthy planet.Rather than accept the advice to cut out meat entirely, those seeking to bargain with the Anthropocene also find other options. This has given rise to a suite of foodways based around restricting meat intake in volume or type. Reducing the amount of commercially produced beef, lamb and pork eaten is one approach, while substituting a meat the production of which has a smaller environmental footprint, most commonly chicken or fish, is another. For those willing to make deeper changes, the meat of free living animals, especially those which are killed accidentally on the roads or for deliberately for environmental management purposes, is another option. Further along this spectrum are the novel protein sources suggested in the Lancet report, including insects, blue-green algae and laboratory-cultured meats.Kangatarianism is another form of this bargain, and is backed by at least half a century of advocacy. The Australian Conservation Foundation made calls to reduce the numbers of other livestock and begin a sustainable harvest of kangaroo for food in 1970 when the sale of kangaroo meat for human consumption was still illegal across the country (Conservation of Kangaroos). The idea was repeated by biologist Gordon Grigg in the late 1980s (Jackson and Vernes 173), and again in the Garnaut Climate Change Review in 2008 (547–48). Kangaroo meat is high in protein and iron, low in fat, and high in healthy polyunsaturated fatty acids and conjugated linoleic acid, and, as these authors showed, has a smaller environmental footprint than beef, lamb, or pork. Kangaroo require less water than cattle, sheep or pigs, and no land is cleared to grow feed for them or give them space to graze. Their paws cause less erosion and compaction of soil than do the hooves of common livestock. They eat less fodder than ruminants and their digestive processes result in lower emissions of the powerful greenhouse gas methane and less solid waste.As Justin of Love Island was aware, kangaroo are not farmed in the sense of being deliberately bred, fed, confined, or treated with hormones, drugs or chemicals, which also adds to their lighter impact on the environment. However, some pastoralists argue that because they cannot prevent kangaroos from accessing the food, water, shelter, and protection from predators they provide for their livestock, they do effectively farm them, although they receive no income from sales of kangaroo meat. This type of light touch farming of kangaroos has a very long history in Australia going back to the continent’s first peopling some 60,000 years ago. Kangaroos were so important to Aboriginal people that a wide range of environments were manipulated to produce their favoured habitats of open grasslands edged by sheltering trees. As Bill Gammage demonstrated, fire was used as a tool to preserve and extend grassy areas, to encourage regrowth which would attract kangaroos and to drive the animals from one patch to another or towards hunters waiting with spears (passim, for example, 58, 72, 76, 93). Gammage and Bruce Pascoe agree that this was a form of animal husbandry in which the kangaroos were drawn to the areas prepared for them for the young grass or, more forcefully, physically directed using nets, brush fences or stone walls. Burnt ground served to contain the animals in place of fencing, and regular harvesting kept numbers from rising to levels which would place pressure on other species (Gammage 79, 281–86; Pascoe 42–43). Contemporary advocates of eating kangaroo have promoted the idea that they should be deliberately co-produced with other livestock instead of being killed to preserve feed and water for sheep and cattle (Ellicott; Wilson 39). Substituting kangaroo for the meat of more environmentally damaging animals would facilitate a reduction in the numbers of cattle and sheep, lessening the harm they do.Most proponents have assumed that their audience is current meat eaters who would substitute kangaroo for the meat of other more environmentally costly animals, but kangatarianism can also emerge from vegetarianism. Wendy Zukerman, who wrote about kangaroo hunting for New Scientist in 2010, was motivated to conduct the research because she was considering becoming an early adopter of kangatarianism as the least environmentally taxing way to counter the longterm anaemia she had developed as a vegetarian. In 2018, George Wilson, honorary professor in the Australian National University’s Fenner School of Environment and Society called for vegetarians to become kangatarians as a means of boosting overall consumption of kangaroo for environmental and economic benefits to rural Australia (39).Given these persuasive environmental arguments, it might be expected that many people would have perceived eating kangaroo instead of other meat as a favourable bargain and taken up the call to become kangatarian. Certainly, there has been widespread interest in trying kangaroo meat. In 1997, only five years after the sale of kangaroo meat for human consumption had been legalised in most states (South Australia did so in 1980), 51% of 500 people surveyed in five capital cities said they had tried kangaroo. However, it had not become a meat of choice with very few found to eat it more than three times a year (Des Purtell and Associates iv). Just over a decade later, a study by Ampt and Owen found an increase to 58% of 1599 Australians surveyed across the country who had tried kangaroo but just 4.7% eating it at least monthly (14). Bryce Appleby, in his study of kangaroo consumption in the home based on interviews with 28 residents of Wollongong in 2010, specifically noted the absence of kangatarians—then a very new concept. A study of 261 Sydney university students in 2014 found that half had tried kangaroo meat and 10% continued to eat it with any regularity. Only two respondents identified themselves as kangatarian (Grant 14–15). Kangaroo meat advocate Michael Archer declared in 2017 that “there’s an awful lot of very, very smart vegetarians [who] have opted for semi vegetarianism and they’re calling themselves ‘kangatarians’, as they’re quite happy to eat kangaroo meat”, but unless there had been a significant change in a few years, the surveys did not bear out his assertion (154).The ethical calculations around eating kangaroo are complicated by factors beyond the strictly environmental. One Tweeter advised Justin: “‘I’m a kangatarian’ isn’t a pickup line, mate”, and certainly the reception of his declaration could have been very cool, especially as it was delivered to a self declared animal warrior (N’Tash Aha). All of the studies of beliefs and practices around the eating of kangaroo have noted a significant minority of Australians who would not consider eating kangaroo based on issues of animal welfare and animal rights. The 1997 study found that 11% were opposed to the idea of eating kangaroo, while in Grant’s 2014 study, 15% were ethically opposed to eating kangaroo meat (Des Purtell and Associates iv; Grant 14–15). Animal ethics complicate the bargains calculated principally on environmental grounds.These ethical concerns work across several registers. One is around the flesh and blood kangaroo as a charismatic native animal unique to Australia and which Australians have an obligation to respect and nurture. Sheep, cattle and pigs have been subject to longterm propaganda campaigns which entrench the idea that they are unattractive and unintelligent, and veil their transition to meat behind euphemistic language and abattoir walls, making it easier to eat them. Kangaroos are still seen as resourceful and graceful animals, and no linguistic tricks shield consumers from the knowledge that it is a roo on their plate. A proposal in 2009 to market a “coat of arms” emu and kangaroo-flavoured potato chip brought complaints to the Advertising Standards Bureau that this was disrespectful to these native animals, although the flavours were to be simulated and the product vegetarian (Black). Coexisting with this high regard to kangaroos is its antithesis. That is, a valuation of them informed by their designation as a pest in the pastoral industry, and the use of the carcasses of those killed to feed dogs and other companion animals. Appleby identified a visceral, disgust response to the idea of eating kangaroo in many of his informants, including both vegetarians who would not consider eating kangaroo because of their commitment to a plant-based diet, and at least one omnivore who would prefer to give up all meat rather than eat kangaroo. While diametrically opposed, the end point of both positions is that kangaroo meat should not be eaten.A second animal ethics stance relates to the imagined kangaroo, a cultural construct which for most urban Australians is much more present in their lives and likely to shape their actions than the living animals. It is behind the rejection of eating an animal which holds such an iconic place in Australian culture: to the dexter on the 1912 national coat of arms; hopping through the Hundred Acre Wood as Kanga and Roo in A.A. Milne’s Winnie-the-Pooh children’s books from the 1920s and the Disney movies later made from them; as a boy’s best friend as Skippy the Bush Kangaroo in a fondly remembered 1970s television series; and high in the sky on QANTAS planes. The anthropomorphising of kangaroos permitted the spectacle of the boxing kangaroo from the late nineteenth century. By framing natural kangaroo behaviours as boxing, these exhibitions encouraged an ambiguous understanding of kangaroos as human-like, moving them further from the category of food (Golder and Kirkby). Australian government bodies used this idea of the kangaroo to support food exports to Britain, with kangaroos as cooks or diners rather than ingredients. The Kangaroo Kookery Book of 1932 (see fig. 1 below) portrayed kangaroos as a nuclear family in a suburban kitchen and another official campaign supporting sales of Australian produce in Britain in the 1950s featured a Disney-inspired kangaroo eating apples and chops washed down with wine (“Kangaroo to Be ‘Food Salesman’”). This imagining of kangaroos as human-like has persisted, leading to the opinion expressed in a 2008 focus group, that consuming kangaroo amounted to “‘eating an icon’ … Although they are pests they are still human nature … these are native animals, people and I believe that is a form of cannibalism!” (Ampt and Owen 26). Figure 1: Rather than promoting the eating of kangaroos, the portrayal of kangaroos as a modern suburban family in the Kangaroo Kookery Book (1932) made it unthinkable. (Source: Kangaroo Kookery Book, Director of Australian Trade Publicity, Australia House, London, 1932.)The third layer of ethical objection on the ground of animal welfare is more specific, being directed to the method of killing the kangaroos which become food. Kangaroos are perhaps the only native animals for which state governments set quotas for commercial harvest, on the grounds that they compete with livestock for pasturage and water. In most jurisdictions, commercially harvested kangaroo carcasses can be processed for human consumption, and they are the ones which ultimately appear in supermarket display cases.Kangaroos are killed by professional shooters at night using swivelling spotlights mounted on their vehicles to locate and daze the animals. While clean head shots are the ideal and regulations state that animals should be killed when at rest and without causing “undue agonal struggle”, this is not always achieved and some animals do suffer prolonged deaths (NSW Code of Practice for Kangaroo Meat for Human Consumption). By regulation, the young of any female kangaroo must be killed along with her. While averting a slow death by neglect, this is considered cruel and wasteful. The hunt has drawn international criticism, including from Greenpeace which organised campaigns against the sale of kangaroo meat in Europe in the 1980s, and Viva! which was successful in securing the withdrawal of kangaroo from sale in British supermarkets (“Kangaroo Meat Sales Criticised”). These arguments circulate and influence opinion within Australia.A final animal ethics issue is that what is actually behind the push for greater use of kangaroo meat is not concern for the environment or animal welfare but the quest to turn a profit from these animals. The Kangaroo Industries Association of Australia, formed in 1970 to represent those who dealt in the marsupials’ meat, fur and skins, has been a vocal advocate of eating kangaroo and a sponsor of market research into how it can be made more appealing to the market. The Association argued in 1971 that commercial harvest was part of the intelligent conservation of the kangaroo. They sought minimum size regulations to prevent overharvesting and protect their livelihoods (“Assn. Backs Kangaroo Conservation”). The Association’s current website makes the claim that wild harvested “Australian kangaroo meat is among the healthiest, tastiest and most sustainable red meats in the world” (Kangaroo Industries Association of Australia). That this is intended to initiate a new and less controlled branch of the meat industry for the benefit of hunters and processors, rather than foster a shift from sheep or cattle to kangaroos which might serve farmers and the environment, is the opinion of Dr. Louise Boronyak, of the Centre for Compassionate Conservation at the University of Technology Sydney (Boyle 19).Concerns such as these have meant that kangaroo is most consumed where it is least familiar, with most of the meat for human consumption recovered from culled animals being exported to Europe and Asia. Russia has been the largest export market. There, kangaroo meat is made less strange by blending it with other meats and traditional spices to make processed meats, avoiding objections to its appearance and uncertainty around preparation. With only a low profile as a novelty animal in Russia, there are fewer sentimental concerns about consuming kangaroo, although the additional food miles undermine its environmental credentials. The variable acceptability of kangaroo in more distant markets speaks to the role of culture in determining how patterns of eating are formed and can be shifted, or, as Elspeth Probyn phrased it “how natural entities are transformed into commodities within a context of globalisation and local communities”, underlining the impossibility of any straightforward ethics of eating kangaroo (33, 35).Kangatarianism is a neologism which makes the eating of kangaroo meat something it has not been in the past, a voluntary restriction based on environmental ethics. These environmental benefits are well founded and eating kangaroo can be understood as an Anthropocenic bargain struck to allow the continuation of the consumption of red meat while reducing one’s environmental footprint. Although superficially attractive, the numbers entering into this bargain remain small because environmental ethics cannot be disentangled from animal ethics. The anthropomorphising of the kangaroo and its use as a national symbol coexist with its categorisation as a pest and use of its meat as food for companion animals. Both understandings of kangaroos made their meat uneatable for many Australians. Paired with concerns over how kangaroos are killed and the commercialisation of a native species, kangaroo meat has a very mixed reception despite decades of advocacy for eating its meat in favour of that of more harmed and more harmful introduced species. Given these constraints, kangatarianism is unlikely to become widespread and indeed it should be viewed as at best a temporary exigency. As the climate warms and rainfall becomes more erratic, even animals which have evolved to suit Australian conditions will come under increasing pressure, and humans will need to reach Kübler-Ross’ final state of grief: acceptance. In this case, this would mean acceptance that our needs cannot be placed ahead of those of other animals.ReferencesAmpt, Peter, and Kate Owen. Consumer Attitudes to Kangaroo Meat Products. Canberra: Rural Industries Research and Development Corporation, 2008.Appleby, Bryce. “Skippy the ‘Green’ Kangaroo: Identifying Resistances to Eating Kangaroo in the Home in a Context of Climate Change.” BSc Hons, U of Wollongong, 2010 <http://ro.uow.edu.au/thsci/103>.Archer, Michael. “Zoology on the Table: Plenary Session 4.” Australian Zoologist 39, 1 (2017): 154–60.“Assn. Backs Kangaroo Conservation.” The Beverley Times 26 Feb. 1971: 3. 22 Feb. 2019 <http://nla.gov.au/nla.news-article202738733>.Barone, Tayissa. “Kangatarians Jump the Divide.” Sydney Morning Herald 9 Feb. 2010. 13 Apr. 2019 <https://www.smh.com.au/lifestyle/kangatarians-jump-the-divide-20100209-gdtvd8.html>.Black, Rosemary. “Some Australians Angry over Idea for Kangaroo and Emu-Flavored Potato Chips.” New York Daily News 4 Dec. 2009. 5 Feb. 2019 <https://www.nydailynews.com/life-style/eats/australians-angry-idea-kangaroo-emu-flavored-potato-chips-article-1.431865>.Boyle, Rhianna. “Eating Skippy.” Big Issue Australia 578 11-24 Jan. 2019: 16–19.Cawthorn, Donna-Mareè, and Louwrens C. Hoffman. “Controversial Cuisine: A Global Account of the Demand, Supply and Acceptance of ‘Unconventional’ and ‘Exotic’ Meats.” Meat Science 120 (2016): 26–7.Conservation of Kangaroos. Melbourne: Australian Conservation Foundation, 1970.Des Purtell and Associates. Improving Consumer Perceptions of Kangaroo Products: A Survey and Report. Canberra: Rural Industries Research and Development Corporation, 1997.Ellicott, John. “Little Pay Incentive for Shooters to Join Kangaroo Meat Industry.” The Land 15 Mar. 2018. 28 Mar. 2019 <https://www.theland.com.au/story/5285265/top-roo-shooter-says-harvesting-is-a-low-paid-job/>.Garnaut, Ross. Garnaut Climate Change Review. 2008. 26 Feb. 2019 <http://www.garnautreview.org.au/index.htm>.Gammage, Bill. The Biggest Estate on Earth: How Aborigines Made Australia. Sydney: Allen and Unwin, 2012.Golder, Hilary, and Diane Kirkby. “Mrs. Mayne and Her Boxing Kangaroo: A Married Woman Tests Her Property Rights in Colonial New South Wales.” Law and History Review 21.3 (2003): 585–605.Grant, Elisabeth. “Sustainable Kangaroo Harvesting: Perceptions and Consumption of Kangaroo Meat among University Students in New South Wales.” Independent Study Project (ISP). U of NSW, 2014. <https://digitalcollections.sit.edu/isp_collection/1755>.Haslam, Nick. “The Five Stages of Grief Don’t Come in Fixed Steps – Everyone Feels Differently.” The Conversation 22 Oct. 2018. 28 Mar. 2019 <https://theconversation.com/the-five-stages-of-grief-dont-come-in-fixed-steps-everyone-feels-differently-96111>.Head, Lesley. “The Anthropoceans.” Geographical Research 53.3 (2015): 313–20.Kangaroo Industries Association of Australia. Kangaroo Meat. 26 Feb. 2019 <http://www.kangarooindustry.com/products/meat/>.“Kangaroo Meat Sales Criticised.” The Canberra Times 13 Sep. 1984: 14. 22 Feb 2019 <http://nla.gov.au/nla.news-article136915919>.“Kangaroo to Be Food ‘Salesman.’” Newcastle Morning Herald and Miners’ Advocate, 2 Dec. 1954. 22 Feb 2019 <http://nla.gov.au/nla.news-article134089767>.Kübler-Ross, Elisabeth. On Death and Dying: What the Dying Have to Teach Doctors, Nurses, Clergy, and their own Families. New York: Touchstone, 1997.Jackson, Stephen, and Karl Vernes. Kangaroo: Portrait of an Extraordinary Marsupial. Sydney: Allen and Unwin, 2010.Lappé, Frances Moore. Diet for a Small Planet. New York: Ballantine Books, 1971.N’Tash Aha (@Nsvasey). “‘I’m a Kangatarian’ isn’t a Pickup Line, Mate. #LoveIslandAU.” Twitter post. 27 May 2018. 5 Apr. 2019 <https://twitter.com/Nsvasey/status/1000697124122644480>.“NSW Code of Practice for Kangaroo Meat for Human Consumption.” Government Gazette of the State of New South Wales 24 Mar. 1993. 22 Feb. 2019 <http://nla.gov.au/nla.news-page14638033>.Oxford University Press, Australia and New Zealand. Word of the Month. June 2017. <https://www.oup.com.au/dictionaries/word-of-the-month>.Pascoe, Bruce. Dark Emu, Black Seeds: Agriculture or Accident? Broome: Magabala Books, 2014.Probyn, Elspeth. “Eating Roo: Of Things That Become Food.” New Formations 74.1 (2011): 33–45.Steinfeld, Henning, Pierre Gerber, Tom Wassenaar, Vicent Castel, Mauricio Rosales, and Cees d Haan. Livestock’s Long Shadow: Environmental Issues and Options. Rome: Food and Agriculture Organisation of the United Nations, 2006.Trust Nature. Essence of Kangaroo Capsules. 26 Feb. 2019 <http://ncpro.com.au/products/all-products/item/88139-essence-of-kangaroo-35000>.Victoria Department of Environment, Land, Water and Planning. Kangaroo Pet Food Trial. 28 Mar. 2019 <https://www.wildlife.vic.gov.au/managing-wildlife/wildlife-management-and-control-authorisations/kangaroo-pet-food-trial>.Willett, Walter, et al. “Food in the Anthropocene: The EAT–Lancet Commission on Healthy Diets from Sustainable Food Systems.” The Lancet 16 Jan. 2019. 26 Feb. 2019 <https://www.thelancet.com/commissions/EAT>.Wilson, George. “Kangaroos Can Be an Asset Rather than a Pest.” Australasian Science 39.1 (2018): 39.Zukerman, Wendy. “Eating Skippy: The Future of Kangaroo Meat.” New Scientist 208.2781 (2010): 42–5.

APA, Harvard, Vancouver, ISO, and other styles

40

Brien, Donna Lee. "From Waste to Superbrand: The Uneasy Relationship between Vegemite and Its Origins." M/C Journal 13, no.4 (August18, 2010). http://dx.doi.org/10.5204/mcj.245.

Full text

Abstract:

This article investigates the possibilities for understanding waste as a resource, with a particular focus on understanding food waste as a food resource. It considers the popular yeast spread Vegemite within this frame. The spread’s origins in waste product, and how it has achieved and sustained its status as a popular symbol of Australia despite half a century of Australian gastro-multiculturalism and a marked public resistance to other recycling and reuse of food products, have not yet been a focus of study. The process of producing Vegemite from waste would seem to align with contemporary moves towards recycling food waste, and ensuring environmental sustainability and food security, yet even during times of austerity and environmental concern this has not provided the company with a viable marketing strategy. Instead, advertising copywriting and a recurrent cycle of product memorialisation have created a superbrand through focusing on Vegemite’s nutrient and nostalgic value.John Scanlan notes that producing waste is a core feature of modern life, and what we dispose of as surplus to our requirements—whether this comprises material objects or more abstract products such as knowledge—reveals much about our society. In observing this, Scanlan asks us to consider the quite radical idea that waste is central to everything of significance to us: the “possibility that the surprising core of all we value results from (and creates even more) garbage (both the material and the metaphorical)” (9). Others have noted the ambivalent relationship we have with the waste we produce. C. T. Anderson notes that we are both creator and agent of its disposal. It is our ambivalence towards waste, coupled with its ubiquity, that allows waste materials to be described so variously: negatively as garbage, trash and rubbish, or more positively as by-products, leftovers, offcuts, trimmings, and recycled.This ambivalence is also crucial to understanding the affectionate relationship the Australian public have with Vegemite, a relationship that appears to exist in spite of the product’s unpalatable origins in waste. A study of Vegemite reveals that consumers can be comfortable with waste, even to the point of eating recycled waste, as long as that fact remains hidden and unmentioned. In Vegemite’s case not only has the product’s connection to waste been rendered invisible, it has been largely kept out of sight despite considerable media and other attention focusing on the product. Recycling Food Waste into Food ProductRecent work such as Elizabeth Royte’s Garbage Land and Tristram Stuart’s Waste make waste uncomfortably visible, outlining how much waste, and food waste in particular, the Western world generates and how profligately this is disposed of. Their aim is clear: a call to less extravagant and more sustainable practices. The relatively recent interest in reducing our food waste has, of course, introduced more complexity into a simple linear movement from the creation of a food product, to its acquisition or purchase, and then to its consumption and/or its disposal. Moreover, the recycling, reuse and repurposing of what has previously been discarded as waste is reconfiguring the whole idea of what waste is, as well as what value it has. The initiatives that seem to offer the most promise are those that reconfigure the way waste is understood. However, it is not only the process of transforming waste from an abject nuisance into a valued product that is central here. It is also necessary to reconfigure people’s acculturated perceptions of, and reactions to waste. Food waste is generated during all stages of the food cycle: while the raw materials are being grown; while these are being processed; when the resulting food products are being sold; when they are prepared in the home or other kitchen; and when they are only partly consumed. Until recently, the food industry in the West almost universally produced large volumes of solid and liquid waste that not only posed problems of disposal and pollution for the companies involved, but also represented a reckless squandering of total food resources in terms of both nutrient content and valuable biomass for society at large. While this is currently changing, albeit slowly, the by-products of food processing were, and often are, dumped (Stuart). In best-case scenarios, various gardening, farming and industrial processes gather household and commercial food waste for use as animal feed or as components in fertilisers (Delgado et al; Wang et al). This might, on the surface, appear a responsible application of waste, yet the reality is that such food waste often includes perfectly good fruit and vegetables that are not quite the required size, shape or colour, meat trimmings and products (such as offal) that are completely edible but extraneous to processing need, and other high grade product that does not meet certain specifications—such as the mountains of bread crusts sandwich producers discard (Hickman), or food that is still edible but past its ‘sell by date.’ In the last few years, however, mounting public awareness over the issues of world hunger, resource conservation, and the environmental and economic costs associated with food waste has accelerated efforts to make sustainable use of available food supplies and to more efficiently recycle, recover and utilise such needlessly wasted food product. This has fed into and led to multiple new policies, instances of research into, and resultant methods for waste handling and treatment (Laufenberg et al). Most straightforwardly, this involves the use or sale of offcuts, trimmings and unwanted ingredients that are “often of prime quality and are only rejected from the production line as a result of standardisation requirements or retailer specification” from one process for use in another, in such processed foods as soups, baby food or fast food products (Henningsson et al. 505). At a higher level, such recycling seeks to reclaim any reusable substances of significant food value from what could otherwise be thought of as a non-usable waste product. Enacting this is largely dependent on two elements: an available technology and being able to obtain a price or other value for the resultant product that makes the process worthwhile for the recycler to engage in it (Laufenberg et al). An example of the latter is the use of dehydrated restaurant food waste as a feedstuff for finishing pigs, a reuse process with added value for all involved as this process produces both a nutritious food substance as well as a viable way of disposing of restaurant waste (Myer et al). In Japan, laws regarding food waste recycling, which are separate from those governing other organic waste, are ensuring that at least some of food waste is being converted into animal feed, especially for the pigs who are destined for human tables (Stuart). Other recycling/reuse is more complex and involves more lateral thinking, with the by-products from some food processing able to be utilised, for instance, in the production of dyes, toiletries and cosmetics (Henningsson et al), although many argue for the privileging of food production in the recycling of foodstuffs.Brewing is one such process that has been in the reuse spotlight recently as large companies seek to minimise their waste product so as to be able to market their processes as sustainable. In 2009, for example, the giant Foster’s Group (with over 150 brands of beer, wine, spirits and ciders) proudly claimed that it recycled or reused some 91.23% of 171,000 tonnes of operational waste, with only 8.77% of this going to landfill (Foster’s Group). The treatment and recycling of the massive amounts of water used for brewing, rinsing and cooling purposes (Braeken et al.; Fillaudeaua et al.) is of significant interest, and is leading to research into areas as diverse as the development microbial fuel cells—where added bacteria consume the water-soluble brewing wastes, thereby cleaning the water as well as releasing chemical energy that is then converted into electricity (Lagan)—to using nutrient-rich wastewater as the carbon source for creating bioplastics (Yu et al.).In order for the waste-recycling-reuse loop to be closed in the best way for securing food supplies, any new product salvaged and created from food waste has to be both usable, and used, as food (Stuart)—and preferably as a food source for people to consume. There is, however, considerable consumer resistance to such reuse. Resistance to reusing recycled water in Australia has been documented by the CSIRO, which identified negative consumer perception as one of the two primary impediments to water reuse, the other being the fundamental economics of the process (MacDonald & Dyack). This consumer aversion operates even in times of severe water shortages, and despite proof of the cleanliness and safety of the resulting treated water. There was higher consumer acceptance levels for using stormwater rather than recycled water, despite the treated stormwater being shown to have higher concentrations of contaminants (MacDonald & Dyack). This reveals the extent of public resistance to the potential consumption of recycled waste product when it is labelled as such, even when this consumption appears to benefit that public. Vegemite: From Waste Product to Australian IconIn this context, the savoury yeast spread Vegemite provides an example of how food processing waste can be repurposed into a new food product that can gain a high level of consumer acceptability. It has been able to retain this status despite half a century of Australian gastronomic multiculturalism and the wide embrace of a much broader range of foodstuffs. Indeed, Vegemite is so ubiquitous in Australian foodways that it is recognised as an international superbrand, a standing it has been able to maintain despite most consumers from outside Australasia finding it unpalatable (Rozin & Siegal). However, Vegemite’s long product history is one in which its origin as recycled waste has been omitted, or at the very least, consistently marginalised.Vegemite’s history as a consumer product is narrated in a number of accounts, including one on the Kraft website, where the apocryphal and actual blend. What all these narratives agree on is that in the early 1920s Fred Walker—of Fred Walker and Company, Melbourne, canners of meat for export and Australian manufacturers of Bonox branded beef stock beverage—asked his company chemist to emulate Marmite yeast extract (Farrer). The imitation product was based, as was Marmite, on the residue from spent brewer’s yeast. This waste was initially sourced from Melbourne-based Carlton & United Breweries, and flavoured with vegetables, spices and salt (Creswell & Trenoweth). Today, the yeast left after Foster Group’s Australian commercial beer making processes is collected, put through a sieve to remove hop resins, washed to remove any bitterness, then mixed with warm water. The yeast dies from the lack of nutrients in this environment, and enzymes then break down the yeast proteins with the effect that vitamins and minerals are released into the resulting solution. Using centrifugal force, the yeast cell walls are removed, leaving behind a nutrient-rich brown liquid, which is then concentrated into a dark, thick paste using a vacuum process. This is seasoned with significant amounts of salt—although less today than before—and flavoured with vegetable extracts (Richardson).Given its popularity—Vegemite was found in 2009 to be the third most popular brand in Australia (Brand Asset Consulting)—it is unsurprising to find that the product has a significant history as an object of study in popular culture (Fiske et al; White), as a marker of national identity (Ivory; Renne; Rozin & Siegal; Richardson; Harper & White) and as an iconic Australian food, brand and product (Cozzolino; Luck; Khamis; Symons). Jars, packaging and product advertising are collected by Australian institutions such as Sydney’s Powerhouse Museum and the National Museum of Australia in Canberra, and are regularly included in permanent and travelling exhibitions profiling Australian brands and investigating how a sense of national identity is expressed through identification with these brands. All of this significant study largely focuses on how, when and by whom the product has been taken up, and how it has been consumed, rather than its links to waste, and what this circumstance could add to current thinking about recycling of food waste into other food products.It is worth noting that Vegemite was not an initial success in the Australian marketplace, but this does not seem due to an adverse public perception to waste. Indeed, when it was first produced it was in imitation of an already popular product well-known to be made from brewery by-products, hence this origin was not an issue. It was also introduced during a time when consumer relationships to waste were quite unlike today, and thrifty re-use of was a common feature of household behaviour. Despite a national competition mounted to name the product (Richardson), Marmite continued to attract more purchasers after Vegemite’s launch in 1923, so much so that in 1928, in an attempt to differentiate itself from Marmite, Vegemite was renamed “Parwill—the all Australian product” (punning on the idea that “Ma-might” but “Pa-will”) (White 16). When this campaign was unsuccessful, the original, consumer-suggested name was reinstated, but sales still lagged behind its UK-owned prototype. It was only after remaining in production for more than a decade, and after two successful marketing campaigns in the second half of the 1930s that the Vegemite brand gained some market traction. The first of these was in 1935 and 1936, when a free jar of Vegemite was offered with every sale of an item from the relatively extensive Kraft-Walker product list (after Walker’s company merged with Kraft) (White). The second was an attention-grabbing contest held in 1937, which invited consumers to compose Vegemite-inspired limericks. However, it was not the nature of the product itself or even the task set by the competition which captured mass attention, but the prize of a desirable, exotic and valuable imported Pontiac car (Richardson 61; Superbrands).Since that time, multinational media company, J Walter Thompson (now rebranded as JWT) has continued to manage Vegemite’s marketing. JWT’s marketing has never looked to Vegemite’s status as a thrifty recycler of waste as a viable marketing strategy, even in periods of austerity (such as the Depression years and the Second World War) or in more recent times of environmental concern. Instead, advertising copywriting and a recurrent cycle of cultural/media memorialisation have created a superbrand by focusing on two factors: its nutrient value and, as the brand became more established, its status as national icon. Throughout the regular noting and celebration of anniversaries of its initial invention and launch, with various commemorative events and products marking each of these product ‘birthdays,’ Vegemite’s status as recycled waste product has never been more than mentioned. Even when its 60th anniversary was marked in 1983 with the laying of a permanent plaque in Kerferd Road, South Melbourne, opposite Walker’s original factory, there was only the most passing reference to how, and from what, the product manufactured at the site was made. This remained the case when the site itself was prioritised for heritage listing almost twenty years later in 2001 (City of Port Phillip).Shying away from the reality of this successful example of recycling food waste into food was still the case in 1990, when Kraft Foods held a nationwide public campaign to recover past styles of Vegemite containers and packaging, and then donated their collection to Powerhouse Museum. The Powerhouse then held an exhibition of the receptacles and the historical promotional material in 1991, tracing the development of the product’s presentation (Powerhouse Museum), an occasion that dovetailed with other nostalgic commemorative activities around the product’s 70th birthday. Although the production process was noted in the exhibition, it is noteworthy that the possibilities for recycling a number of the styles of jars, as either containers with reusable lids or as drinking glasses, were given considerably more notice than the product’s origins as a recycled product. By this time, it seems, Vegemite had become so incorporated into Australian popular memory as a product in its own right, and with such a rich nostalgic history, that its origins were no longer of any significant interest or relevance.This disregard continued in the commemorative volume, The Vegemite Cookbook. With some ninety recipes and recipe ideas, the collection contains an almost unimaginably wide range of ways to use Vegemite as an ingredient. There are recipes on how to make the definitive Vegemite toast soldiers and Vegemite crumpets, as well as adaptations of foreign cuisines including pastas and risottos, stroganoffs, tacos, chilli con carne, frijole dip, marinated beef “souvlaki style,” “Indian-style” chicken wings, curries, Asian stir-fries, Indonesian gado-gado and a number of Chinese inspired dishes. Although the cookbook includes a timeline of product history illustrated with images from the major advertising campaigns that runs across 30 pages of the book, this timeline history emphasises the technological achievement of Vegemite’s creation, as opposed to the matter from which it orginated: “In a Spartan room in Albert Park Melbourne, 20 year-old food technologist Cyril P. Callister employed by Fred Walker, conducted initial experiments with yeast. His workplace was neither kitchen nor laboratory. … It was not long before this rather ordinary room yielded an extra-ordinary substance” (2). The Big Vegemite Party Book, described on its cover as “a great book for the Vegemite fan … with lots of old advertisements from magazines and newspapers,” is even more openly nostalgic, but similarly includes very little regarding Vegemite’s obviously potentially unpalatable genesis in waste.Such commemorations have continued into the new century, each one becoming more self-referential and more obviously a marketing strategy. In 2003, Vegemite celebrated its 80th birthday with the launch of the “Spread the Smile” campaign, seeking to record the childhood reminisces of adults who loved Vegemite. After this, the commemorative anniversaries broke free from even the date of its original invention and launch, and began to celebrate other major dates in the product’s life. In this way, Kraft made major news headlines when it announced that it was trying to locate the children who featured in the 1954 “Happy little Vegemites” campaign as part of the company’s celebrations of the 50th anniversary of the television advertisement. In October 2006, these once child actors joined a number of past and current Kraft employees to celebrate the supposed production of the one-billionth jar of Vegemite (Rood, "Vegemite Spreads" & "Vegemite Toasts") but, once again, little about the actual production process was discussed. In 2007, the then iconic marching band image was resituated into a contemporary setting—presumably to mobilise both the original messages (nutritious wholesomeness in an Australian domestic context) as well as its heritage appeal. Despite the real interest at this time in recycling and waste reduction, the silence over Vegemite’s status as recycled, repurposed food waste product continued.Concluding Remarks: Towards Considering Waste as a ResourceIn most parts of the Western world, including Australia, food waste is formally (in policy) and informally (by consumers) classified, disposed of, or otherwise treated alongside garden waste and other organic materials. Disposal by individuals, industry or local governments includes a range of options, from dumping to composting or breaking down in anaerobic digestion systems into materials for fertiliser, with food waste given no special status or priority. Despite current concerns regarding the security of food supplies in the West and decades of recognising that there are sections of all societies where people do not have enough to eat, it seems that recycling food waste into food that people can consume remains one of the last and least palatable solutions to these problems. This brief study of Vegemite has attempted to show how, despite the growing interest in recycling and sustainability, the focus in both the marketing of, and public interest in, this iconic and popular product appears to remain rooted in Vegemite’s nutrient and nostalgic value and its status as a brand, and firmly away from any suggestion of innovative and prudent reuse of waste product. That this is so for an already popular product suggests that any initiatives that wish to move in this direction must first reconfigure not only the way waste itself is seen—as a valuable product to be used, rather than as a troublesome nuisance to be disposed of—but also our own understandings of, and reactions to, waste itself.Acknowledgements Many thanks to the reviewers for their perceptive, useful, and generous comments on this article. All errors are, of course, my own. The research for this work was carried out with funding from the Faculty of Arts, Business, Informatics and Education, CQUniversity, Australia.ReferencesAnderson, C. T. “Sacred Waste: Ecology, Spirit, and the American Garbage Poem.” Interdisciplinary Studies in Literature and Environment 17 (2010): 35-60.Blake, J. The Vegemite Cookbook: Delicious Recipe Ideas. Melbourne: Ark Publishing, 1992.Braeken, L., B. Van der Bruggen and C. Vandecasteele. “Regeneration of Brewery Waste Water Using Nanofiltration.” Water Research 38.13 (July 2004): 3075-82.City of Port Phillip. “Heritage Recognition Strategy”. Community and Services Development Committee Agenda, 20 Aug. 2001.Cozzolino, M. Symbols of Australia. Ringwood: Penguin, 1980.Creswell, T., and S. Trenoweth. “Cyril Callister: The Happiest Little Vegemite”. 1001 Australians You Should Know. North Melbourne: Pluto Press, 2006. 353-4.Delgado, C. L., M. Rosegrant, H. Steinfled, S. Ehui, and C. Courbois. Livestock to 2020: The Next Food Revolution. Food, Agriculture, and the Environment Discussion Paper, 28. Washington, D. C.: International Food Policy Research Institute, 2009.Farrer, K. T. H. “Callister, Cyril Percy (1893-1949)”. Australian Dictionary of Biography 7. Melbourne: Melbourne University Press, 1979. 527-8.Fillaudeaua, L., P. Blanpain-Avetb and G. Daufinc. “Water, Wastewater and Waste Management in Brewing Industries”. Journal of Cleaner Production 14.5 (2006): 463-71.Fiske, J., B. Hodge and G. Turner. Myths of Oz: Reading Australian Popular Culture. Sydney: Allen & Unwin, 1987.Foster’s Group Limited. Transforming Fosters: Sustainability Report 2009.16 June 2010 ‹http://fosters.ice4.interactiveinvestor.com.au/Fosters0902/2009SustainabilityReport/EN/body.aspx?z=1&p=-1&v=2&uid›.George Patterson Young and Rubicam (GPYR). Brand Asset Valuator, 2009. 6 Aug. 2010 ‹http://www.brandassetconsulting.com/›.Harper, M., and R. White. Symbols of Australia. UNSW, Sydney: UNSW Press, 2010.Henningsson, S., K. Hyde, A. Smith, and M. Campbell. “The Value of Resource Efficiency in the Food Industry: A Waste Minimisation Project in East Anglia, UK”. Journal of Cleaner Production 12.5 (June 2004): 505-12.Hickman, M. “Exposed: The Big Waste Scandal”. The Independent, 9 July 2009. 18 June 2010 ‹http://www.independent.co.uk/life-style/food-and-drink/features/exposed-the-big-waste-scandal-1737712.html›.Ivory, K. “Australia’s Vegemite”. Hemispheres (Jan. 1998): 83-5.Khamis, S. “Buy Australiana: Diggers, Drovers and Vegemite”. Write/Up. Eds. E. Hartrick, R. Hogg and S. Supski. St Lucia: API Network and UQP, 2004. 121-30.Lagan, B. “Australia Finds a New Power Source—Beer”. The Times 5 May 2007. 18 June 2010 ‹http://www.timesonline.co.uk/tol/news/science/article1749835.ece›.Laufenberg, G., B. Kunz and M. Nystroem. “Transformation of Vegetable Waste into Value Added Products: (A) The Upgrading Concept; (B) Practical Implementations [review paper].” Bioresource Technology 87 (2003): 167-98.Luck, P. Australian Icons: Things That Make Us What We Are. Melbourne: William Heinemann Australia, 1992.MacDonald, D. H., and B. Dyack. Exploring the Institutional Impediments to Conservation and Water Reuse—National Issues: Report for the Australian Water Conservation and Reuse Research Program. March. CSIRO Land and Water, 2004.Myer, R. O., J. H. Brendemuhl, and D. D. Johnson. “Evaluation of Dehydrated Restaurant Food Waste Products as Feedstuffs for Finishing Pigs”. Journal of Animal Science 77.3 (1999): 685-92.Pittaway, M. The Big Vegemite Party Book. Melbourne: Hill of Content, 1992. Powerhouse Museum. Collection & Research. 16 June 2010.Renne, E. P. “All Right, Vegemite!: The Everyday Constitution of an Australian National Identity”. Visual Anthropology 6.2 (1993): 139-55.Richardson, K. “Vegemite, Soldiers, and Rosy Cheeks”. Gastronomica 3.4 (Fall 2003): 60-2.Rood, D. “Vegemite Spreads the News of a Happy Little Milestone”. Sydney Morning Herald 6 Oct. 2008. 16 March 2010 ‹http://www.smh.com.au/news/national/vegemite-spreads-the-news-of-a-happy-little-milestone/2008/10/05/1223145175371.html›.———. “Vegemite Toasts a Billion Jars”. The Age 6 Oct. 2008. 16 March 2010 ‹http://www.theage.com.au/national/vegemite-toasts-a-billion-jars-20081005-4uc1.html›.Royte, E. Garbage Land: On the Secret Trail of Trash. New York: Back Bay Books, 2006.Rozin, P., and M. Siegal “Vegemite as a Marker of National Identity”. Gastronomica 3.4 (Fall 2003): 63-7.Scanlan, J. On Garbage. London: Reaktion Books, 2005.Stuart, T. Waste: Uncovering the Global Food Scandal. New York: W. W. Norton & Company, 2009.Superbrands. Superbrands: An Insight into Many of Australia’s Most Trusted Brands. Vol IV. Ingleside, NSW: Superbrands, 2004.Symons, M. One Continuous Picnic: A History of Eating in Australia. Ringwood: Penguin Books, 1982.Wang, J., O. Stabnikova, V. Ivanov, S. T. Tay, and J. Tay. “Intensive Aerobic Bioconversion of Sewage Sludge and Food Waste into Fertiliser”. Waste Management & Research 21 (2003): 405-15.White, R. S. “Popular Culture as the Everyday: A Brief Cultural History of Vegemite”. Australian Popular Culture. Ed. I. Craven. Cambridge UP, 1994. 15-21.Yu, P. H., H. Chua, A. L. Huang, W. Lo, and G. Q. Chen. “Conversion of Food Industrial Wastes into Bioplastics”. Applied Biochemistry and Biotechnology 70-72.1 (March 1998): 603-14.

APA, Harvard, Vancouver, ISO, and other styles

41

Stead, Naomi. "White cubes and red knots." M/C Journal 5, no.3 (July1, 2002). http://dx.doi.org/10.5204/mcj.1961.

Full text

Abstract:

The question of colour in architecture offers many potential points of entry. Taking an historical standpoint, one could discuss the use of bright colour in ancient Greek and Roman architecture, the importance of brilliantly coloured mosaic and stained glass to sacred architecture in the Byzantine and medieval periods, and the primacy of colour in non-Western architectural traditions both ancient and modern. It would be possible to trace prohibitions against the use of applied colour, derived from late 18th century notions of architectural morality—ideals demanding authenticity, honesty and directness in the expression of structure, function and materials. This puritan strand could be pursued into the modern movement, to its quasi-pathological attachment to whiteness.1 It would also be possible to note a trend which ran counter to dominant modernist attitudes to colour, in the eclectic 'neon historicism' of so-called 'post-modernist' architecture. But while it would be remiss of me not to acknowledge the history of colour in architecture in passing, it has been well addressed elsewhere, and is in any case outside the scope of this paper.2 What is significant is that this history is marked throughout by many of the same, largely unspoken, prohibitions against colour that can be traced across other cultural realms—that which David Batchelor has described as a history of 'chromophobia'. As Batchelor writes; 'Chromophobia manifests itself in the many and varied attempts to purge colour from culture, to diminish its significance, to deny its complexity…. [T]his purging of colour is usually accomplished in one of two ways. In the first, colour is made out to be the property of some 'foreign' body—usually the feminine, the oriental, the primitive, the infantile, the vulgar, the queer or the pathological. In the second, colour is relegated to the realm of the superficial, the supplementary, the inessential or the cosmetic. In one, colour is regarded as alien and therefore dangerous; in the other it is perceived merely as a secondary quantity of experience, and thus unworthy or serious consideration.'3 Numerous examples of the attempt to 'purge' colour can be identified throughout the history of architecture in the modern period. The mode of chromophobia particular to architecture may be summarised thus: colour in architecture has been associated with illusion and frivolity, and thus with decoration—it has been seen as being excess or supplementary to 'real' architecture.4 Discussions of colour in architecture can never be completely distinguished from discussions of ornament, or of materials and materiality. Colour is not necessarily a problem in itself—it is acceptable, for instance, when it is inherent to the material or to its weathering process, as in the bright green of copper verdigris. It is the application of colour, in the form of paint or stain, that raises questions of authenticity. The importance of surface and colour have been consistently made subordinate to architectural form; and the idea that colour is acceptable in interiors but not exteriors is merely the expression of another hierarchy, linking and demoting the trivial, contingent, feminised interior in favour of universal, masculinized, heroic external form. In the modern period, a work of 'serious' Architecture (as opposed to vernacular, commercial, or 'popular' architecture) has most often either been white, or coloured in the subdued palette afforded by the inherent characteristics of 'natural' materials.5 This is nowhere more true than in institutional architecture generally, and museum architecture in particular. Museums and their stake in the neutral monochrome The museum as an institution has traditionally functioned as a symbol of the establishment and its authority, a symbolic role often expressed in conventionally monumental architecture. This monumentality has, in turn, been reinforced by prestigious materials: much of the dignity and status of institutional architecture is taken from materials valued for their expense, rarity, or durability.6 Museum buildings are required to last, and thus they must not only use enduring materials, but materials which demonstrate their durability by being self-finishing in their natural, apparently neutral, state. The very idea that 'natural' materials are also somehow 'neutral' opens onto another, more ideological investment that the museum has in avoiding colour. Museums have long held a stake in the idea of an objective stance, and maintained the pretence of an unmediated presentation of historical fact. The notion of the museum as 'white cube' embodies all of this—the idea of the white cube, with its aformal form and achromatic colour, signifies purity and transcendence. Just as the whiteness of modern architecture was a continuation of the hygienic whiteness of doctor's coat, bathroom tiles, and hospital walls, the whiteness of the museum signifies clinical objectivity.7 It also, perhaps more significantly, stands for the ideal of the tabula rasa, the clean slate upon which the documentary evidence of art, history, or any other metanarrative could be methodically examined and arranged. For the museum, abandoning the neutrality of its public presentation may also mean a symbolic abandonment of objectivity. It would mean, if not a surrender to partiality, at least the admission of partiality—and the renunciation of universal whiteness for the specificities of colour. In the modern period, applied colour can never be neutral, but is read as mask, disguise, or stain. In the postmodern period, the discourse of the 'new museology' has challenged and discredited many of the ideological complicities of the idea of the museum as 'white box', linked as they are with a suspiciously absolutist rhetoric of abstract purity. Museums have increasingly begun to render explicit their role in the re-presentation of history, and to work at recontextualising ideas and artefacts. But even if a critical and self-reflexive stance is now more common in museological practice, it has taken much longer to begin to inform museum architecture. It would be a very courageous museum indeed that was willing to cash in all of the chips of its cultural authority, of which prestigious monumental architecture is a particularly powerful source. Most museums are still, if not white, at least respectably neutral, inside and out. But not so the National Museum of Australia (NMA). This museum, in its polychromatic formal complexity, could hardly be further from a 'white cube' museum. The National Museum of Australia: flirting with the flippant The NMA is housed in a loud and gregarious building. From its controversial strategy of literally appropriating elements from other canonical modernist works, through the coded messages of the Braille patterns on its surface, to the device of the extruded string and red 'knot' which passes through and around the building's form, it is relentless in its challenge to conventional institutional architecture. This is nowhere more true than in its colouration—there is hardly a neutral tone in sight. For that matter, there is hardly a 'natural' material in sight either—the majority of the building is constructed from pre-formed aluminium panelling in grey, yellow, red and khaki, crossed in places by sweeping calligraphic symbols.8 The dramatic aerial loop at the museum's entry is white and bright orange. There are walls of black dimpled pre-formed concrete, blue painted poles (get it?), a 'Mexican wave' of multicoloured steel sheets, and of course the richly cacophonous Garden of Australia Dreams. There are also some deliberate plays on colour symbolism—Le Corbusier's gleaming white modernist classic, the Villa Savoye, is reversed and reconstituted in black, corrugated steel. The fact that this forms part of the Institute of Aboriginal and Torres Strait Islander Studies is a hint of the building's clear, even dangerously frank, employment of colour symbolism. Given the architects previous work, we can safely assume that in this case, as elsewhere in the building, the choice of colours is calculated for maximum rhetorical effect. But I am less concerned here with the specific ploys of the architects than with the ways in which the building's reception has been conditioned by its employment of colour, specifically the ways in which it has been construed as populist. The NMA has polarised the architectural community in Australia. While much of the comment directed at the building has centred around its contravention of standards of taste and propriety in civic architecture, I would argue that this is only the symptom of a deeper reaction against its apparent frivolity, as signified most strongly by its colour. This is exemplified in a critique of the building by Stephen Frith, a respected Canberra academic. Concluding a polemical review in the Canberra Times, Frith asks: But why such tongue-lashings and breast-beatings over what has quickly established itself as a happy theme park to mediocrity? Surely its condoning of the ruthless kitsch of petty capitalism in its imagery and finishes provides for some spectre of merit? The problem becomes one of the civic domain in which architecture and its rhetoric is interpreted. For a supposedly public work, the museum is an intensely private building, privately encoded with in-jokes, and in the end hugely un-funny... The confection of cheap cladding and plasterboard is a spurious sideshow of magpie borrowings passing themselves off as cultural reference...9 Everything in this passage decries what Frith reads as the NMA's verisimilitude of popularity - the reference to theme-parks, sideshows, commercialism - a confection constructed with poor quality materials and finishes, which nevertheless flirts 'pretentiously' with the canon of modern architecture. To Frith the building reads not as a cheap and cheerful reflection of the Australian vernacular, but as a demeaning attempt to raise a laugh from the elite at the expense of the uncomprehending masses. His complaint is thus two-fold—that the building has insufficient gravitas, and that this is compounded rather than redeemed by the fact that it is not truly popular at all, but rather 'intensely private'. There is an important distinction to be made here, then, between 'populism' and 'popularity'. Populism has the negative connotation of deliberately seeking popular acceptance at the cost of quality, intellectual rigour, or formal aesthetic value. 'Popularity' still retains its more neutral modern sense, either of actual public involvement, or of things that are socially recognised as popular. In architecture, populism is already hedged about with prohibitions springing from the idea that a deliberately populist architecture is somehow fraudulent. A piece of serious, civic, monumental architecture should neither set out expressly to be popular, nor to look like it is, so the logic goes: if a work of high architecture happens to gain popular acclaim, then that is a happy accident. But there are significant reasons why such popularity must be seen to be incidental to other, more lofty concerns. Given that colour is seen to be 'popular', a highly coloured building is thus assumed to be 'lowering' itself in order to appeal to popular taste. Old systems of thought endure, and both museums and architecture are each subject to an unspoken hierarchy that still sees 'populism', if not actual popularity, as inferior. Conclusions: colour as the sign of a critical engagement But there is another possible reading of the NMA's apparent populism. I would argue that the building in fact presents and problematises the question of popularity in formal architectural terms. This leads to a proposition: that there is a 'look' of populism that exists independently of any intended or actual popularity, or even a connection with popular culture. I would argue that the NMA opens an elaborate play on this 'look' of the popular, and that it does so by manipulating certain key aesthetic devices: literal and figurative elements, visual jokes, non-orthogonal forms, and most significantly, bright and mixed colour. Such devices carry a weight of expectation and association, they cause a building to be read or socially recognised as being populist, largely as a result of pre-existing dichotomies between 'high' and 'low' art. In this conception the NMA, turning the modernist prohibition on its head, uses colour as the deliberately frivolous disguise of a profoundly serious intent. Rather than concealing the absence of meaning, it conceals an overabundance of meaning—a despairing accumulation of piled up allegories, codes and fragments. It is thus deeply ironic that the NMA has been read as a light, flippant, and populist confection, since I would argue that it could hardly be further from being those things. Rather than taking the usual path, of seeking cultural authority through allusion to traditional monumental architecture, the NMA makes perverse references to the seemingly trivial, commercial, and populist. The reasons why the architects might want the building to be (mis)read in this way are complex. But by renouncing the aesthetic trappings of a serious institution, the NMA reveals the very superficiality of such trappings. Furthermore, by renouncing the 'look of authority' in favour of colour, frivolity, and apparent populism, it introduces a note of doubt. Could the building, and thus the institution - a national museum, remember, charged with representing the nation and placed in the national capital - really be as flippant as it seems? Or is there some more subtle game afoot, a subversive questioning of accepted notions of Australian national history and national identity? I would argue that this is so. In the NMA, then, colour is the sign of a critical engagement. It positions the building itself as a discourse or discussion, not only of architectural colour as conferring inferiority and flippancy, but of a lack of colour as conferring authority and legitimacy. Of course, it is precisely because of architecture's history of chromophobia that colour can itself become a tool for subversiveness, provide an invitation to alternative readings, and collapse unspoken hierarchies. In this respect, the colour in and of the NMA provides an emblem of that which has long been marginalised in architecture, and in culture more generally. Notes 1. Mark Wigley writes that the primacy of whiteness in high modernist architecture (particularly the work of Le Corbusier) lies partly in the removal of decoration. '[The] erasure of decoration is portrayed [by Le Corbusier] as the necessary gesture of a civilized society. Indeed, civilization is defined as the elimination of the 'superfluous' in favour of the 'essential' and the paradigm of inessential surplus is decoration. Its removal liberates a new visual order. Echoing an argument at least as old as Western philosophy, Le Corbusier describes civilization as a gradual passage from the sensual to the intellectual, from the tactile to the visual. Decoration's 'caresses of the senses' are progressively abandoned in favour of the visual harmony of proportion.' Mark Wigley, White Walls, Designer Dresses: The Fashioning of Modern Architecture, MIT Press, Cambridge, Mass., 1995, pp. 2-3 2. See for example John Gage's superb and authoritative history of the use and meaning of colour, Colour and Meaning: Art, Science and Symbolism, Thames and Hudson, London, 1999. For a survey of the use of colour in architecture, see Tom Porter, Architectural Colour: A Design Guide to Using Colour on Buildings, Whitney Library of Design, New York, 1982, or the more recent Architectural Design Profile number 120: Colour in Architecture, AD, vol. 66, no 3/4, March/April 1996. These are only a few examples of the available literature. 3. David Batchelor, Chromophobia, Reaktion Books, London, 2000, pp. 22-23. 4. The notable exception to this - the architecture of schools is emblematic in itself: colour is appealing to children, so the logic would go, because they have undeveloped, 'primitive' tastes. 5. William Braham has perceptively examined the allure of 'natural' materials and colours in the modern period. He writes that 'the natural can only be understood as a somewhat flexible category of finishes, not by a single principle of use, manufacture, or appearance. The fact that a family of paint colours neutrals, ochres, and other earth colours fit within the definition of natural is only partly explained by their original manufacture with naturally occurring mineral compounds. Though they are opaque surface coatings, they resemble the tones produced in natural materials by weathering.' He goes on to say that the 'natural/neutral palette' is characterised by 'the difficult pursuit of authenticity', and this question goes indeed to the heart of the issue of colour in architecture. William W. Braham, 'A Wall of Books: The Gender of Natural Colours in Modern Architecture', JAE Journal of Architectural Education, vol. 53. No.1, September 1999, p. 10. 6. But perhaps more important than actual durability in institutional architecture is the appearance of durability, and this appearance is undermined by protective treatments like paint, whether coloured or not. Materials which are seen as flimsy or fragile may as well be coloured, so the logic goes, since they require constant re-painting anyway, and since it fits their low status. 7. Mark Wigley, White Walls, Designer Dresses: The Fashioning of Modern Architecture, MIT Press, Cambridge, Mass., 1995, p. 5. 8. Aluminium panelling is a new technology and a new material one that was unknown in the high modernist period but which is becoming increasingly ubiquitous today. The fact that aluminium panelling is coloured during the manufacturing process opens a new and interesting question: is this colour inherent, or is it simply applied earlier in the building process? Is it, in other words, an 'honest' or a 'dishonest' colour? Given that aluminium does have its own colour, and that it can be lacquered or anodised to retain that colour, it seems that the aluminium panelling of the NMA have been received as 'dishonest'. 9. Frith, 'A monument to lost opportunity', The Canberra Times, 20 March 2001 Citation reference for this article MLA Style Stead, Naomi. "White cubes and red knots" M/C: A Journal of Media and Culture 5.3 (2002). [your date of access] < http://www.media-culture.org.au/0207/whitecubes.php>. Chicago Style Stead, Naomi, "White cubes and red knots" M/C: A Journal of Media and Culture 5, no. 3 (2002), < http://www.media-culture.org.au/0207/whitecubes.php> ([your date of access]). APA Style Stead, Naomi. (2002) White cubes and red knots. M/C: A Journal of Media and Culture 5(3). < http://www.media-culture.org.au/0207/whitecubes.php> ([your date of access]).

APA, Harvard, Vancouver, ISO, and other styles

42

Elliott, Susie. "Irrational Economics and Regional Cultural Life." M/C Journal 22, no.3 (June19, 2019). http://dx.doi.org/10.5204/mcj.1524.

Full text

Abstract:

IntroductionAustralia is at a particular point in its history where there is a noticeable diaspora of artists and creative practitioners away from the major capitals of Sydney and Melbourne (in particular), driven in no small part by ballooning house prices of the last eight years. This has meant big changes for some regional spaces, and in turn, for the face of Australian cultural life. Regional cultural precincts are forming with tourist flows, funding attention and cultural economies. Likewise, there appears to be growing consciousness in the ‘art centres’ of Melbourne and Sydney of interesting and relevant activities outside their limits. This research draws on my experience as an art practitioner, curator and social researcher in one such region (Castlemaine in Central Victoria), and particularly from a recent interview series I have conducted in collaboration with art space in that region, Wide Open Road Art. In this, 23 regional and city-based artists were asked about the social, economic and local conditions that can and have supported their art practices. Drawing from these conversations and Bourdieu’s ideas around cultural production, the article suggests that authentic, diverse, interesting and disruptive creative practices in Australian cultural life involve the increasingly pressing need for security while existing outside the modern imperative of high consumption; of finding alternative ways to live well while entering into the shared space of cultural production. Indeed, it is argued that often it is the capacity to defy key economic paradigms, for example of ‘rational (economic) self-interest’, that allows creative life to flourish (Bourdieu Field; Ley “Artists”). While regional spaces present new opportunities for this, there are pitfalls and nuances worth exploring.Changes in Regional AustraliaAustralia has long been an urbanising nation. Since Federation our cities have increased from a third to now constituting two-thirds of the country’s total population (Gray and Lawrence 6; ABS), making us one of the most urbanised countries in the world. Indeed, as machines replaced manual labour on farms; as Australia’s manufacturing industry began its decline; and as young people in particular left the country for city universities (Gray and Lawrence), the post-war industrial-economic boom drove this widespread demographic and economic shift. In the 1980s closures of regional town facilities like banks, schools and hospitals propelled widespread belief that regional Australia was in crisis and would be increasingly difficult to sustain (Rentschler, Bridson, and Evans; Gray and Lawrence 2; Barr et al.; ABS). However, the late 1990s and early 21st century saw a turnaround that has been referred to by some as the rise of the ‘sea change’. That is, widespread renewed interest and idealisation of not just coastal areas but anywhere outside the city (Murphy). It was a simultaneous pursuit of “a small ‘a’ alternative lifestyle” and escape from rising living costs in urban areas, especially for the unemployed, single parents and those with disabilities (Murphy). This renewed interest has been sustained. The latest wave, or series of waves, have coincided with the post-GFC house price spike, of cheap credit and lenient lending designed to stimulate the economy. This initiative in part led to Sydney and Melbourne median dwelling prices rising by up to 114% in eight years (Scutt 2017), which alone had a huge influence on who was able to afford to live in city areas and who was not. Rapid population increases and diminished social networks and familial support are also considered drivers that sent a wave of people (a million since 2011) towards the outer fringes of the cities and to ‘commuter belt’ country towns (Docherty; Murphy). While the underprivileged are clearly most disadvantaged in what has actually been a global development process (see Jayne on this, and on the city as a consumer itself), artists and creatives are also a unique category who haven’t fared well with hyper-urbanisation (Ley “Artists”). Despite the class privilege that often accompanies such a career choice, the economic disadvantage art professions often involve has seen a diaspora of artists moving to regional areas, particularly those in the hinterlands around and train lines to major centres. We see the recent ‘rise of a regional bohemia’ (Regional Australia Institute): towns like Toowoomba, Byron Bay, Surf Coast, Gold Coast-Tweed, Kangaroo Valley, Wollongong, Warburton, Bendigo, Tooyday, New Norfolk, and countless more being re-identified as arts towns and precincts. In Australia in 2016–17, 1 in 6 professional artists, and 1 in 4 visual artists, were living in a regional town (Throsby and Petetskaya). Creative arts in regional Australia makes up a quarter of the nation’s creative output and is a $2.8 billion industry; and our regions particularly draw in creative practitioners in their prime productive years (aged 24 to 44) (Regional Australia Institute).WORA Conservation SeriesIn 2018 artist and curator Helen Mathwin and myself received a local shire grant to record a conversation series with 23 artists who were based in the Central Goldfields region of Victoria as well as further afield, but who had a connection to the regional arts space we run, WideOpenRoadArt (WORA). In videoed, in-depth, approximately hour-long, semi-structured interviews conducted throughout 2018, we spoke to artists (16 women and 7 men) about the relocation phenomenon we were witnessing in our own growing arts town. Most were interviewed in WORA’s roving art float, but we seized any ad hoc opportunity we had to have genuine discussions with people. Focal points were around sustainability of practice and the social conditions that supported artists’ professional pursuits. This included accessing an arts community, circles of cultural production, and the ‘art centre’; the capacity to exhibit; but also, social factors such as affordable housing and the ability to live on a low-income while having dependants; and so on. The conversations were rich with lived experiences and insights on these issues.Financial ImperativesIn line with the discussion above, the most prominent factor we noticed in the interviews was the inescapable importance of being able to live cheaply. The consistent message that all of the interviewees, both regional- and city-based, conveyed was that a career in art-making required an important independence from the need to earn a substantial income. One interviewee commented: “I do run my art as a business, I have an ABN […] it makes a healthy loss! I don’t think I’ve ever made a profit […].” Another put it: “now that I’m in [this] town and I have a house and stuff I do feel like there is maybe a bit more security around those daily things that will hopefully give me space to [make artworks].”Much has been said on the pervasive inability to monetise art careers, notably Bourdieu’s observations that art exists on an interdependent field of cultural capital, determining for itself an autonomous conception of value separate to economics (Bourdieu, Field 39). This is somewhat similar to the idea of art as a sacred phenomenon irreducible to dollar terms (Abbing 38; see also Benjamin’s “aura”; “The Work of Art”). Art’s difficult relationship with commodification is part of its heroism that Benjamin described (Benjamin Charles Baudelaire 79), its potential to sanctify mainstream society by staying separate to the lowly aspirations of commerce (Ley “Artists” 2529). However, it is understood, artists still need to attain professional education and capacities, yet they remain at the bottom of the income ladder not only professionally, but in the case of visual artists, they remain at the bottom of the creative income hierarchies as well. Further to this, within visual arts, only a tiny proportion achieve financially backed success (Menger 277). “Artistic labour markets are characterised by high risk of failure, excess supply of recruits, low artistic income level, skewed income distribution and multiple jobholding” (Mangset, Torvik Heian, Kleppe, and Løyland; Menger). Mangset et al. point to ideas that have long surrounded the “charismatic artist myth,” of a quasi-metaphysical calling to be an artist that can lead one to overlook the profession’s vast pitfalls in terms of economic sustainability. One interviewee described it as follows: “From a very young age I wanted to be an artist […] so there’s never been a time that I’ve thought that’s not what I’m doing.” A 1% rule seems widely acknowledged in how the profession manages the financial winners against those who miss out; the tiny proportion of megastar artists versus a vast struggling remainder.As even successful artists often dip below the poverty line between paid engagements, housing costs can make the difference between being able to live in an area and not (Turnbull and Whitford). One artist described:[the reason we moved here from Melbourne] was financial, yes definitely. We wouldn’t have been able to purchase a property […] in Melbourne, we would not have been able to live in place that we wanted to live, and to do what we wanted to do […]. It was never an option for us to get a big mortgage.Another said:It partly came about as a financial practicality to move out here. My partner […] wanted to be in the bush, but I was resistant at first, we were in Melbourne but we just couldn’t afford Melbourne in the end, we had an apartment, we had a studio. My partner was a cabinet maker then. You know, just every month all our money went to rent and we just couldn’t manage anymore. So we thought, well maybe if we come out to the bush […] It was just by a happy accident that we found a property […] that we could afford, that was off-grid so it cut the bills down for us [...] that had a little studio and already had a little cottage on there that we could rent that out to get money.For a prominent artist we spoke to this issue was starkly reflected. Despite large exhibitions at some of the highest profile galleries in regional Victoria, the commissions offered for these shows were so insubstantial that the artist and their family had to take on staggering sums of personal debt to execute the ambitious and critically acclaimed shows. Another very successful artist we interviewed who had shown widely at ‘A-list’ international arts institutions and received several substantial grants, spoke of their dismay and pessimism at the idea of financial survival. For all artists we spoke to, pursuing their arts practice was in constant tension with economic imperatives, and their lives had all been shaped by the need to make shrewd decisions to continue practising. There were two artists out of the 23 we interviewed who considered their artwork able to provide full-time income, although this still relied on living costs remaining extremely low. “We are very lucky to have bought a very cheap property [in the country] that I can [also] have my workshop on, so I’m not paying for two properties in Melbourne […] So that certainly takes a fair bit of pressure off financially.” Their co-interviewee described this as “pretty luxurious!” Notably, the two who thought they could live off their art practices were both men, mid-career, whose works were large, spectacular festival items, which alongside the artists’ skill and hard work was also a factor in the type of remuneration received.Decongested LivingBeyond more affordable real estate and rental spaces, life outside our cities offers other benefits that have particular relevance to creative practitioners. Opera and festival director Lindy Hume described her move to the NSW South Coast in terms of space to think and be creative. “The abundance of time, space and silence makes living in places like [Hume’s town] ideal for creating new work” (Brown). And certainly, this was a theme that arose frequently in our interviews. Many of our regionally based artists were in part choosing the de-pressurised space of non-metro areas, and also seeking an embedded, daily connection to nature for themselves, their art-making process and their families. In one interview this was described as “dreamtime”. “Some of my more creative moments are out walking in the forest with the dog, that sort of semi-daydreamy thing where your mind is taken away by the place you’re in.”Creative HubsAll of our regional interviewees mentioned the value of the local community, as a general exchange, social support and like-minded connection, but also specifically of an arts community. Whether a tree change by choice or a more reactive move, the diaspora of artists, among others, has led to a type of rural renaissance in certain popular areas. Creative hubs located around the country, often in close proximity to the urban centres, are creating tremendous opportunities to network with other talented people doing interesting things, living in close proximity and often open to cross-fertilisation. One said: “[Castlemaine] is the best place in Australia, it has this insane cultural richness in a tiny town, you can’t go out and not meet people on the street […] For someone who has not had community in their life that is so gorgeous.” Another said:[Being an artist here] is kind of easy! Lots of people around to connect—with […] other artists but also creatively minded people [...] So it means you can just bump into someone from down the street and have an amazing conversation in five minutes about some amazing thing! […] There’s a concentration here that works.With these hubs, regional spaces are entering into a new relevance in the sphere of cultural production. They are generating unique and interesting local creative scenes for people to live amongst or visit, and generating strong local arts economies, tourist economies, and funding opportunities (Rentschler, Bridson, and Evans). Victoria in particular has burgeoned, with tourist flows to its regions increasing 13 per cent in 5 years and generating tourism worth $10 billion (Tourism Victoria). Victoria’s Greater Bendigo is Australia’s most popularly searched tourist destination on Trip Advisor, with tourism increasing 52% in 10 years (Boland). Simultaneously, funding flows have increased to regional zones, as governments seek to promote development outside Australia’s urban centres and are confident in the arts as a key strategy in boosting health, economies and overall wellbeing (see Rentschler, Bridson, and Evans; see also the 2018 Regional Centre for Culture initiative, Boland). The regions are also an increasingly relevant participant in national cultural life (Turnbull and Whitford; Mitchell; Simpson; Woodhead). Opportunities for an openness to productive exchange between regional and metropolitan sites appear to be growing, with regional festivals and art events gaining importance and unique attributes in the consciousness of the arts ‘centre’ (see for example Fairley; Simpson; Farrelly; Woodhead).Difficulties of Regional LocationDespite this, our interviews still brought to light the difficulties and barriers experienced living as a regional artist. For some, living in regional Victoria was an accepted set-back in their ambitions, something to be concealed and counteracted with education in reputable metropolitan art schools or city-based jobs. For others there was difficulty accessing a sympathetic arts community—although arts towns had vibrant cultures, certain types of creativity were preferred (often craft-based and more community-oriented). Practitioners who were active in maintaining their links to a metropolitan art scene voiced more difficulty in fitting in and successfully exhibiting their (often more conceptual or boundary-pushing) work in regional locations.The Gentrification ProblemThe other increasingly obvious issue in the revivification of some non-metropolitan areas is that they can and are already showing signs of being victims of their own success. That is, some regional arts precincts are attracting so many new residents that they are ceasing to be the low-cost, hospitable environments for artists they once were. Geographer David Ley has given attention to this particular pattern of gentrification that trails behind artists (Ley “Artists”). Ley draws from Florida’s ideas of late capitalism’s ascendency of creativity over the brute utilitarianism of the industrial era. This has got to the point that artists and creative professionals have an increasing capacity to shape and generate value in areas of life that were previous overlooked, especially with built environments (2529). Now more than ever, there is the “urbane middle-class” pursuing ‘the swirling milieu of artists, bohemians and immigrants” (Florida) as they create new, desirable landscapes with the “refuse of society” (Benjamin Charles Baudelaire 79; Ley New Middle Class). With Australia’s historic shifts in affordability in our major cities, this pattern that Ley identified in urban built environments can be seen across our states and regions as well.But with gentrification comes increased costs of living, as housing, shops and infrastructure all alter for an affluent consumer-resident. This diminishes what Bourdieu describes as “the suspension and removal of economic necessity” fundamental to the avant-garde (Bourdieu Distinction 54). That is to say, its relief from heavy pressure to materially survive is arguably critical to the reflexive, imaginative, and truly new offerings that art can provide. And as argued earlier, there seems an inbuilt economic irrationality in artmaking as a vocation—of dedicating one’s energy, time and resources to a pursuit that is notoriously impoverishing. But this irrationality may at the same time be critical to setting forth new ideas, perspectives, reflections and disruptions of taken-for-granted social assumptions, and why art is so indispensable in the first place (Bourdieu Field 39; Ley New Middle Class 2531; Weber on irrationality and the Enlightenment Project; also Adorno’s the ‘primitive’ in art). Australia’s cities, like those of most developed nations, increasingly demand we busy ourselves with the high-consumption of modern life that makes certain activities that sit outside this almost impossible. As gentrification unfolds from the metropolis to the regions, Australia faces a new level of far-reaching social inequality that has real consequences for who is able to participate in art-making, where these people can live, and ultimately what kind of diversity of ideas and voices participate in the generation of our national cultural life. ConclusionThe revival of some of Australia’s more popular regional towns has brought new life to some regional areas, particularly in reshaping their identities as cultural hubs worth experiencing, living amongst or supporting their development. Our interviews brought to life the significant benefits artists have experienced in relocating to country towns, whether by choice or necessity, as well as some setbacks. It was clear that economics played a major role in the demographic shift that took place in the area being examined; more specifically, that the general reorientation of social life towards consumption activities are having dramatic spatial consequences that we are currently seeing transform our major centres. The ability of art and creative practices to breathe new life into forgotten and devalued ideas and spaces is a foundational attribute but one that also creates a gentrification problem. Indeed, this is possibly the key drawback to the revivification of certain regional areas, alongside other prejudices and clashes between metro and regional cultures. It is argued that the transformative and redemptive actions art can perform need to involve the modern irrationality of not being transfixed by matters of economic materialism, so as to sit outside taken-for-granted value structures. This emphasises the importance of equality and open access in our spaces and landscapes if we are to pursue a vibrant, diverse and progressive national cultural sphere.ReferencesAbbing, Hans. Why Artists Are Poor: The Exceptional Economy of the Arts. Amsterdam: Amsterdam UP, 2002.Adorno, Theodor. Aesthetic Theory. London: Routledge, 1983.Australian Bureau of Statistics. “Population Growth: Capital City Growth and Development.” 4102.0—Australian Social Trends. Canberra: Australian Bureau of Sttaistics, 1996. <http://www.abs.gov.au/ausstats/abs@.nsf/2f762f95845417aeca25706c00834efa/924739f180990e34ca2570ec0073cdf7!OpenDocument>.Barr, Neil, Kushan Karunaratne, and Roger Wilkinson. Australia’s Farmers: Past, Present and Future. Land and Water Resources Research and Development Corporation, 2005. 1 Mar. 2019 <http://inform.regionalaustralia.org.au/industry/agriculture-forestry-and-fisheries/item/australia-s-farmers-past-present-and-future>.Benjamin, Walter. Charles Baudelaire: A Lyric Poet in the Era of High Capitalism. London: NLB, 1973.———. “The Work of Art in the Age of Mechanical Reproduction.” Illuminations. Ed. Hannah Arendt. Trans. Harry Zohn. New York: Schocken Books, 1969.Boland, Brooke. “What It Takes to Be a Leading Regional Centre of Culture.” Arts Hub 18 July 2018. 1 Mar. 2019 <https://www.artshub.com.au/festival/news-article/sponsored-content/festivals/brooke-boland/what-it-takes-to-be-a-leading-regional-centre-of-culture-256110>.Bourdieu, Pierre. Distinction. Cambridge, MA: Harvard UP, 1984.———. The Field of Cultural Production. New York: Columbia UP, 1993.Brown, Bill. “‘Restless Giant’ Lures Queensland Opera’s Artistic Director Lindy Hume to the Regional Art Movement.” ABC News 13 Sep. 2017. 10 Mar. 2019 <https://www.abc.net.au/news/2017-09-12/regional-creative-industries-on-the-rise/8895842>.Docherty, Glenn. “Why 5 Million Australians Can’t Get to Work, Home or School on Time.” Sydney Morning Herald 17 Feb. 2019. 10 Mar. 2019 <https://www.smh.com.au/national/why-5-million-australians-can-t-get-to-work-home-or-school-on-time-20190215-p50y1x.html>.Fairley, Gina. “Big Hit Exhibitions to See These Summer Holidays.” Arts Hub 14 Dec. 2018. 1 Mar. 2019 <https://visual.artshub.com.au/news-article/news/visual-arts/gina-fairley/big-hit-exhibitions-to-see-these-summer-holidays-257016>.Farrelly, Kate. “Bendigo: The Regional City That’s Transformed into a Foodie and Cultural Hub.” Domain 9 Apr. 2019. 10 Mar. 2019 <https://www.domain.com.au/news/bendigo-the-regional-city-you-didnt-expect-to-become-a-foodie-and-cultural-hub-813317/>.Florida, Richard. “A Creative, Dynamic City Is an Open, Tolerant City.” The Globe and Mail 24 Jun. 2002: T8.Gray, Ian, and Geoffrey Lawrence. A Future For Regional Australia: Escaping Global Misfortune. Cambridge: Cambridge University Press, 2001.Hume, Lindy. Restless Giant: Changing Cultural Values in Regional Australia. Strawberry Hills: Currency House, 2017.Jayne, Mark. Cities and Consumption. London: Routledge, 2005.Ley, David. The New Middle Class and the Remaking of the Central City. Oxford: Oxford University Press, 1996.———. “Artists, Aestheticisation and Gentrification.” Urban Studies 40.12 (2003): 2527–44.Menger, Pierre-Michel. “Artistic Labor Markets: Contingent Works, Excess Supply and Occupational Risk Management.” Handbook of the Economics of Art and Culture. Eds. Victor Ginsburgh and David Throsby. Amsterdam: Elsevier, 2006. 766–811.Mangset, Per, Mari Torvik Heian, Bard Kleppe and Knut Løyland. “Why Are Artists Getting Poorer: About the Reproduction of Low Income among Artists.” International Journal of Cultural Policy 24.4 (2018): 539-58.Mitchell, Scott. “Want to Start Collecting Art But Don’t Know Where to Begin? Trust Your Own Taste, plus More Tips.” ABC Life, 31 Mar. 2019 <https://www.abc.net.au/life/tips-for-buying-art-starting-collection/10084036>.Murphy, Peter. “Sea Change: Re-Inventing Rural and Regional Australia.” Transformations 2 (March 2002).Regional Australia Institute. “The Rise of the Regional Bohemians.” Regional Australia Institute 24 May. 2017. 1 Mar. 2019 <http://www.regionalaustralia.org.au/home/2017/05/rise-regional-bohemians-painting-new-picture-arts-culture-regional-australia/>.Rentschler, Ruth, Kerrie Bridson, and Jody Evans. Regional Arts Australia Stats and Stories: The Impact of the Arts in Regional Australia. Regional Arts Australia [n.d.]. <https://www.cacwa.org.au/documents/item/477>.Simpson, Andrea. “The Regions: Delivering Exceptional Arts Experiences to the Community.” ArtsHub 11 Apr. 2019. <https://visual.artshub.com.au/news-article/sponsored-content/visual-arts/andrea-simpson/the-regions-delivering-exceptional-arts-experiences-to-the-community-257752>.

APA, Harvard, Vancouver, ISO, and other styles

43

Flew, Terry. "Right to the City, Desire for the Suburb?" M/C Journal 14, no.4 (August18, 2011). http://dx.doi.org/10.5204/mcj.368.

Full text

Abstract:

The 2000s have been a lively decade for cities. The Worldwatch Institute estimated that 2007 was the first year in human history that more people worldwide lived in cities than the countryside. Globalisation and new digital media technologies have generated the seemingly paradoxical outcome that spatial location came to be more rather than less important, as combinations of firms, industries, cultural activities and creative talents have increasingly clustered around a select node of what have been termed “creative cities,” that are in turn highly networked into global circuits of economic capital, political power and entertainment media. Intellectually, the period has seen what the UCLA geographer Ed Soja refers to as the spatial turn in social theory, where “whatever your interests may be, they can be significantly advanced by adopting a critical spatial perspective” (2). This is related to the dynamic properties of socially constructed space itself, or what Soja terms “the powerful forces that arise from socially produced spaces such as urban agglomerations and cohesive regional economies,” with the result that “what can be called the stimulus of socio-spatial agglomeration is today being assertively described as the primary cause of economic development, technological innovation, and cultural creativity” (14). The demand for social justice in cities has, in recent years, taken the form of “Right to the City” movements. The “Right to the City” movement draws upon the long tradition of radical urbanism in which the Paris Commune of 1871 features prominently, and which has both its Marxist and anarchist variants, as well as the geographer Henri Lefebvre’s (1991) arguments that capitalism was fundamentally driven by the production of space, and that the citizens of a city possessed fundamental rights by virtue of being in a city, meaning that political struggle in capitalist societies would take an increasingly urban form. Manifestations of contemporary “Right to the City” movements have been seen in the development of a World Charter for the Right to the City, Right to the City alliances among progressive urban planners as well as urban activists, forums that bring together artists, architects, activists and urban geographers, and a variety of essays on the subject by radical geographers including David Harvey, whose work I wish to focus upon here. In his 2008 essay "The Right to the City," Harvey presents a manifesto for 21st century radical politics that asserts that the struggle for collective control over cities marks the nodal point of anti-capitalist movements today. It draws together a range of strands of arguments recognizable to those familiar with Harvey’s work, including Marxist political economy, the critique of neoliberalism, the growth of social inequality in the U.S. in particular, and concerns about the rise of speculative finance capital and its broader socio-economic consequences. My interest in Harvey’s manifesto here arises not so much from his prognosis for urban radicalism, but from how he understands the suburban in relation to this urban class struggle. It is an important point to consider because, in many parts of the world, growing urbanisation is in fact growing suburbanisation. This is the case for U.S. cities (Cox), and it is also apparent in Australian cities, with the rise in particular of outer suburban Master Planned Communities as a feature of the “New Prosperity” Australia has been experiencing since the mid 1990s (Flew; Infrastructure Australia). What we find in Harvey’s essay is that the suburban is clearly sub-urban, or an inferior form of city living. Suburbs are variously identified by Harvey as being:Sites for the expenditure of surplus capital, as a safety valve for overheated finance capitalism (Harvey 27);Places where working class militancy is pacified through the promotion of mortgage debt, which turns suburbanites into political conservatives primarily concerned with maintaining their property values;Places where “the neoliberal ethic of intense possessive individualism, and its cognate of political withdrawal from collective forms of action” are actively promoted through the proliferation of shopping malls, multiplexes, franchise stores and fast-food outlets, leading to “pacification by cappuccino” (32);Places where women are actively oppressed, so that “leading feminists … [would] proclaim the suburb as the locus of all their primary discontents” (28);A source of anti-capitalist struggle, as “the soulless qualities of suburban living … played a critical role in the dramatic events of 1968 in the US [as] discontented white middle-class students went into a phase of revolt, sought alliances with marginalized groups claiming civil rights and rallied against American imperialism” (28).Given these negative associations, one could hardly imagine citizens demanding the right to the suburb, in the same way as Harvey projects the right to the city as a rallying cry for a more democratic social order. Instead, from an Australian perspective, one is reminded of the critiques of suburbia that have been a staple of radical theory from the turn of the 20th century to the present day (Collis et. al.). Demanding the “right to the suburb” would appear here as an inherently contradictory demand, that could only be desired by those who the Australian radical psychoanalytic theorist Douglas Kirsner described as living an alienated existence where:Watching television, cleaning the car, unnecessary housework and spectator sports are instances of general life-patterns in our society: by adopting these patterns the individual submits to a uniform life fashioned from outside, a pseudo-life in which the question of individual self-realisation does not even figure. People live conditioned, unconscious lives, reproducing the values of the system as a whole (Kirsner 23). The problem with this tradition of radical critique, which is perhaps reflective of the estrangement of a section of the Australian critical intelligentsia more generally, is that most Australians live in suburbs, and indeed seem (not surprisingly!) to like living in them. Indeed, each successive wave of migration to Australia has been marked by families seeking a home in the suburbs, regardless of the housing conditions of the place they came from: the demand among Singaporeans for large houses in Perth, or what has been termed “Singaperth,” is one of many manifestations of this desire (Lee). Australian suburban development has therefore been characterized by a recurring tension between the desire of large sections of the population to own their own home (the fabled quarter-acre block) in the suburbs, and the condemnation of suburban life from an assortment of intellectuals, political radicals and cultural critics. This was the point succinctly made by the economist and urban planner Hugh Stretton in his 1970 book Ideas for Australian Cities, where he observed that “Most Australians choose to live in suburbs, in reach of city centres and also of beaches or countryside. Many writers condemn this choice, and with especial anger or gloom they condemn the suburbs” (Stretton 7). Sue Turnbull has observed that “suburbia has come to constitute a cultural fault-line in Australia over the last 100 years” (19), while Ian Craven has described suburbia as “a term of contention and a focus for fundamentally conflicting beliefs” in the Australian national imaginary “whose connotations continue to oscillate between dream and suburban nightmare” (48). The tensions between celebration and critique of suburban life play themselves out routinely in the Australian media, from the sun-lit suburbanism of Australia’s longest running television serial dramas, Neighbours and Home and Away, to the pointed observational critiques found in Australian comedy from Barry Humphries to Kath and Kim, to the dark visions of films such as The Boys and Animal Kingdom (Craven; Turnbull). Much as we may feel that the diagnosis of suburban life as a kind of neurotic condition had gone the way of the concept album or the tie-dye shirt, newspaper feature writers such as Catherine Deveny, writing in The Age, have offered the following as a description of the Chadstone shopping centre in Melbourne’s eastern suburbChadstone is a metastasised tumour of offensive proportions that's easy to find. You simply follow the line of dead-eyed wage slaves attracted to this cynical, hermetically sealed weatherless biosphere by the promise a new phone will fix their punctured soul and homewares and jumbo caramel mugachinos will fill their gaping cavern of disappointment … No one looks happy. Everyone looks anaesthetised. A day spent at Chadstone made me understand why they call these shopping centres complexes. Complex as in a psychological problem that's difficult to analyse, understand or solve. (Deveny) Suburbanism has been actively promoted throughout Australia’s history since European settlement. Graeme Davison has observed that “Australia’s founders anticipated a sprawl of homes and gardens rather than a clumping of terraces and alleys,” and quotes Governor Arthur Phillip’s instructions to the first urban developers of the Sydney Cove colony in 1790 that streets shall be “laid out in such a manner as to afford free circulation of air, and where the houses are built … the land will be granted with a clause that will prevent more than one house being built on the allotment” (Davison 43). Louise Johnson (2006) argued that the main features of 20th century Australian suburbanisation were very much in place by the 1920s, particularly land-based capitalism and the bucolic ideal of home as a retreat from the dirt, dangers and density of the city. At the same time, anti-suburbanism has been a significant influence in Australian public thought. Alan Gilbert (1988) drew attention to the argument that Australia’s suburbs combined the worst elements of the city and country, with the absence of both the grounded community associated with small towns, and the mental stimuli and personal freedom associated with the city. Australian suburbs have been associated with spiritual emptiness, the promotion of an ersatz, one-dimensional consumer culture, the embourgeoisment of the working-class, and more generally criticised for being “too pleasant, too trivial, too domestic and far too insulated from … ‘real’ life” (Gilbert 41). There is also an extensive feminist literature critiquing suburbanization, seeing it as promoting the alienation of women and the unequal sexual division of labour (Game and Pringle). More recently, critiques of suburbanization have focused on the large outer-suburban homes developed on new housing estates—colloquially known as McMansions—that are seen as being environmentally unsustainable and emblematic of middle-class over-consumption. Clive Hamilton and Richard Denniss’s Affluenza (2005) is a locus classicus of this type of argument, and organizations such as the Australia Institute—which Hamilton and Denniss have both headed—have regularly published papers making such arguments. Can the Suburbs Make You Creative?In such a context, championing the Australian suburb can feel somewhat like being an advocate for Dan Brown novels, David Williamson plays, Will Ferrell comedies, or TV shows such as Two and a Half Men. While it may put you on the side of majority opinion, you can certainly hear the critical axe grinding and possibly aimed at your head, not least because of the association of such cultural forms with mass popular culture, or the pseudo-life of an alienated existence. The art of a program such as Kath and Kim is that, as Sue Turnbull so astutely notes, it walks both sides of the street, both laughing with and laughing at Australian suburban culture, with its celebrity gossip magazines, gourmet butcher shops, McManisons and sales at Officeworks. Gina Riley and Jane Turner’s inspirations for the show can be seen with the presence of such suburban icons as Shane Warne, Kylie Minogue and Barry Humphries as guests on the program. Others are less nuanced in their satire. The website Things Bogans Like relentlessly pillories those who live in McMansions, wear Ed Hardy t-shirts and watch early evening current affairs television, making much of the lack of self-awareness of those who would simultaneously acquire Buddhist statues for their homes and take budget holidays in Bali and Phuket while denouncing immigration and multiculturalism. It also jokes about the propensity of “bogans” to loudly proclaim that those who question their views on such matters are demonstrating “political correctness gone mad,” appealing to the intellectual and moral authority of writers such as the Melbourne Herald-Sun columnist Andrew Bolt. There is also the “company you keep” question. Critics of over-consuming middle-class suburbia such as Clive Hamilton are strongly associated with the Greens, whose political stocks have been soaring in Australia’s inner cities, where the majority of Australia’s cultural and intellectual critics live and work. By contrast, the Liberal party under John Howard and now Tony Abbott has taken strongly to what could be termed suburban realism over the 1990s and 2000s. Examples of suburban realism during the Howard years included the former Member for Lindsay Jackie Kelly proclaiming that the voters of her electorate were not concerned with funding for their local university (University of Western Sydney) as the electorate was “pram city” and “no one in my electorate goes to uni” (Gibson and Brennan-Horley), and the former Minister for Immigration and Citizenship, Garry Hardgrave, holding citizenship ceremonies at Bunnings hardware stores, so that allegiance to the Australian nation could co-exist with a sausage sizzle (Gleeson). Academically, a focus on the suburbs is at odds with Richard Florida’s highly influential creative class thesis, which stresses inner urban cultural amenity and “buzz” as the drivers of a creative economy. Unfortunately, it is also at odds with many of Florida’s critics, who champion inner city activism as the antidote to the ersatz culture of “hipsterisation” that they associate with Florida (Peck; Slater). A championing of suburban life and culture is associated with writers such as Joel Kotkin and the New Geography group, who also tend to be suspicious of claims made about the creative industries and the creative economy. It is worth noting, however, that there has been a rich vein of work on Australian suburbs among cultural geographers, that has got past urban/suburban binaries and considered the extent to which critiques of suburban Australia are filtered through pre-existing discursive categories rather than empirical research findings (Dowling and Mee; McGuirk and Dowling; Davies (this volume). I have been part of a team engaged in a three-year study of creative industries workers in outer suburban areas, known as the Creative Suburbia project.[i] The project sought to understand how those working in creative industries who lived and worked in the outer suburbs maintained networks, interacted with clients and their peers, and made a success of their creative occupations: it focused on six suburbs in the cities of Brisbane (Redcliffe, Springfield, Forest Lake) and Melbourne (Frankston, Dandenong, Caroline Springs). It was premised upon what has been an inescapable empirical fact: however much talk there is about the “return to the city,” the fastest rates of population growth are in the outer suburbs of Australia’s major cities (Infrastructure Australia), and this is as true for those working in creative industries occupations as it is for those in virtually all other industry and occupational sectors (Flew; Gibson and Brennan-Horley; Davies). While there is a much rehearsed imagined geography of the creative industries that points to creative talents clustering in dense, highly agglomerated inner city precincts, incubating their unique networks of trust and sociality through random encounters in the city, it is actually at odds with the reality of where people in these sectors choose to live and work, which is as often as not in the suburbs, where the citizenry are as likely to meet in their cars at traffic intersections than walking in city boulevards.There is of course a “yes, but” response that one could have to such empirical findings, which is to accept that the creative workforce is more suburbanised than is commonly acknowledged, but to attribute this to people being driven out of the inner city by high house prices and rents, which may or may not be by-products of a Richard Florida-style strategy to attract the creative class. In other words, people live in the outer suburbs because they are driven out of the inner city. From our interviews with 130 people across these six suburban locations, the unequivocal finding was that this was not the case. While a fair number of our respondents had indeed moved from the inner city, just as many would—if given the choice—move even further away from the city towards a more rural setting as they would move closer to it. While there are clearly differences between suburbs, with creative people in Redcliffe being generally happier than those in Springfield, for example, it was quite clear that for many of these people a suburban location helped them in their creative practice, in ways that included: the aesthetic qualities of the location; the availability of “headspace” arising from having more time to devote to creative work rather than other activities such as travelling and meeting people; less pressure to conform to a stereotyped image of how one should look and act; financial savings from having access to lower-cost locations; and time saved by less commuting between locations.These creative workers generally did not see having access to the “buzz” associated with the inner city as being essential for pursuing work in their creative field, and they were just as likely to establish hardware stores and shopping centres as networking hubs as they were cafes and bars. While being located in the suburbs was disadvantageous in terms of access to markets and clients, but this was often seen in terms of a trade-off for better quality of life. Indeed, contrary to the presumptions of those such as Clive Hamilton and Catherine Deveny, they could draw creative inspiration from creative locations themselves, without feeling subjected to “pacification by cappuccino.” The bigger problem was that so many of the professional associations they dealt with would hold events in the inner city in the late afternoon or early evening, presuming people living close by and/or not having domestic or family responsibilities at such times. The role played by suburban locales such as hardware stores as sites for professional networking and as elements of creative industries value chains has also been documented in studies undertaken of Darwin as a creative city in Australia’s tropical north (Brennan-Horley and Gibson; Brennan-Horley et al.). Such a revised sequence in the cultural geography of the creative industries has potentially great implications for how urban cultural policy is being approached. The assumption that the creative industries are best developed in cities by investing heavily in inner urban cultural amenity runs the risk of simply bypassing those areas where the bulk of the nation’s artists, musicians, filmmakers and other cultural workers actually are, which is in the suburbs. Moreover, by further concentrating resources among already culturally rich sections of the urban population, such policies run the risk of further accentuating spatial inequalities in the cultural realm, and achieving the opposite of what is sought by those seeking spatial justice or the right to the city. An interest in broadband infrastructure or suburban university campuses is certainly far more prosaic than a battle for control of the nation’s cultural institutions or guerilla actions to reclaim the city’s streets. Indeed, it may suggest aspirations no higher than those displayed by Kath and Kim or by the characters of Barry Humphries’ satirical comedy. But however modest or utilitarian a focus on developing cultural resources in Australian suburbs may seem, it is in fact the most effective way of enabling the forms of spatial justice in the cultural sphere that many progressive people seek. ReferencesBrennan-Horley, Chris, and Chris Gibson. “Where Is Creativity in the City? Integrating Qualitative and GIS Methods.” Environment and Planning A 41.11 (2009): 2595–614. Brennan-Horley, Chris, Susan Luckman, Chris Gibson, and J. Willoughby-Smith. “GIS, Ethnography and Cultural Research: Putting Maps Back into Ethnographic Mapping.” The Information Society: An International Journal 26.2 (2010): 92–103.Collis, Christy, Emma Felton, and Phil Graham. “Beyond the Inner City: Real and Imagined Places in Creative Place Policy and Practice.” The Information Society: An International Journal 26.2 (2010): 104–12.Cox, Wendell. “The Still Elusive ‘Return to the City’.” New Geography 28 February 2011. < http://www.newgeography.com/content/002070-the-still-elusive-return-city >.Craven, Ian. “Cinema, Postcolonialism and Australian Suburbia.” Australian Studies 1995: 45-69. Davies, Alan. “Are the Suburbs Dormitories?” The Melbourne Urbanist 21 Sep. 2010. < http://melbourneurbanist.wordpress.com/2010/09/21/are-the-suburbs-dormitories/ >.Davison, Graeme. "Australia: The First Suburban Nation?” Journal of Urban History 22.1 (1995): 40-75. Deveny, Catherine. “No One Out Alive.” The Age 29 Oct. 2009. < http://www.smh.com.au/opinion/society-and-culture/no-one-gets-out-alive-20091020-h6yh.html >.Dowling, Robyn, and K. Mee. “Tales of the City: Western Sydney at the End of the Millennium.” Sydney: The Emergence of World City. Ed. John Connell. Melbourne: Oxford UP, 2000. 244–72.Flew, Terry. “Economic Prosperity, Suburbanization and the Creative Workforce: Findings from Australian Suburban Communities.” Spaces and Flows: Journal of Urban and Extra-Urban Studies 1.1 (2011, forthcoming).Game, Ann, and Rosemary Pringle. “Sexuality and the Suburban Dream.” Australian and New Zealand Journal of Sociology 15.2 (1979): 4–15.Gibson, Chris, and Chris Brennan-Horley. “Goodbye Pram City: Beyond Inner/Outer Zone Binaries in Creative City Research.” Urban Policy and Research 24.4 (2006): 455–71. Gilbert, A. “The Roots of Australian Anti-Suburbanism.” Australian Cultural History. Ed. S. I. Goldberg and F. B. Smith. Cambridge: Cambridge UP, 1988. 33–39. Gleeson, Brendan. Australian Heartlands: Making Space for Hope in the Suburbs. Sydney: Allen & Unwin, 2006.Hamilton, Clive, and Richard Denniss. Affluenza. Sydney: Allen & Unwin, 2005.Harvey, David. “The Right to the City.” New Left Review 53 (2008): 23–40.Infrastructure Australia. State of Australian Cities 2010. Infrastructure Australia Major Cities Unit. Canberra: Commonwealth of Australia. 2010.Johnson, Lesley. “Style Wars: Revolution in the Suburbs?” Australian Geographer 37.2 (2006): 259–77. Kirsner, Douglas. “Domination and the Flight from Being.” Australian Capitalism: Towards a Socialist Critique. Eds. J. Playford and D. Kirsner. Melbourne: Penguin, 1972. 9–31.Kotkin, Joel. “Urban Legends.” Foreign Policy 181 (2010): 128–34. Lee, Terence. “The Singaporean Creative Suburb of Perth: Rethinking Cultural Globalization.” Globalization and Its Counter-Forces in South-East Asia. Ed. T. Chong. Singapore: Institute for Southeast Asian Studies, 2008. 359–78. Lefebvre, Henri. The Production of Space. Trans. Donald Nicholson-Smith. Oxford: Blackwell, 1991.McGuirk, P., and Robyn Dowling. “Understanding Master-Planned Estates in Australian Cities: A Framework for Research.” Urban Policy and Research 25.1 (2007): 21–38Peck, Jamie. “Struggling with the Creative Class.” International Journal of Urban and Regional Research 29.4 (2005): 740–70. Slater, Tom. “The Eviction of Critical Perspectives from Gentrification Research.” International Journal of Urban and Regional Research 30.4 (2006): 737–57. Soja, Ed. Seeking Spatial Justice. Minneapolis: U of Minnesota P, 2010.Stretton, Hugh. Ideas for Australian Cities. Melbourne: Penguin, 1970.Turnbull, Sue. “Mapping the Vast Suburban Tundra: Australian Comedy from Dame Edna to Kath and Kim.” International Journal of Cultural Studies 11.1 (2008): 15–32.

APA, Harvard, Vancouver, ISO, and other styles

44

Malatzky, Christina Amelia Rosa. "“I Do Hope That It'll Be Maybe 80/20”: Equality in Contemporary Australian Marriages." M/C Journal 15, no.6 (September14, 2012). http://dx.doi.org/10.5204/mcj.562.

Full text

Abstract:

Introduction One in three Australian marriages ends in divorce (ABS, Parental Divorce). While such statistics may be interpreted to mean that marriage is becoming less significant to Australians, many Australians continue to invest heavily in marriage as a constitutive mode of subjectification. Recently released first-wave data from a longitudinal study being conducted with seven thousand high school students in Queensland indicates that the majority of high schoolers expect to get married (Skrbis et al. 76). Significant political attention and debate in Australia has centred on the issue of marriage “equality” in relation to legislating same-sex marriage. Many accounts problematise marriage in Australia today by focussing on the current inequities involved in who can and cannot legally get married, which are important debates to be had in the process of understanding the persistent importance of marriage as a social institution. This paper, however, provides a critical account of “equality” in contemporary heterosexual marriages or heteronormative monogamous relationships. I argue that, far from being a mundane “old” debate, the distribution of unpaid work between spouses has a significant effect on women’s spousal satisfaction, and it calls into question the notion of “marriage equality” in everyday heterosexual marriages whether these are civil or common law relationships. I suggest that the contemporary “Hollywood” fantasy about marriage, which informs the same-sex marriage movement, sets up expectations that belie most people’s lived realities.Project Overview This paper draws on data from a larger research project that explores the impact of globalised ideas about good womanhood and good motherhood on Western Australian women, and how local context shapes these women’s personal ideals about their own life trajectories. Interviews were conducted with a series of women living in regional Western Australia. While more women were interviewed as part of the larger research project, this paper draws on interviews with seven intending-to-mother women and fifteen mothers. Through several open-ended questions, the women were asked about either their plans for motherhood or their experiences of motherhood, in relation to additional expectations of women’s lives, such as participation in the paid sector and body ideals. Married women were also asked about how unpaid labour—that is, domestic and, where relevant, childcare labour—is divided between themselves and their husbands. Women’s responses to these questions provide a critical account of how marriage and the notion of “equality” is currently lived out in Australia. To ensure confidentiality, their real names have been replaced by pseudonyms. My purpose in drawing on my own data in conjunction with literature on the gendered division of unpaid labour is to emphasise that while the theoretical insights are not new, the fact that a gendered disparity continues to exist is of concern because of women’s dissatisfaction with the situation, particularly in the context of frequent claims that equality is already achieved, and given that it queries the fantasy of marriage continuing to circulate in contemporary culture. The women I interviewed responded openly to questions about the division of domestic, and where relevant, childcare labour and the affects of this on their relationships. Feminist approaches to the research process highlight the importance of being reflexive about the relationship(s) between researcher and researched to make the presence of the researcher in the research process explicit (Ramazanoglu and Holland 156). Ramazanoglu and Holland argue “producing knowledge through empirical research is not the same as acting as a conduit for the voices of others” (116). While the power dynamic between researcher and researched is not generally an equal one, the fact that I am younger than all of my participants bar one (who is the same age) I believe went some way towards diffusing my position of power in the interviews. Some of my participants were also either already known to me, or had been referred to me by another participant prior to the interview, which may have made the process of interview less intimidating and more comfortable. Importantly, in many instances, my participants’ reflections about the division of unpaid labour in their marriages, their expectations, hopes for the future, and feelings about it mirrored my own feelings and realities. I related personally to their experiences, and empathise with their dilemmas. This is significant methodologically because “emotional connectedness” (Coffey 158–9) including a close identification with participants (Conle 53–4) influences the process of interpretation. However, in Scott’s terms, power operated through my assessment of participants’ dilemmas being similar to my own and my writing up of their interviews (780). The findings presented in this paper are based on my interpretation of the voices of others, and are unavoidably influenced by my personal context as the researcher. Two predominate themes emerged from women’s accounts of unpaid domestic and childcare labour. Women anticipated their partner’s participation in domestic care activities, although in most cases, this expectation was not met. Further, women held these expectations for “when they had children,” even though their partners did not presently participate in domestic activities. At the same time, the women accepted that, while their husband’s should participate more in unpaid work, this participation would not be equal to their own responsibilities regardless of what other activities either were engaged in outside of the domestic and familial sphere. I found that while women expect a fairer division of domestic labour, they do not expect it to be “50/50.” I argue that the gendered division of labour has changed less than most couples readily admit, as seen through the following overview. Gender Relations: Changes and Stases In Western societies, women’s roles in the public sphere have changed considerably over the last fifty plus years. Women now constitute a significant percentage of the paid workforce. Today, couple families where both partners work in the paid sector are the most common of all families (ABS, Family Functioning). However, there has not been a corresponding shift in the way that unpaid labour is divided between partners. Only one half of the historical gendered division of labour has undergone change; while women as well as men now operate in the paid (and thus valued) sector (traditionally available only to men), women still predominately perform most of the unpaid (and undervalued) domestic work. Gender researchers have been reporting on the unequal division of domestic labour between couples, and the material and emotional consequences for women, for a long time (see Hochschild; DeVault; Coltrane), yet I argue that it remains largely unchanged, and dismissed as an important issue in the Australian community. Hochschild’s work, in particular, made a significant contribution to research into the gendered division of unpaid labour between couples by analysing and reporting on interview data collected from fifty couples, both working full-time in the paid sector, with young children. Hochschild identified and reported on couples justifications for the way they divide domestic and care, which, as I will demonstrate, are still common today (17, see also Hochschild with Machung 128). Several contemporary studies (Meisenbach; Shelton and Johnson) report that women perform the majority of domestic and care duties, despite women’s long established presence in the paid workforce. Indeed, historically, the majority of women participated in the workforce, with only middle and upper-class women experiencing a delayed entry to paid work. In their review of current research into the division of household labour in the United States Lachance-Grzela and Bouchard find that: In spite of women’s increased commitment to the labour force market and their associated political and social achievements, their advances have not been paralleled in the familiar sphere…the gains women have made outside the home have not translated directly into an egalitarian allocation of household labour…[American] women continue to perform the vast majority of unpaid tasks performed to satisfy the needs of family members or to maintain the home. (767) Exchange theories predicted that women’s increased participation in paid work would stimulate an increase in the time men spent performing domestic work (Carter 16). However, various studies including Lupton’s investigation into the distinctions, or indeed, commonalities, between the roles of “mother” and “father” find that women still perform the majority of childcare and domestic labour, even those who are also engaged in paid employment. Time use studies conducted by the Australian Bureau of Statistics also suggest that this prediction has not eventuated, and that whilst some women may have an improved capacity to negotiate with their partners about domestic labour division because of their income, this is not always the case (Carter 17). Ella (aged 32, mother of one) described “quite enjoying it” when her partner was away on business because it was less work not having to deal with his mess on top of other tasks. This is consistent with earlier research findings that single mothers spend less time on domestic work than women with children who live with men (Carter 17). It is common for men to do less domestic work than they create (Bittman 3). All of the women I interviewed who were in partnerships and intending to mother sometime in the future were either employed full-time in the paid sector, seeking full-time employment after completing graduate degrees, or combining paid work with tertiary study. One participant had recently dropped her hours from full-time to part-time because she was pregnant. All of the partnered women who were already mothering at the time of the interview were in full-time employment before the birth of their first child, and seven of them were still in paid employment; one full-time, one three-quarter time and five part time. Most women reported doing the majority, if not all, of the domestic and childcare labour regardless of whether they combined this work with paid work outside of the home. Whilst some women were indifferent to the inequity in their domestic labour and childcare responsibilities, most identified it as a source of tension, conflict, and disappointment in their spousal relationships. These women had anticipated greater participation by their husbands in the home, an optimism derived from some other source than those women with whom they interact.Anticipating Participation In their in-depth psychological study into the specific temporal disruptions and occasions of social dislocation ensuing from the birth of a child in the United States, Monk et al. found that the disruption to daily events and the reduction of social activities were more discernible for women than for men. Other research (Arendell; Hays; Mauthner; Nicolson) conducted at this time concurred with these findings. Similar results are found over a decade later. Choi et al. found most women feel at least some resentment about the impact of parenthood on their lives being “far greater for them than for their partner” (174). Influenced by reports of a supposed ideological shift in the late 1990s wherein fathers were encouraged to take a more active role in the raising of their children in ways previously considered maternal (Lupton 51), women today tend to anticipate that their husband’s will participate more in domestic and care activities, which predominately, does not eventuate. Consequently, feeling “let down” by partners has been identified as a key factor in the presentation of postnatal depression (Choi et al. 175). The women I interviewed who were planning to mother sometime in the future anticipated that their husbands would participate more in the home after the birth of a child. Gabrielle (aged 25, married for three years) hoped that this would be an 80/20 split. The idea of an 80/20 split as an “improvement” may be confronting, but this is Gabrielle’s reality, and her predicament—shared by many other women today—captures the prevailing importance of discussions around the gendered division of domestic labour. Several interviewees who were already mothering had also anticipated that their husbands would participate alongside them in household and childcare related activities. For most, this kind of participation had not eventuated and women were left with feelings of disappointment, and tensions and conflicts in their marriages. Grainne (aged 30, married for five years, mother of one) had expected her husband to be reasonably supportive and helpful around the house when they started their family. Yet she was unpleasantly surprised and intensely disappointed by how participation in the home had worked out since she and her husband had become parents six months ago. Grainne explained that she: expected that my husband would be more supportive and more helpful…I’ve been even more disappointed because he hasn’t followed through with…how I thought he would be…I almost despair a bit…we have actually struggled more in our relationship in the last six months than in the five and a half years. Grainne spoke about the impact of this inequity on the intimacy in her relationship. This is consistent with Pocock who identifies inequity in the division of unpaid work as one of “two work-related spokes in the wheel” (106–107) of spousal intimacy; the other being time and energy to communicate. According to Pocock intimacy, not necessarily sexual, is lacking in many Australian spousal relationships with unequal divisions of unpaid labour (107). While the loss of intimacy results in feelings of loss and regret, for some women, it is characterised as a past concern in their overworked and stressed lives (Pocock 107). Several women from professional backgrounds, in particular Lena and Freya, identified the inequity in their partnerships when it came to home duties and childcare as a significant, and even as the “main,” source of tension and conflict in their spousal relationships. Lena (aged 30, married for five years, mother of two) described having “great debates” with her husband about the division of domestic labour and childcare in their partnership. From her husband’s perspective, it is her “job…to do all the kids and the housework and everything else,” whereas from Lena’s perspective, “he should be able to feed the kids and clean up” on the weekend if she needs to go out. Freya (aged 30, married for ten years, mother of three) also talked about the “various rows” she had had with her husband about her domestic and childcare load. She described herself as “not coping” with the workload. For all of these women, domestic inequality in their marriages has real emotional consequences for them as individuals, and is a significant source of marital discontent. Women’s decisions about whether and when to have children, and how many to have, are influenced by the inequity experienced in marital relationships. Although I suggest that women’s desire to become mothers may eventually outweigh these immediate and everyday concerns, reports from already mothering women suggest that this source of conflict does not dissipate. The evidence gathered from my interviews demonstrates that trying to change dynamics in a relationship, when it comes to domestic tasks, is even more difficult when it is compounded with the emotional, mental and physical demands of motherhood, as Choi et al. also suggest (177).Accepting Inequality The findings of my study suggest that women intending to mother and those already mothering continue to expect to do more domestic and childcare labour than their partners. However, even with this concession, some women are still over-optimistic in their estimations about the amount of domestic labour their partner’s will perform. Fetterolf and Eagly find similar patterns in gender equality expectations in the United States amongst female college undergraduates planning to mother sometime in the future (90–91). Some women I interviewed who were planning to mother sometime in the future described their own attempts to negotiate with their partner to make them do more work. For instance, Gabrielle (aged 25, married for three years), who, as discussed earlier, hoped that her husband will participate more in the home after the birth of a child, said: Once we’ve had kids he might change and realise he might have to help out a little bit more, I can’t actually do everything…I don’t think it’ll be 50/50 just from experience of how we’ve been married so far… I do hope that it’ll be maybe 80/20 or something like that. When asked about whether their current division of house work was a concern for her, particularly in relation to having children, Gabrielle replied that she just “nagged” about it. Putting her discontent in the frame of “nagging” trivialises the issue. While it is men who tend to characterise women’s discontent as “nagging,” women can also internalise, and use this language to minimise their own feelings. That men “just don’t see mess and dirt” in the same way that women do is a popular idea drawn on to account for women’s acceptance of inequity in the home as evidenced in numerous statements from the women I interviewed. Commentaries like these align with Carter’s (1) observations that generally accepted ideas about women and men (for example, that women see dirt and men do not) are drawn on to explain and justify domestic labour arrangements. In response to how domestic labour is divided between her husband and herself, Marguerite (aged 25, married for ten months), like Gabrielle (aged 25, married for three years), described an “80/20 split,” with her as the 80%. Marguerite commented that “it’s not that he’s lazy, it’s just that he doesn’t see it, he doesn’t realise that a house needs cleaning.” Fallding described these ideas, and the behaviours that ensue, as a type of patriarchal family model, specifically “rightful patriarchy” (69) that includes the idea that women naturally pay more attention to detail than men. Conclusion “Falling in love” and “getting married” remains an important cultural narrative in Australian society. As Gabrielle (aged 25, married for three years) described, people ask you “when are you getting married? When are you having kids?” because “that’s just what you do.” I argue that offering critical accounts of heteronormative monogamous relationships/marriage equality from a variety of positions is important to understandings of these relationships in contemporary Australia. Accounts of the division of unpaid labour in the home between spouses provide one forum through which equality within marriage/heteronormative monogamous relationships can be examined. A tension exists between an expectation of participation on the part of women about their partner’s role in the home, and a latent acceptance by most women that equality in the division of unpaid work is unrealistic and unachievable. Men remain largely removed from work in the home and appear to have a degree of choice about their level of participation in domestic and care duties. The consistency of these findings with earlier work, some of which is over a decade old, suggests that the way families divide unpaid domestic and care labour remains gendered, despite significant changes in other aspects of gender relations. Many of the current discussions about marriage idealise it in ways that are not borne out in this research. This idealisation feeds into the romance of marriage, which maintains women’s investment in it, and thus the likelihood that they will find themselves in a relationship that disappoints them in significant and easily dismissed ways.ReferencesAustralian Bureau of Statistics. Australian Social Trends, 2003, Family Functioning: Balancing Family and Work. 4102.0 (2010). ‹http://www.abs.gov.au/ausstats/abs@.nsf/7d12b0f6763c78caca257061001cc588/c8647f1dd5f36f42ca2570eb00835397!OpenDocument›. Australian Bureau of Statistics. Australian Social Trends, 2010, Parental Divorce or Death During Childhood. 4102.0 (2010). ‹http://www.abs.gov.au/AUSSTATS/abs@.nsf/Lookup/4102.0Main+Features40Sep+2010›. Arendell, Terry. “Conceiving and Investigating Motherhood: The Decade's Scholarship.” Journal of Marriage and the Family 62.4 (2000): 1192–207. Bittman, Michael. Juggling Time: How Australian Families Use Time. Office of the Status of Women, Department of the Prime Minister and Cabinet: Canberra, 1991. Carter, Meg. Who Cares Anyway? Negotiating Domestic Labour in Families with Teenage Kids. (Doctoral dissertation). (2007). ‹http://researchbank.swinburne.edu.au/vital/access/manager/Repository/swin:15946.› Choi, P., Henshaw, C , Baker, S, and J Tree. "Supermum, Superwife, Supereverything: Performing Femininity in the Transition to Motherhood." Journal of Reproductive and Infant Psychology 23.2 (2005): 167–180. Coffey, Amanda. The Ethnographic Self: Fieldwork and the Representation of Identity. London: Sage Publications, 1999. Coltrane, Scott. “Research on Household Labour: Modelling and Measuring Social Embeddedness of Routine Family Work.” Journal of Marriage and Family 62.4 (2000): 1208-1233. Conle, Carola. 2000. “Narrative Inquiry: Research Tool and Medium for Professional Development.” European Journal of Teacher Education 23.1 (2000): 773-97. DeVault, Marjorie. Feeding the Family: The Social Organisation of Caring as Gendered Work. Chicago: Chicago UP, 1991. Fallding, Harold. “Inside the Australian Family.” Marriage and the Family in Australia. Ed. Adolphus Elkin. Sydney: Angus and Robertson, 1957. 54–81. Fetterolf, Janell and Alice Eagly. “Do Young Women Expect Gender Equality in Their Future Lives? An Answer From a Possible Selves Experiment.” Sex Roles 65.1 (2011): 83–93. Hays, Susan. The Cultural Contradictions of Motherhood. New Haven: Yale UP, 1996. Hochschild, Arlie. The Second Shift. New York: Viking, 1989. Hochschild, Arlie with Anne Machung. The Second Shift. New York: Penguin Edition, 2003. Lachance-Grzela, Mylene, and Genevieve Bouchard. “Why Do Women Do the Lion's Share of Housework? A Decade of Research.” Sex Roles 63.1 (2010): 767–80. Lupton, Deborah. “‘A Love/Hate Relationship’: the Ideals and Experiences of First-Time Mothers.” Journal of Sociology 36.1 (2000): 50–63. Mauthner, Natasha. “Reassessing the Importance and Role of the Marital Relationship in Postnatal Depression: Methodological and Theoretical Implications.” Journal of Reproductive and Infant Psychology 1.16 (1998): 157–75. Meisenbach, Rebecca. “The Female Breadwinner: Phenomenological Experience and Gendered Identity in Work/Family Spaces.” Sex Roles 62.1 (2010): 2–19. Monk, Timonthy H., Marilyn J. Essex, Nancy A. Smider, Marjorie H. Klein, and David J. Kupfer. “The Impact of the Birth of a Baby on the Time Structure and Social Mixture of a Couple's Daily Life and Its Consequences for Well-Being.” Journal of Applied Social Psychology 26.14 (1996): 1237– 58. Nicolson, Paula. Postnatal Depression: Psychology, Science and the Transition to Motherhood. London: Routledge, 1998. Pocock, Barbara. The Work/Life Collision: What Work is Doing to Australians and What to Do About It. Sydney: The Federation Press, 2003. Ramazanoglu, Caroline and Janet Holland. Feminist Methodology: Challenges and Choices. London: Sage, 2002. Scott, Joan. “The Evidence of Experience.” Critical Inquiry 17.4 (1991): 773–97. Shelton, Nikki, and Sally Johnson. “'I Think Motherhood for Me Was a Bit Like a Double-Edged Sword': The Narratives of Older Mothers.” Journal of Community and Applied Social Psychology 16.1 (2006): 316–30. Skrbis, Zlatko, Mark Western, Bruce Tranter, David Hogan, Rebecca Coates, Jonathan Smith, Belinda Hewitt, and Margery Mayall. “Expecting the Unexpected: Young People’s Expectations about Marriage and Family.” Journal of Sociology 48.1 (2012): 63–83.

APA, Harvard, Vancouver, ISO, and other styles

45

McKenzie, Peter. "Jazz Culture in the North: A Comparative Study of Regional Jazz Communities in Cairns and Mackay, North Queensland." M/C Journal 20, no.6 (December31, 2017). http://dx.doi.org/10.5204/mcj.1318.

Full text

Abstract:

IntroductionMusicians and critics regard Australian jazz as vibrant and creative (Shand; Chessher; Rechniewski). From its tentative beginnings in the early twentieth century (Whiteoak), jazz has become a major aspect of Australia’s music and performance. Due to the large distances separating cities and towns, its development has been influenced by geographical isolation (Nikolsky; Chessher; Clare; Johnson; Stevens; McGuiness). While major cities have been the central hubs, it is increasingly acknowledged that regional centres also provide avenues for jazz performance (Curtis).This article discusses findings relating to transient musical populations shaped by geographical conditions, venue issues that are peculiar to the Northern region, and finally the challenges of cultural and parochial mindsets that North Queensland jazz musicians encounter in performance.Cairns and MackayCairns and Mackay are regional centres on the coast of Queensland, Australia. Cairns – population 156,901 in 2016 (ABS) – is a world famous tourist destination situated on the doorstep of the Great Barrier Reef (Thorp). Mackay – population 114,969 in 2016 (ABS) – is a lesser-known community with an economy largely underpinned by the sugar cane and coal mining industries (Rolfe et al. 138). Both communities lie North of the capital city Brisbane – Mackay in the heart of Central Queensland, and Cairns as the unofficial capital of Far North Queensland. Mackay and Cairns were selected for this study, not on representational grounds, but because they provide an opportunity to learn through case studies. Stake notes that “potential for learning is a different and sometimes superior criterion to representativeness,” adding, “that may mean taking the one most accessible or the one we can spend the most time with (451).”Musically, both regional centres have a number of venues that promote live music, however, only Cairns has a dedicated jazz club, the Cairns Jazz Club (CJC). Each has a community convention centre that brings high-calibre touring musicians to the region, including jazz musicians.Mackay is home to the Central Queensland Conservatorium of Music (CQCM) a part of the Central Queensland University that has offered conservatoire-style degree programs in jazz, contemporary music and theatre for over twenty-five years. Cairns does not have any providers of tertiary jazz qualifications.MethodologySemi-structured in-depth interviews were conducted with twenty-two significant individuals associated with the jazz communities in Mackay and Cairns over a twelve-month period from 2015 to 2016. Twelve of the interviewees were living in Cairns at the time, and ten were living in Mackay. The selection of interviewees was influenced by personal knowledge of key individuals, historical records located at the CQCM, and from a study by (Mitchell), who identified important figures in the Cairns jazz scene. The study participants included members of professional jazz ensembles, dedicated jazz audience members and jazz educators. None of the participants who were interviewed relied solely on the performance of jazz as their main occupation. All of the musicians combined teaching duties with music-making in several genres including rock, jazz, Latin and funk, as well as work in the recording and producing of recorded music. Combining the performance of jazz and commercial musical styles is a common and often crucial part of being a musician in a regional centre due to the low demand for any one specific genre (Luckman et al. 630). The interview data that was gathered during the study’s data collection phase was analysed for themes using the grounded theory research method (Charmaz). The following sections will discuss three areas of findings relating to some of the unique North Queensland influences that have impacted the development and sustainability of the two regional jazz communities.Transient Musical PopulationsThe prospect of living in North Queensland is an alluring proposition for many people. According to the participants in this study, the combination of work and a tropical lifestyle attracts people from all over the country to Cairns and Mackay, but this influx is matched by a high population turnover. Many musicians who move into the region soon move away again. High population turnover is a characteristic of several Northern regional centres such as the city of Darwin (Luckman, Gibson and Lea 12). The high growth and high population turnover in Cairns, in particular, was one of the highest in the country between 2006 and 2011 (ABS). The study participants in both regions believed that the transient nature of the local population is detrimental to the development and sustainability of the jazz communities. One participant described the situation in Cairns this way: “The tropics sort of lure them up there, tease them with all of the beauty and nature, and then spit them out when they realise it’s not what they imagined (interviewee 1, 24 Aug. 2016).” Looking more broadly to other coastal regional areas of Australia, there is evidence of the counter-urban flow of professionals and artists seeking out a region’s “natural and cultural environment” (Gibson 339). On the far North coast of New South Wales, Gibson examined how the climate, natural surroundings and cultural charms attracted city dwellers to that region (337). Similarly, most of the participants in this study mentioned lifestyle choices such as raising a family and living in the tropics as reasons to move to Cairns or Mackay. The prospect of working in the tourism and hospitality industry was found to be another common reason for musicians to move to Cairns in particular. In contrast to some studies (Salazar; Conradson and Latham) where it was found that the middle- to upper-classes formed the majority of lifestyle migrants, the migrating musicians identified by this study were mostly low-income earners seeking a combination of music work and other types of employment outside the music industry. There have been studies that have explored and critically reviewed the theoretical frameworks behind lifestyle migration (Benson and Osbaldiston) including the examination of issues and the motivation to ‘lifestyle migrate’. What is interesting in this current study is the focus of discussion on the post-migration effects. Study participants believe that most of the musicians who move into their region leave soon afterwards because of their disillusionment with the local music industry. Despite the lure of musical jobs through the tourism and hospitality industry, local musicians in Cairns tend to believe there is less work than imagined. Pub rock duos and DJs have taken most of the performance opportunities, which makes it hard for new musicians to compete.The study also reveals that Cairns jazz musicians consider it more difficult to find and collaborate with quality newcomers. This may be attributed to the smaller jazz communities’ demand for players of specific instruments. One participant explained, “There’s another bass player that just moved here, but he only plays by ear, so when people want to play charts and new songs, he can’t do it so it's hard finding the right guys up here at times (interviewee 2, 23 Aug. 2016).” Cairns and Mackay participants agreed that the difficulty of finding and retaining quality musicians in the region impacted on the ability of certain groups to be sustainable. One participant added, “It’s such a small pool of musicians, at the moment, I've got a new project ready to go and I've got two percussionists, but I need a bass player, but there is no bass player that I'm willing to work with (interviewee 3, 24 Aug. 2016).” The same participant has been fortunate over the years, performing with a different local group whose members have permanently stayed in the Cairns region, however, forging new musical pathways and new groups seemed challenging due to the lack of musical skills in some of the potential musicians.In Mackay, the study revealed a smaller influx of new musicians to the region, and study participants experienced the same difficulties forming groups and retaining members as their Cairns counterparts. One participant, who found it difficult to run a Big Band as well as a smaller jazz ensemble because of the transient population, claimed that many local musicians were lured to metropolitan centres for university or work.Study participants in both Northern centres appeared to have developed a tolerance and adaptability for their regional challenges. While this article does not aim to suggest a solution to the issues they described, one interesting finding that emerged in both Cairns and Mackay was the musicians’ ability to minimise some of the effects of the transient population. Some musicians found that it was more manageable to sustain a band by forming smaller groups such as duos, trios and quartets. An example was observed in Mackay, where one participant’s Big Band was a standard seventeen-piece group. The loss of players was a constant source of anxiety for the performers. Changing to a smaller ensemble produced a sense of sustainability that satisfied the group. In Cairns, one participant found that if the core musicians in the group (bass, drums and vocals) were permanent local residents, they could manage to use musicians passing through the region, which had minimal impact on the running of the group. For example, the Latin band will have different horn players sit in from time to time. When those performers leave, the impact on the group is minimal because the rhythm section is comprised of long-term Cairns residents.Venue Conditions Heat UpAt the Cape York Hotel in Cairns, musicians and audience members claimed that it was uncomfortable to perform or attend Sunday afternoon jazz gigs during the Cairns summer due to the high temperatures and non air-conditioned venues. This impact of the physical environment on the service process in a venue was first modelled and coined the ‘Servicescape’ by Bitner (57). The framework, which includes physical dimensions like temperature, noise, space/function and signage, has also been further investigated in other literature (Minor et al.; Kubacki; Turley and Fugate). This model is relevant to this study because it clearly affects the musician’s ability to perform music in the Northern climate and attract audiences. One of the regular musicians at the Cape York Hotel commented: So you’re thinking, ‘Well, I’m starting to create something here, people are starting to show up’, but then you see it just dwindling away and then you get two or three weeks of hideously hot weather, and then like last Sunday, by the time I went on in the first set, my shirt was sticking to me like tissue paper… I set up a gig, a three-hour gig with my trio, and if it’s air conditioned you’re likely to get people but if it’s like the Cape York, which is not air conditioned, and you’re out in the beer garden with a tin roof over the top with big fans, it’s hideous‘. (Interviewee 4, 24 Aug. 2016)The availability of venues that offer live jazz is limited in both regions. The issue was twofold: firstly, the limited availability of a larger venue to cater for the ensembles was deemed problematic; and secondly, the venue manager needed to pay for the services of the club, which contributed to its running costs. In Cairns, the Cape York Hotel has provided the local CJC with an outdoor beer garden as a venue for their regular Sunday performances since 2015. The president of the CJC commented on the struggle for the club to find a suitable venue for their musicians and patrons. The club has had residencies in multiple venues over the last thirty years with varying success. It appears that the club has had to endure these conditions in order to provide their musicians and audiences an outlet for jazz performance. This dedication to their art form and sense of resilience appears to be a regular theme for these Northern jazz musicians.Minor et al. (7) recommended that live music organisers needed to consider offering different physical environments for different events (7). For example, a venue that caters for a swing band might include a dance floor for potential dancers or if a venue catered for a sit down jazz show, the venue might like to choose the best acoustic environment to best support the sound of the ensemble. The research showed that customers have different reasons for attending events, and in relation to the Cape York Hotel, the majority of the customers were the CJC members who simply wanted to enjoy their jazz club performances in an air conditioned environment with optimal acoustics as the priority. Although not ideal, the majority of the CJC members still attended during the summer months and endured the high temperatures due to a lack of venue suitability.Parochial MindsetsOne of the challenging issues faced by many of the participants in both regions was the perceived cultural divide between jazz aficionados and general patrons at many venues. While larger centres in Australia have enjoyed an international reputation as creative hubs for jazz such as Melbourne and Sydney (Shand), the majority of participants in this study believed that a significant portion of the general public is quite parochial in their views on various musical styles including jazz. Coined the ‘bogan factor’, one participant explained, “I call it the bogan factor. Do you think that's an academic term? It is now” (interviewee 5, 17 Feb. 2016). They also commented on dominant cultural choices of residents in these regions: “It's North Queensland, it's a sport orientated, 4WD dominated place. Culturally they are the main things that people are attracted to” (interviewee 5, 17 Feb. 2016). These cultural preferences appear to affect the performance opportunities for the participants in Cairns and Mackay.Waitt and Gibson explored how the Wollongong region was chosen as an area for investigation to see if city size mattered for creativity and creativity-led regeneration (1224). With the ‘Creative Class’ framework in mind (Florida), the researchers found that Wollongong’s primarily blue-collar industrial identity was a complex mixture of cultural pursuits including the arts, sport and working class ideals (Waitt and Gibson 1241). This finding is consistent with the comments of study participants from Cairns and Mackay who believed that the identities of their regions were strongly influenced by sport and industries like mining and farming. One Mackay participant added, “I think our culture, in itself, would need to change to turn more people to jazz. I can’t see that happening. That’s Australia. You’re fighting against 200 years of sport” (interviewee 6, 12 Feb. 2016). Performing in Mackay or Cairns in venues that attract various demographics can make it difficult for musicians playing jazz. A Cairns participant added, “As Ingrid James once told me, ‘It's North Queensland, you’ve got an audience of tradesman, they don't get it’. It's silly to think it's going to ever change” (interviewee 7, 26 Aug. 2016). One Mackay participant believed that the lack of appreciation for jazz in regional areas was largely due to a lack of exposure to the art form. Most people grow up listening to other styles of music in their households.Another participant made the point that regardless of the region’s cultural and leisure-time preferences, if a jazz band is playing in a football club, you must expect it to be unpopular. Many of the research participants emphasised that playing in a suitable venue is paramount for developing a consistent and attentive audience. Choosing a venue that values and promotes the style of jazz music that the musicians are performing could help to attract more jazz fans and therefore build a sustainable jazz community.Refreshingly, this study revealed that musicians in both regions showed considerable resilience in dealing with the issue of parochial mindsets, and they have implemented methods to help educate their audiences. The audience plays a significant part in the development and future of a jazz community (Becker; Martin). For the Central Queensland Conservatorium of Music in Mackay, part of the ethos of the institution is to provide music performance and educational opportunities to the region. One of the lecturers who made a significant contribution to the design of the ensemble program had a clear vision to combine jazz and popular music styles in order to connect with a regional audience. He explained, “The popular music strand of the jazz program and what we called the commercial ensembles was very much birthed out of that concept of creating a connection with the community and making us more accessible in the shortest amount of time, which then enabled us to expose people to jazz” (interviewee 8, 20 Mar. 2016).In a similar vein, several Cairns musicians commented on how they engaged with their audiences through education. Some musicians attempted to converse with the patrons on the comparative elements of jazz and non-jazz styles, which helped to instil some appreciation in patrons with little jazz knowledge. One participant cited that although not all patrons were interested in an education at a pub, some became regular attendees and showed greater appreciation for the different jazz styles. These findings align with other studies (Radbourne and Arthurs; Kubacki; Kubacki et al.), who found that audiences tend to return to arts organizations or events more regularly if they feel connected to the experience (Kubacki et al. 409).ConclusionThe Cairns and Mackay jazz musicians who were interviewed in this study revealed some innovative approaches for sustaining their art form in North Queensland. The participants discussed creative solutions for minimising the influence of a transient musician population as well as overcoming some of the parochial mindsets in the community through education. The North Queensland summer months proved to be a struggle for musicians and audience members alike in Cairns in particular, but resilience and commitment to the music and the social network of jazz performers seemed to override this obstacle. Although this article presents just a subset of the findings from a study of the development and sustainability of the jazz communities in Mackay and Cairns, it opens the way for further investigation into the unique issues faced. Deeper understanding of these issues could contribute to the ongoing development and sustainability of jazz communities in regional Australia.ReferencesAustralian Bureau of Statistics. "Mackay (Statistical Area 2), Cairns (R) (Statistical Local Area), Census 2016." Canberra: Australian Bureau of Statistics.———. "Perspectives on Regional Australia: Population Growth and Turnover in Local Government Areas (Lgas), 2006-2011." Canberra: Australian Bureau of Statistics.Becker, H. Art Worlds. Berkeley, CA: University of California Press, 1982.Benson, Michaela, and Nick Osbaldiston. "Toward a Critical Sociology of Lifestyle Migration: Reconceptualizing Migration and the Search for a Better Way of Life." The Sociological Review 64.3 (2016): 407-23.Bitner, Mary Jo. "Servicescapes: The Impact of Physical Surroundings on Customers and Employees." The Journal of Marketing (1992): 57-71. Charmaz, K. Constructing Grounded Theory. 2nd ed. Thousand Oaks, California: Sage, 2014. Chessher, A. "Australian Jazz Musician-Educators: An Exploration of Experts' Approaches to Teaching Jazz." Sydney: University of Sydney, 2009. Clare, J. Bodgie Dada and the Cult of Cool: Jazz in Australia since the 1940s. Sydney: University of New South Wales Press, 1995. Conradson, David, and Alan Latham. "Transnational Urbanism: Attending to Everyday Practices and Mobilities." Journal of Ethnic and Migration Studies 31.2 (2005): 227-33. Curtis, Rebecca Anne. "Australia's Capital of Jazz? The (Re)creation of Place, Music and Community at the Wangaratta Jazz Festival." Australian Geographer 41.1 (2010): 101-16. Florida, Richard. The Rise of the Creative Class: And How It’s Transforming Work, Leisure, Community and Everyday Life. Melbourne, Victoria: Pluto Press Australia, 2003. Gibson, Chris. "Migration, Music and Social Relations on the NSW Far North Coast." Transformations 2 (2002): 1-15. ———. "Rural Transformation and Cultural Industries: Popular Music on the New South Wales Far North Coast." Australian Geographical Studies 40.3 (2002): 337-56. Johnson, Bruce. The Inaudible Music: Jazz, Gender and Australian Modernity. Strawberry Hills, NSW: Currency Press, 2000. Kubacki, Krzysztof. "Jazz Musicians: Creating Service Experience in Live Performance." International Journal of Contemporary Hospitality Management 20.4 (2008): 401- 13. ———, et al. "Comparing Nightclub Customers’ Preferences in Existing and Emerging Markets." International Journal of Hospitality Management 26.4 (2007): 957-73. Luckman, S., et al. "Life in a Northern (Australian) Town: Darwin's Mercurial Music Scene." Continuum: Journal of Media & Cultural Studies 22.5 (2008): 623-37. ———, Chris Gibson, and Tess Lea. "Mosquitoes in the Mix: How Transferable Is Creative City Thinking?" Singapore Journal of Tropical Geography 30.1 (2009): 70-85. Martin, Peter J. "The Jazz Community as an Art World: A Sociological Perspective." Jazz Research Journal 2.1 (2005): 5-13. McGuiness, Lucian. "A Case for Ethnographic Enquiry in Australian Jazz." Sydney: University of Sydney, 2010.Minor, Michael S., et al. "Rock On! An Elementary Model of Customer Satisfaction with Musical Performances." Journal of Services Marketing 18.1 (2004): 7-18. Mitchell, A. "Jazz on the Far North Queensland Resort Circuit: A Musician's Perspective." Proceedings of the History & Future of Jazz in the Asia-Pacific Region. Eds. P. Hayward and G. Hodges. Vol. 1. Hamilton Island, Australia: Central Queensland Conservatorium of Music, 2004. Nikolsky, T. "The Development of the Australian Jazz Real Book." Melbourne: RMIT University, 2012. Radbourne, Jennifer, and Andy Arthurs. "Adapting Musicology for Commercial Outcomes." 9th International Conference on Arts and Cultural Management (AIMAC 2007), 2007.Rechniewski, Peter. The Permanent Underground: Australian Contemporary Jazz in the New Millennium. Platform Papers 16. Redfern, NSW: Currency House, 2008. Rolfe, John, et al. "Lessons from the Social and Economic Impacts of the Mining Boom in the Bowen Basin 2004-2006." Australasian Journal of Regional Studies 13.2 (2007): 134-53. Salazar, Noel B. "Migrating Imaginaries of a Better Life … until Paradise Finds You." Understanding Lifestyle Migration. Springer, 2014. 119-38. Shand, J. Jazz: The Australian Accent. Sydney: UNSW Press, 2009.Stake, Robert E. "Qualitative Case Studies." The Sage Handbook of Qualitative Research. Eds. Norman K. Denzin and Yvonna S. Lincoln. 3rd ed. Thousand Oaks, CA: Sage, 2005. 443-66. Stevens, Timothy. "The Red Onion Jazz Band at the 1963 Australian Jazz Convention." Musicology Australia 24.1 (2001): 35-61. Thorp, Justine. "Tourism in Cairns: Image and Product." Journal of Australian Studies 31.91 (2007): 107-13. Turley, L., and D. Fugate. "The Multidimensional Nature of Service Facilities." Journal of Services Marketing 6.3 (1992): 37-45. Waitt, G., and C. Gibson. "Creative Small Cities: Rethinking the Creative Economy in Place." Urban Studies 46.5-6 (2009): 1223-46. Whiteoak, J. "'Jazzing’ and Australia's First Jazz Band." Popular Music 13.3 (1994): 279-95.

APA, Harvard, Vancouver, ISO, and other styles

46

Brien, Donna Lee. "Forging Continuing Bonds from the Dead to the Living: Gothic Commemorative Practices along Australia’s Leichhardt Highway." M/C Journal 17, no.4 (July24, 2014). http://dx.doi.org/10.5204/mcj.858.

Full text

Abstract:

The Leichhardt Highway is a six hundred-kilometre stretch of sealed inland road that joins the Australian Queensland border town of Goondiwindi with the Capricorn Highway, just south of the Tropic of Capricorn. Named after the young Prussian naturalist Ludwig Leichhardt, part of this roadway follows the route his party took as they crossed northern Australia from Morton Bay (Brisbane) to Port Essington (near Darwin). Ignoring the usual colonial practice of honouring the powerful and aristocratic, Leichhardt named the noteworthy features along this route after his supporters and fellow expeditioners. Many of these names are still in use and a series of public monuments have also been erected in the intervening century and a half to commemorate this journey. Unlike Leichhardt, who survived his epic trip, some contemporary travellers who navigate the remote roadway named in his honour do not arrive at their final destinations. Memorials to these violently interrupted lives line the highway, many enigmatically located in places where there is no obvious explanation for the lethal violence that occurred there. This examination profiles the memorials along Leichhardt’s highway as Gothic practice, in order to illuminate some of the uncanny paradoxes around public memorials, as well as the loaded emotional terrain such commemorative practices may inhabit. All humans know that death awaits them (Morell). Yet, despite this, and the unprecedented torrent of images of death and dying saturating news, television, and social media (Duwe; Sumiala; Bisceglio), Gorer’s mid-century ideas about the denial of death and Becker’s 1973 Pulitzer prize-winning description of the purpose of human civilization as a defence against this knowledge remains current in the contemporary trope that individuals (at least in the West) deny their mortality. Contributing to this enigmatic situation is how many deny the realities of aging and bodily decay—the promise of the “life extension” industries (Hall)—and are shielded from death by hospitals, palliative care providers, and the multimillion dollar funeral industry (Kiernan). Drawing on Piatti-Farnell’s concept of popular culture artefacts as “haunted/haunting” texts, the below describes how memorials to the dead can powerfully reconnect those who experience them with death’s reality, by providing an “encrypted passageway through which the dead re-join the living in a responsive cycle of exchange and experience” (Piatti-Farnell). While certainly very different to the “sublime” iconic Gothic structure, the Gothic ruin that Summers argued could be seen as “a sacred relic, a memorial, a symbol of infinite sadness, of tenderest sensibility and regret” (407), these memorials do function in both this way as melancholy/regret-inducing relics as well as in Piatti-Farnell’s sense of bringing the dead into everyday consciousness. Such memorialising activity also evokes one of Spooner’s features of the Gothic, by acknowledging “the legacies of the past and its burdens on the present” (8).Ludwig Leichhardt and His HighwayWhen Leichhardt returned to Sydney in 1846 from his 18-month journey across northern Australia, he was greeted with surprise and then acclaim. Having mounted his expedition without any backing from influential figures in the colony, his party was presumed lost only weeks after its departure. Yet, once Leichhardt and almost all his expedition returned, he was hailed “Prince of Explorers” (Erdos). When awarding him a significant purse raised by public subscription, then Speaker of the Legislative Council voiced what he believed would be the explorer’s lasting memorial —the public memory of his achievement: “the undying glory of having your name enrolled amongst those of the great men whose genius and enterprise have impelled them to seek for fame in the prosecution of geographical science” (ctd. Leichhardt 539). Despite this acclaim, Leichhardt was a controversial figure in his day; his future prestige not enhanced by his Prussian/Germanic background or his disappearance two years later attempting to cross the continent. What troubled the colonial political class, however, was his transgressive act of naming features along his route after commoners rather than the colony’s aristocrats. Today, the Leichhardt Highway closely follows Leichhardt’s 1844-45 route for some 130 kilometres from Miles, north through Wandoan to Taroom. In the first weeks of his journey, Leichhardt named 16 features in this area: 6 of the more major of these after the men in his party—including the Aboriginal man ‘Charley’ and boy John Murphy—4 more after the tradesmen and other non-aristocratic sponsors of his venture, and the remainder either in memory of the journey’s quotidian events or natural features there found. What we now accept as traditional memorialising practice could in this case be termed as Gothic, in that it upset the rational, normal order of its day, and by honouring humble shopkeepers, blacksmiths and Indigenous individuals, revealed the “disturbance and ambivalence” (Botting 4) that underlay colonial class relations (Macintyre). On 1 December 1844, Leichhardt also memorialised his own past, referencing the Gothic in naming a watercourse The Creek of the Ruined Castles due to the “high sandstone rocks, fissured and broken like pillars and walls and the high gates of the ruined castles of Germany” (57). Leichhardt also disturbed and disfigured the nature he so admired, famously carving his initials deep into trees along his route—a number of which still exist, including the so-called Leichhardt Tree, a large coolibah in Taroom’s main street. Leichhardt also wrote his own memorial, keeping detailed records of his experiences—both good and more regretful—in the form of field books, notebooks and letters, with his major volume about this expedition published in London in 1847. Leichhardt’s journey has since been memorialised in various ways along the route. The Leichhardt Tree has been further defaced with numerous plaques nailed into its ancient bark, and the town’s federal government-funded Bicentennial project raised a formal memorial—a large sandstone slab laid with three bronze plaques—in the newly-named Ludwig Leichhardt Park. Leichhardt’s name also adorns many sites both along, and outside, the routes of his expeditions. While these fittingly include natural features such as the Leichhardt River in north-west Queensland (named in 1856 by Augustus Gregory who crossed it by searching for traces of the explorer’s ill-fated 1848 expedition), there are also many businesses across Queensland and the Northern Territory less appropriately carrying his name. More somber monuments to Leichhardt’s legacy also resulted from this journey. The first of these was the white settlement that followed his declaration that the countryside he moved through was well endowed with fertile soils. With squatters and settlers moving in and land taken up before Leichhardt had even arrived back in Sydney, the local Yeeman people were displaced, mistreated and completely eradicated within a decade (Elder). Mid-twentieth century, Patrick White’s literary reincarnation, Voss of the eponymous novel, and paintings by Sidney Nolan and Albert Tucker have enshrined in popular memory not only the difficult (and often described as Gothic) nature of the landscape through which Leichhardt travelled (Adams; Mollinson, and Bonham), but also the distinctive and contrary blend of intelligence, spiritual mysticism, recklessness, and stoicism Leichhardt brought to his task. Roadside Memorials Today, the Leichhardt Highway is also lined with a series of roadside shrines to those who have died much more recently. While, like centotaphs, tombstones, and cemeteries, these memorialise the dead, they differ in usually marking the exact location that death occurred. In 43 BC, Cicero articulated the idea of the dead living in memory, “The life of the dead consists in the recollection cherished of them by the living” (93), yet Nelson is one of very few contemporary writers to link roadside memorials to elements of Gothic sensibility. Such constructions can, however, be described as Gothic, in that they make the roadway unfamiliar by inscribing onto it the memory of corporeal trauma and, in the process, re-creating their locations as vivid sites of pain and suffering. These are also enigmatic sites. Traffic levels are generally low along the flat or gently undulating terrain and many of these memorials are located in locations where there is no obvious explanation for the violence that occurred there. They are loci of contradictions, in that they are both more private than other memorials, in being designed, and often made and erected, by family and friends of the deceased, and yet more public, visible to all who pass by (Campbell). Cemeteries are set apart from their surroundings; the roadside memorial is, in contrast, usually in open view along a thoroughfare. In further contrast to cemeteries, which contain many relatively standardised gravesites, individual roadside memorials encapsulate and express not only the vivid grief of family and friends but also—when they include vehicle wreckage or personal artefacts from the fatal incident—provide concrete evidence of the trauma that occurred. While the majority of individuals interned in cemeteries are long dead, roadside memorials mark relatively contemporary deaths, some so recent that there may still be tyre marks, debris and bloodstains marking the scene. In 2008, when I was regularly travelling this roadway, I documented, and researched, the six then extant memorial sites that marked the locations of ten fatalities from 1999 to 2006. (These were all still in place in mid-2014.) The fatal incidents are very diverse. While half involved trucks and/or road trains, at least three were single vehicle incidents, and the deceased ranged from 13 to 84 years of age. Excell argues that scholarship on roadside memorials should focus on “addressing the diversity of the material culture” (‘Contemporary Deathscapes’) and, in these terms, the Leichhardt Highway memorials vary from simple crosses to complex installations. All include crosses (mostly, but not exclusively, white), and almost all are inscribed with the name and birth/death dates of the deceased. Most include flowers or other plants (sometimes fresh but more often plastic), but sometimes also a range of relics from the crash and/or personal artefacts. These are, thus, unsettling sights, not least in the striking contrast they provide with the highway and surrounding road reserve. The specific location is a key component of their ability to re-sensitise viewers to the dangers of the route they are travelling. The first memorial travelling northwards, for instance, is situated at the very point at which the highway begins, some 18 kilometres from Goondiwindi. Two small white crosses decorated with plastic flowers are set poignantly close together. The inscriptions can also function as a means of mobilising connection with these dead strangers—a way of building Secomb’s “haunted community”, whereby community in the post-colonial age can only be built once past “murderous death” (131) is acknowledged. This memorial is inscribed with “Cec Hann 06 / A Good Bloke / A Good hoarseman [sic]” and “Pat Hann / A Good Woman” to tragically commemorate the deaths of an 84-year-old man and his 79-year-old wife from South Australia who died in the early afternoon of 5 June 2006 when their Ford Falcon, towing a caravan, pulled onto the highway and was hit by a prime mover pulling two trailers (Queensland Police, ‘Double Fatality’; Jones, and McColl). Further north along the highway are two memorials marking the most inexplicable of road deaths: the single vehicle fatality (Connolly, Cullen, and McTigue). Darren Ammenhauser, aged 29, is remembered with a single white cross with flowers and plaque attached to a post, inscribed hopefully, “Darren Ammenhauser 1971-2000 At Rest.” Further again, at Billa Billa Creek, a beautifully crafted metal cross attached to a fence is inscribed with the text, “Kenneth J. Forrester / RIP Jack / 21.10.25 – 27.4.05” marking the death of the 79-year-old driver whose vehicle veered off the highway to collide with a culvert on the creek. It was reported that the vehicle rolled over several times before coming to rest on its wheels and that Forrester was dead when the police arrived (Queensland Police, ‘Fatal Traffic Incident’). More complex memorials recollect both single and multiple deaths. One, set on both sides of the road, maps the physical trajectory of the fatal smash. This memorial comprises white crosses on both sides of road, attached to a tree on one side, and a number of ancillary sites including damaged tyres with crosses placed inside them on both sides of the road. Simple inscriptions relay the inability of such words to express real grief: “Gary (Gazza) Stevens / Sadly missed” and “Gary (Gazza) Stevens / Sadly missed / Forever in our hearts.” The oldest and most complex memorial on the route, commemorating the death of four individuals on 18 June 1999, is also situated on both sides of the road, marking the collision of two vehicles travelling in opposite directions. One memorial to a 62-year-old man comprises a cross with flowers, personal and automotive relics, and a plaque set inside a wooden fence and simply inscribed “John Henry Keenan / 23-11-1936–18-06-1999”. The second memorial contains three white crosses set side-by-side, together with flowers and relics, and reveals that members of three generations of the same family died at this location: “Raymond Campbell ‘Butch’ / 26-3-67–18-6-99” (32 years of age), “Lorraine Margaret Campbell ‘Lloydie’ / 29-11-46–18-6-99” (53 years), and “Raymond Jon Campbell RJ / 28-1-86–18-6-99” (13 years). The final memorial on this stretch of highway is dedicated to Jason John Zupp of Toowoomba who died two weeks before Christmas 2005. This consists of a white cross, decorated with flowers and inscribed: “Jason John Zupp / Loved & missed by all”—a phrase echoed in his newspaper obituary. The police media statement noted that, “at 11.24pm a prime mover carrying four empty trailers [stacked two high] has rolled on the Leichhardt Highway 17km north of Taroom” (Queensland Police, ‘Fatal Truck Accident’). The roadside memorial was placed alongside a ditch on a straight stretch of road where the body was found. The coroner’s report adds the following chilling information: “Mr Zupp was thrown out of the cabin and his body was found near the cabin. There is no evidence whatsoever that he had applied the brakes or in any way tried to prevent the crash … Jason was not wearing his seatbelt” (Cornack 5, 6). Cornack also remarked the truck was over length, the brakes had not been properly adjusted, and the trip that Zupp had undertaken could not been lawfully completed according to fatigue management regulations then in place (8). Although poignant and highly visible due to these memorials, these deaths form a small part of Australia’s road toll, and underscore our ambivalent relationship with the automobile, where road death is accepted as a necessary side-effect of the freedom of movement the technology offers (Ladd). These memorials thus animate highways as Gothic landscapes due to the “multifaceted” (Haider 56) nature of the fear, terror and horror their acknowledgement can bring. Since 1981, there have been, for instance, between some 1,600 and 3,300 road deaths each year in Australia and, while there is evidence of a long term downward trend, the number of deaths per annum has not changed markedly since 1991 (DITRDLG 1, 2), and has risen in some years since then. The U.S.A. marked its millionth road death in 1951 (Ladd) along the way to over 3,000,000 during the 20th century (Advocates). These deaths are far reaching, with U.K. research suggesting that each death there leaves an average of 6 people significantly affected, and that there are some 10 to 20 per cent of mourners who experience more complicated grief and longer term negative affects during this difficult time (‘Pathways Through Grief’). As the placing of roadside memorials has become a common occurrence the world over (Klaassens, Groote, and Vanclay; Grider; Cohen), these are now considered, in MacConville’s opinion, not only “an appropriate, but also an expected response to tragedy”. Hockey and Draper have explored the therapeutic value of the maintenance of “‘continuing bonds’ between the living and the dead” (3). This is, however, only one explanation for the reasons that individuals erect roadside memorials with research suggesting roadside memorials perform two main purposes in their linking of the past with the present—as not only sites of grieving and remembrance, but also of warning (Hartig, and Dunn; Everett; Excell, Roadside Memorials; MacConville). Clark adds that by “localis[ing] and personalis[ing] the road dead,” roadside memorials raise the profile of road trauma by connecting the emotionless statistics of road death directly to individual tragedy. They, thus, transform the highway into not only into a site of past horror, but one in which pain and terror could still happen, and happen at any moment. Despite their increasing commonality and their recognition as cultural artefacts, these memorials thus occupy “an uncomfortable place” both in terms of public policy and for some individuals (Lowe). While in some states of the U.S.A. and in Ireland the erection of such memorials is facilitated by local authorities as components of road safety campaigns, in the U.K. there appears to be “a growing official opposition to the erection of memorials” (MacConville). Criticism has focused on the dangers (of distraction and obstruction) these structures pose to passing traffic and pedestrians, while others protest their erection on aesthetic grounds and even claim memorials can lower property values (Everett). While many ascertain a sense of hope and purpose in the physical act of creating such shrines (see, for instance, Grider; Davies), they form an uncanny presence along the highway and can provide dangerous psychological territory for the viewer (Brien). Alongside the townships, tourist sites, motels, and petrol stations vying to attract customers, they stain the roadway with the unmistakable sign that a violent death has happened—bringing death, and the dead, to the fore as a component of these journeys, and destabilising prominent cultural narratives of technological progress and safety (Richter, Barach, Ben-Michael, and Berman).Conclusion This investigation has followed Goddu who proposes that a Gothic text “registers its culture’s contradictions” (3) and, in profiling these memorials as “intimately connected to the culture that produces them” (Goddu 3) has proposed memorials as Gothic artefacts that can both disturb and reveal. Roadside memorials are, indeed, so loaded with emotional content that their close contemplation can be traumatising (Brien), yet they are inescapable while navigating the roadway. Part of their power resides in their ability to re-animate those persons killed in these violent in the minds of those viewing these memorials. In this way, these individuals are reincarnated as ghostly presences along the highway, forming channels via which the traveller can not only make human contact with the dead, but also come to recognise and ponder their own sense of mortality. While roadside memorials are thus like civic war memorials in bringing untimely death to the forefront of public view, roadside memorials provide a much more raw expression of the chaotic, anarchic and traumatic moment that separates the world of the living from that of the dead. While traditional memorials—such as those dedicated by, and to, Leichhardt—moreover, pay homage to the vitality of the lives of those they commemorate, roadside memorials not only acknowledge the alarming circumstances of unexpected death but also stand testament to the power of the paradox of the incontrovertibility of sudden death versus our lack of ability to postpone it. In this way, further research into these and other examples of Gothic memorialising practice has much to offer various areas of cultural study in Australia.ReferencesAdams, Brian. Sidney Nolan: Such Is Life. Hawthorn, Vic.: Hutchinson, 1987. Advocates for Highway and Auto Safety. “Motor Vehicle Traffic Fatalities & Fatality Rate: 1899-2003.” 2004. Becker, Ernest. The Denial of Death. New York: Simon & Schuster, 1973. Bisceglio, Paul. “How Social Media Is Changing the Way We Approach Death.” The Atlantic 20 Aug. 2013. Botting, Fred. Gothic: The New Critical Idiom. 2nd edition. Abingdon, UK: Routledge, 2014. Brien, Donna Lee. “Looking at Death with Writers’ Eyes: Developing Protocols for Utilising Roadside Memorials in Creative Writing Classes.” Roadside Memorials. Ed. Jennifer Clark. Armidale, NSW: EMU Press, 2006. 208–216. Campbell, Elaine. “Public Sphere as Assemblage: The Cultural Politics of Roadside Memorialization.” The British Journal of Sociology 64.3 (2013): 526–547. Cicero, Marcus Tullius. The Orations of Marcus Tullius Cicero. 43 BC. Trans. C. D. Yonge. London: George Bell & Sons, 1903. Clark, Jennifer. “But Statistics Don’t Ride Skateboards, They Don’t Have Nicknames Like ‘Champ’: Personalising the Road Dead with Roadside Memorials.” 7th International Conference on the Social Context of Death, Dying and Disposal. Bath, UK: University of Bath, 2005. Cohen, Erik. “Roadside Memorials in Northeastern Thailand.” OMEGA: Journal of Death and Dying 66.4 (2012–13): 343–363. Connolly, John F., Anne Cullen, and Orfhlaith McTigue. “Single Road Traffic Deaths: Accident or Suicide?” Crisis: The Journal of Crisis Intervention and Suicide Prevention 16.2 (1995): 85–89. Cornack [Coroner]. Transcript of Proceedings. In The Matter of an Inquest into the Cause and Circumstances Surrounding the Death of Jason John Zupp. Towoomba, Qld.: Coroners Court. 12 Oct. 2007. Davies, Douglas. “Locating Hope: The Dynamics of Memorial Sites.” 6th International Conference on the Social Context of Death, Dying and Disposal. York, UK: University of York, 2002. Department of Infrastructure, Transport, Regional Development and Local Government [DITRDLG]. Road Deaths Australia: 2007 Statistical Summary. Canberra: Commonwealth of Australia, 2008. Duwe, Grant. “Body-count Journalism: The Presentation of Mass Murder in the News Media.” Homicide Studies 4 (2000): 364–399. Elder, Bruce. Blood on the Wattle: Massacres and Maltreatment of Aboriginal Australians since 1788. Sydney: New Holland, 1998. Erdos, Renee. “Leichhardt, Friedrich Wilhelm Ludwig (1813-1848).” Australian Dictionary of Biography Online Edition. Melbourne: Melbourne UP, 1967. Everett, Holly. Roadside Crosses in Contemporary Memorial Culture. Austin: Texas UP, 2002. Excell, Gerri. “Roadside Memorials in the UK.” Unpublished MA thesis. Reading: University of Reading, 2004. ———. “Contemporary Deathscapes: A Comparative Analysis of the Material Culture of Roadside Memorials in the US, Australia and the UK.” 7th International Conference on the Social Context of Death, Dying and Disposal. Bath, UK: University of Bath, 2005. Goddu, Teresa A. Gothic America: Narrative, History, and Nation. New York: Columbia UP, 2007. Gorer, Geoffrey. “The Pornography of Death.” Encounter V.4 (1955): 49–52. Grider, Sylvia. “Spontaneous Shrines: A Modern Response to Tragedy and Disaster.” New Directions in Folklore (5 Oct. 2001). Haider, Amna. “War Trauma and Gothic Landscapes of Dispossession and Dislocation in Pat Barker’s Regeneration Trilogy.” Gothic Studies 14.2 (2012): 55–73. Hall, Stephen S. Merchants of Immortality: Chasing the Dream of Human Life Extension. Boston: Houghton, Mifflin, Harcourt, 2003. Hartig, Kate V., and Kevin M. Dunn. “Roadside Memorials: Interpreting New Deathscapes in Newcastle, New South Wales.” Australian Geographical Studies 36 (1998): 5–20. Hockey, Jenny, and Janet Draper. “Beyond the Womb and the Tomb: Identity, (Dis)embodiment and the Life Course.” Body & Society 11.2 (2005): 41–57. Online version: 1–25. Jones, Ian, and Kaye McColl. (2006) “Highway Tragedy.” Goondiwindi Argus 9 Jun. 2006. Kiernan, Stephen P. “The Transformation of Death in America.” Final Acts: Death, Dying, and the Choices We Make. Eds. Nan Bauer-Maglin, and Donna Perry. Rutgers University: Rutgers UP, 2010. 163–182. Klaassens, M., P.D. Groote, and F.M. Vanclay. “Expressions of Private Mourning in Public Space: The Evolving Structure of Spontaneous and Permanent Roadside Memorials in the Netherlands.” Death Studies 37.2 (2013): 145–171. Ladd, Brian. Autophobia: Love and Hate in the Automotive Age. Chicago: U of Chicago P, 2008. Leichhardt, Ludwig. Journal of an Overland Expedition of Australia from Moreton Bay to Port Essington, A Distance of Upwards of 3000 Miles during the Years 1844–1845. London, T & W Boone, 1847. Facsimile ed. Sydney: Macarthur Press, n.d. Lowe, Tim. “Roadside Memorials in South Eastern Australia.” 7th International Conference on the Social Context of Death, Dying and Disposal. Bath, UK: University of Bath, 2005. MacConville, Una. “Roadside Memorials.” Bath, UK: Centre for Death & Society, Department of Social and Policy Sciences, University of Bath, 2007. Macintyre, Stuart. “The Making of the Australian Working Class: An Historiographical Survey.” Historical Studies 18.71 (1978): 233–253. Mollinson, James, and Nicholas Bonham. Tucker. South Melbourne: Macmillan Company of Australia, and Australian National Gallery, 1982. Morell, Virginia. “Mournful Creatures.” Lapham’s Quarterly 6.4 (2013): 200–208. Nelson, Victoria. Gothicka: Vampire Heroes, Human Gods, and the New Supernatural. Harvard University: Harvard UP, 2012. “Pathways through Grief.” 1st National Conference on Bereavement in a Healthcare Setting. Dundee, 1–2 Sep. 2008. Piatti-Farnell, Lorna. “Words from the Culinary Crypt: Reading the Recipe as a Haunted/Haunting Text.” M/C Journal 16.3 (2013). Queensland Police. “Fatal Traffic Incident, Goondiwindi [Media Advisory].” 27 Apr. 2005. ———. “Fatal Truck Accident, Taroom.” Media release. 11 Dec. 2005. ———. “Double Fatality, Goondiwindi.” Media release. 5 Jun. 2006. Richter, E. D., P. Barach, E. Ben-Michael, and T. Berman. “Death and Injury from Motor Vehicle Crashes: A Public Health Failure, Not an Achievement.” Injury Prevention 7 (2001): 176–178. Secomb, Linnell. “Haunted Community.” The Politics of Community. Ed. Michael Strysick. Aurora, Co: Davies Group, 2002. 131–150. Spooner, Catherine. Contemporary Gothic. London: Reaktion, 2006.

APA, Harvard, Vancouver, ISO, and other styles

47

Savic, Milovan, Anthony McCosker, and Paula Geldens. "Cooperative Mentorship: Negotiating Social Media Use within the Family." M/C Journal 19, no.2 (May4, 2016). http://dx.doi.org/10.5204/mcj.1078.

Full text

Abstract:

IntroductionAccounts of mentoring relationships inevitably draw attention to hierarchies of expertise, knowledge and learning. While public concerns about both the risks and benefits for young people of social media, little attention has been given to the nature of the mentoring role that parents and families play alongside of schools. This conceptual paper explores models of mentorship in the context of family dynamics as they are affected by social media use. This is a context that explicitly disrupts hierarchical structures of mentoring in that new media, and particularly social media use, tends to be driven by youth cultural practices, identity formation, experimentation and autonomy-seeking practices (see for example: Robards; boyd; Campos-Holland et al.; Hodkinson). A growing body of research supports the notion that young people are more skilled in navigating social media platforms than their parents (FOSI; Campos-Holland et al.). This research establishes that uncertainty and tension derived from parents’ impression that their children know more about social media they do (FOSI; Sorbring) has brought about a market for advice and educational programs. In the content of this paper it is notable that when family dynamics and young people’s social media use are addressed through notions of digital citizenship or cyber safety programs, a hierarchical mentorship is assumed, but also problematised; thus the expertise hierarchy is inverted. This paper argues that use of social media platforms, networks, and digital devices challenges traditional hierarchies of expertise in family environments. Family members, parents and children in particular, are involved in ongoing, complex conversations and negotiations about expertise in relation to technology and social media use. These negotiations open up an alternative space for mentorship, challenging traditional roles and suggesting the need for cooperative processes. And this, in turn, can inspire new ways of relating with and through social media and mobile technologies within the family.Inverting Expertise: Social Media, Family and MentoringSocial media are deeply embedded in everyday routines for the vast majority of the population. The emergence of the ‘networked society’, characterised by increasing and pervasive digital and social connectivity, has the potential to create new forms of social interactions within and across networks (Rainie and Wellman), but also to reconfigure intergenerational and family relations. In this way, social media introduces new power asymmetries that affect family dynamics and in particular relationships between young people and their parents. This relatively new mediated environment, by default, exposes young people to social contexts well beyond family and immediate peers making their lived experiences individual, situational and contextual (Swist et al.). The perceived risks this introduces can provoke tensions within families looking to manage those uncertain social contexts, in the process problematising traditional structures of mentorship. Mentoring is a practice predominantly understood within educational and professional workplace settings (Ambrosetti and Dekkers). Although different definitions can be found across disciplines, most models position a mentor as a more experienced knowledge holder, implying a hierarchical relationship between a mentor and mentee (Ambrosetti and Dekkers). Stereotypically, a mentor is understood to be older, wiser and more experienced, while a mentee is, in turn, younger and in need of guidance – a protégé. Alternative models of mentorship see mentoring as a reciprocal process (Eby, Rhodes and Allen; Naweed and Ambrosetti).This “reciprocal” perspective on mentorship recognises the opportunity both sides in the process have to contribute and benefit from the relationship. However, in situations where one party in the relationship does not have the expected knowledge, skills or confidence, this reciprocity becomes more difficult. Thus, as an alternative, asymmetrical or cooperative mentorship lies between the hierarchical and reciprocal (Naweed and Ambrosetti). It suggests that the more experienced side (whichever it is) takes a lead while mentoring is negotiated in a way that meets both sides’ needs. The parent-child relationship is generally understood in hierarchical terms. Traditionally, parents are considered to be mentors for their children, particularly in acquiring new skills and facilitating transitions towards adult life. Such perspectives on parent-child relationships are based on a “deficit” approach to youth, “whereby young people are situated as citizens-in-the-making” (Collin). Social media further problematises the hierarchical dynamic with the role of knowledge holder varying between and within the family members. In many contemporary mediated households, across developed and wealthy nations, technologically savvy children are actively tailoring their own childhoods. This is a context that requires a reconceptualisation of traditional mentoring models within the family context and recognition of each stakeholder’s expertise, knowledge and agency – a position that is markedly at odds with traditional deficit models. Negotiating Social Media Use within the FamilyIn the early stages of the internet and social media research, a generational gap was often at the centre of debates. Although highly contested, Prensky’s metaphor of digital natives and digital immigrants persists in both the popular media and academic literature. This paradigm portrays young people as tech savvy in contrast with their parents. However, such assumptions are rarely grounded in empirical evidence (Hargittai). Nonetheless, while parents are active users of social media, they find it difficult to negotiate social media use with their children (Sorbring). Some studies suggest that parental concerns arise from impressions that their children know more about social media than they do (FOSI; Wang, Bianchi and Raley). Additionally, parental concern with a child’s social media use is positively correlated with the child’s age; parents of older children are less confident in their skills and believe that their child is more digitally skillful (FOSI). However, it may be more productive to understand social media expertise within the family as shared: intermittently fluctuating between parents and children. In developed and wealthy countries, children are already using digital media by the age of five and throughout their pre-teen years predominantly for play and learning, and as teenagers they are almost universally avid social media users (Nansen; Nansen et al.; Swist et al.). Smartphone ownership has increased significantly among young people in Australia, reaching almost 80% in 2015, a proportion nearly identical to the adult population (Australian Communications and Media Authority). In addition, most young people are using multiple devices switching between them according to where, when and with whom they connect (Australian Communications and Media Authority). The locations of internet use have also diversified. While the home remains the most common site, young people make use of mobile devices to access the internet at school, friend’s homes, and via public Wi-Fi hotspots (Australian Communications and Media Authority). As a result, social media access and engagement has become more frequent and personalised and tied to processes of socialisation and well-being (Sorbring; Swist et al.). These developments have been rapid, introducing asymmetry into the parent-child mentoring dynamic along with family tensions about rules, norms and behaviours of media use. Negotiating an appropriate balance between emerging autonomy and parental oversight has always featured as a primary parenting challenge and social media seem to have introduced a new dimension in this context. A 2016 Pew report on parents, teens, and digital monitoring reveals that social media use has become central to the establishment of family rules and disciplinary practices, with over two thirds of parents reporting the use of “digital grounding” as punishment (Pew). As well as restricting social media use, the majority of parents report limiting the amount of time and times of day their children can be online. Interestingly, while parents engage in a variety of hands-on approaches to monitoring and regulating children’s social media use, they are less likely to use monitoring software, blocking/filtering online content, tracking locations and the like (Pew). These findings suggest that parents may lack confidence in technology-based restrictions or prefer pro-active, family based approaches involving discussion about appropriate social media use. This presents an opportunity to explore how social media produces new forms of parent-child relationships that might be best understood through the lens of cooperative models of mentorship. Digital Parenting: Technological and Pedagogical Interventions Parents along with educators and policy makers are looking for technological solutions to the knowledge gap, whether perceived or real, associated with concerns regarding young people’s social media use. Likewise, technology and social media companies are rushing to develop and sell advice, safety filters and resources of all kinds to meet such parental needs (Clark; McCosker). This relatively under-researched field requires further exploration and dissociation from the discourse of risk and fear (Livingstone). Furthermore, in order to develop opportunities modelled on concepts of cooperative mentoring, such programs and interventions need to move away from hierarchical assumptions about the nature of expertise within family contexts. As Collin and Swist point out, online campaigns aimed at addressing young people and children’s safety and wellbeing “are often still designed by adult ‘experts’” (Collin and Swist). A cooperative mentoring approach within family contexts would align with recent use of co-design or participatory design within social and health research and policy (Collin and Swist). In order to think through the potential of cooperative mentorship approaches in relation to social media use within the family, we examine some of the digital resources available to parents.Prominent US cyber safety and digital citizenship program Cyberwise is a commercial website founded by Diana Graber and Cynthia Lieberman, with connections to Verizon Wireless, Google and iKeepSafe among many other partnerships. In addition to learning resources around topics like “Being a Responsible Citizen of the Digital World”, Cyberwise offers online and face to face workshops on “cyber civics” in California, emphasising critical thinking, ethical discussion and decision making about digital media issues. The organisation aims to educate and support parents and teachers in their endeavor to guide young people in civil and safe social media use. CyberWise’s slogan “No grown up left behind!”, and its program of support and education is underpinned by and maintains the notion of adults as lacking expertise and lagging behind young people in digital literacy and social media skills. In the process, it introduces an additional level of expertise in the cyber safety expert and software-based interventions. Through a number of software partners, CyberWise provides a suite of tools that offer parents some control in preventing cyberbullying and establishing norms for cyber safety. For example, Frienedy is a dedicated social media platform that fosters a more private mode of networking for closed groups of mutually known people. It enables users to control completely what they share and with whom they share it. The tool does not introduce any explicit parental monitoring mechanisms, but seeks to impose an exclusive online environment divested of broader social influences and risks – an environment in which parents can “introduce kids to social media on their terms when they are ready”. Although Frienedy does not explicitly present itself as a monitoring tool, it does perpetuate hierarchical forms of mentorship and control for parents. On the other hand, PocketGuardian is a parental monitoring service for tracking children’s social media use, with an explicit emphasis on parental control: “Parents receive notification when cyberbullying or sexting is detected, plus resources to start a conversation with their child without intruding child’s privacy” (the software notifies parents when it detects an issue but without disclosing the content). The tool promotes its ability to step in on behalf of parents, removing “the task of manually inspecting your child's device and accounts”. The software claims that it analyses the content rather than merely catching “keywords” in its detection algorithms. Obviously, tools such as PocketGuardian reflect a hierarchical mentorship model (and recognise the expertise asymmetry) by imposing technological controls. The software, in a way, fosters a fear of expertise deficiency, while enabling technological controls to reassert the parent-child hierarchy. A different approach is exemplified by the Australian based Young and Well Cooperative Research Centre, a “living lab” experiment – this is an overt attempt to reverse deliberate asymmetry. This pedagogical intervention, initially taking the form of an research project, involved four young people designing and delivering a three-hour workshop on social networking and cyber safety for adult participants (Third et al.). The central aim was to disrupt the traditional way adults and young people relate to each other in relation to social media and technology use and attempted to support learning by reversing traditional roles of adult teacher and young student. In this way ‘a non-hierarchical space of intergenerational learning’ was created (Third et al.). The result was to create a setting where intergenerational conversation helped to demystify social media and technology, generate familiarity with sites, improve adult’s understanding of when they should assist young people, and deliver agency and self-efficacy for the young people involved (7-8). In this way, young people’s expertise was acknowledged as a reflection of a cooperative or asymmetrical mentoring relationship in which adult’s guidance and support could also play a part. These lessons have been applied and developed further through a participatory design approach to producing apps and tools such as Appreciate-a-mate (Collin and Swist). In that project “the inclusion of young people’s contexts became a way of activating and sustaining attachments in regard to the campaign’s future use”(313).In stark contrast to the CyberWise tools, the cooperative mentoring (or participatory design) approach, exemplified in this second example, has multiple positive outcomes: first it demystifies social media use and increases understanding of the role it plays in young people’s (and adults’) lives. Second, it increases adults’ familiarity and comfort in navigating their children’s social media use. Finally, for the young people involved, it supports a sense of achievement and acknowledges their expertise and agency. To build sustainability into these processes, we would argue that it is important to look at the family context and cooperative mentorship as an additional point of intervention. Understood in this sense, cooperative and asymmetrical mentoring between a parent and child echoes an authoritative parenting style which is proven to have the best outcome for children (Baumrind), but in a way that accommodates young people’s technology expertise.Both programs analysed target adults (parents) as less skilful than young people (their children) in relation to social media use. However, while first case study, the technology based interventions endorses hierarchical model, the Living Lab example (a pedagogical intervention) attempts to create an environment without hierarchical obstacles to learning and knowledge exchange. Although the parent-child relationship is indubitably characterised by the hierarchy to some extent, it also assumes continuous negotiation and role fluctuation. A continuous process, negotiation intensifies as children age and transition to more independent media use. In the current digital environment, this negotiation is often facilitated (or even led) by social media platforms as additional agents in the process. Unarguably, digital parenting might implicate both technological and pedagogical interventions; however, there should be a dialogue between the two. Without presumed expertise roles, non-hierarchical, cooperative environment for negotiating social media use can be developed. Cooperative mentorship, as a concept, offers an opportunity to connect research and practice through participatory design and it deserves further consideration.ConclusionsPrevailing approaches to cyber safety education tend to focus on risk management and in doing so, they maintain hierarchical forms of parental control. Adhering to such methods fails to acknowledge young people’s expertise and further deepens generational misunderstanding over social media use. Rather than insisting on hierarchical and traditional roles, there is a need to recognise and leverage asymmetrical expertise within the family in regards to social media.Cooperative and asymmetrical mentorship happens naturally in the family and can be facilitated by and through social media. The inverted hierarchy of expertise we have described here puts both parents and children, in a position of constant negotiation over social media use. This negotiation is complex, relational, unpredictable, open toward emergent possibilities and often intensive. Unquestionably, it is clear that social media provides opportunities for negotiation over, and inversion of, traditional family roles. Whether this inversion of expertise is real or only perceived, however, deserves further investigation. This article formulates some of the conceptual groundwork for an empirical study of family dynamics in relation to social media use and rulemaking. The study aims to continue to probe the positive potential of cooperative and asymmetrical mentorship and participatory design concepts and practices. The idea of cooperative mentorship does not necessarily provide a universal solution to how families negotiate social media use, but it does provide a new lens through which this dynamic can be observed. Clearly family dynamics, and the parent-child relationship, in particular, can play a vital part in supporting effective digital citizenship and wellbeing processes. Learning about this spontaneous and natural process of family negotiations might equip us with tools to inform policy and practices that can help parents and children to collaboratively create ‘a networked world in which they all want to live’ (boyd). ReferencesAmbrosetti, Angelina, and John Dekkers. "The Interconnectedness of the Roles of Mentors and Mentees in Pre-Service Teacher Education Mentoring Relationships." Australian Journal of Teacher Education 35.6 (2010): 42-55. Naweed, Anjum, and Ambrosetti Angelina. "Mentoring in the Rail Context: The Influence of Training, Style, and Practicenull." Journal of Workplace Learning 27.1 (2015): 3-18.Australian Communications and Media Authority, Office of the Childrens eSafety Commissioner. Aussie Teens and Kids Online. Australian Communications and Media Authority, 2016. Baumrind, Diana. "Effects of Authoritative Parental Control on Child Behavior." Child Development 37.4 (1966): 887. boyd, danah. It's Complicated: The Social Lives of Networked Teens. New Haven: Yale University Press, 2014. Campos-Holland, Ana, Brooke Dinsmore, Gina Pol, Kevin Zevalios. "Keep Calm: Youth Navigating Adult Authority across Networked Publics." Technology and Youth: Growing Up in a Digital World. Eds. Sampson Lee Blair, Patricia Neff Claster, and Samuel M. Claster. 2015. 163-211. Clark, Lynn Schofield. The Parent App: Understanding Families in the Digital Age. New York: Oxford University Press, 2013. Collin, Philippa. Young Citizens and Political Participation in a Digital Society: Addressing the Democratic Disconnect. Palgrave Macmillan, 2015. Collin, Philippa, and Teresa Swist. "From Products to Publics? The Potential of Participatory Design for Research on Youth, Safety and Well-Being." Journal of Youth Studies 19.3 (2016): 305-18. Eby, Lillian T., Jean E. Rhodes, and Tammy D. Allen. "Definition and Evolution of Mentoring." The Blackwell Handbook of Mentoring: A Multiple Perspectives Approach. Eds. Tammy D. Allen and Lillian T. Eby. Malden, Mass.: Wiley-Blackwell, 2010. 7-20.FOSI. Parents, Privacy & Technology Use. Washington: Family Online Safety Institute, 2015. Hargittai, Eszter. "Digital Na(t)ives? Variation in Internet Skills and Uses among Members of the 'Net Generation'." Sociological Inquiry 80.1 (2010): 92-113.Hodkinson, Paul. "Bedrooms and Beyond: Youth, Identity and Privacy on Social Network Sites." New Media & Society (2015). Livingstone, Sonia. "More Online Risks for Parents to Worry About, Says New Safer Internet Day Research." Parenting for a Digital Future 2016.McCosker, Anthony. "Managing Digital Citizenship: Cyber Safety as Three Layers of Contro." Negotiating Digital Citizenship: Control, Contest and Culture. Eds. A. McCosker, S. Vivienne, and A. Johns. London: Rowman & Littlefield, forthcoming 2016. Nansen, Bjorn. "Accidental, Assisted, Automated: An Emerging Repertoire of Infant Mobile Media Techniques." M/C Journal 18.5 (2015). Nansen, Bjorn, et al. "Children and Digital Wellbeing in Australia: Online Regulation, Conduct and Competence." Journal of Children and Media 6.2 (2012): 237-54. Pew, Research Center. Parents, Teens and Digital Monitoring: Pew Research Center, 2016. Prensky, Marc. "Digital Natives, Digital Immigrants Part 1." On the Horizon 9.5 (2001): 1-6. Rainie, Harrison, and Barry Wellman. Networked: The New Social Operating System. Cambridge, Mass.: Cambridge, Mass.: MIT Press, 2012. Robards, Brady. "Leaving Myspace, Joining Facebook: ‘Growing up’ on Social Network Sites." Continuum 26.3 (2012): 385-98. Sorbring, Emma. "Parents’ Concerns about Their Teenage Children’s Internet Use." Journal of Family Issues 35.1 (2014): 75-96.Swist, Teresa, et al. Social Media and Wellbeing of Children and Young People: A Literature Review. Perth, WA: Prepared for the Commissioner for Children and Young People, Western Australia, 2015. Third, Amanda, et al. Intergenerational Attitudes towards Social Networking and Cybersafety: A Living Lab. Melbourne: Cooperative Research Centre for Young People, Technology and Wellbeing, 2011.Wang, Rong, Suzanne M. Bianchi, and Sara B. Raley. "Teenagers’ Internet Use and Family Rules: A Research Note." Journal of Marriage and Family 67.5 (2005): 1249-58.

APA, Harvard, Vancouver, ISO, and other styles

48

Brien, Donna Lee. "“Concern and sympathy in a pyrex bowl”: Cookbooks and Funeral Foods." M/C Journal 16, no.3 (June22, 2013). http://dx.doi.org/10.5204/mcj.655.

Full text

Abstract:

Introduction Special occasion cookery has been a staple of the cookbook writing in the English speaking Western world for decades. This includes providing catering for personal milestones as well as religious and secular festivals. Yet, in an era when the culinary publishing sector is undergoing considerable expansion and market segmentation, narratives of foods marking of one of life’s central and inescapable rites—death—are extremely rare. This discussion investigates examples of food writing related to death and funeral rites in contemporary cookbooks. Funeral feasts held in honour of the dead date back beyond recorded history (Luby and Gruber), and religious, ceremonial and community group meals as a component of funeral rites are now ubiquitous around the world. In earlier times, the dead were believed to derive both pleasure and advantage from these offerings (LeClercq), and contemporary practice still reflects this to some extent, with foods favoured by the deceased sometimes included in such meals (see, for instance, Varidel). In the past, offering some sustenance as a component of a funeral was often necessary, as mourners might have travelled considerable distances to attend the ceremony, and eateries outside the home were not as commonplace or convenient to access as they are today. The abundance and/or lavishness of the foods provided may also have reflected the high esteem in which the dead was held, and offered as a mark of community respect (Smith and Bird). Following longstanding tradition, it is still common for Western funeral attendees to gather after the formal parts of the event—the funeral service and burial or cremation —in a more informal atmosphere to share memories of the deceased and refreshments (Simplicity Funerals 31). Thursby notes that these events, which are ostensibly about the dead, often develop into a celebration of the ties between living family members and friends, “times of reunions and renewed relationships” (94). Sharing food is central to this celebration as “foods affirm identity, strengthen kinship bonds, provide comfortable and familiar emotional support during periods of stress” (79), while familiar dishes evoke both memories and promising signals of the continued celebration of life” (94). While in the southern states and some other parts of the USA, it is customary to gather at the church premises after the funeral for a meal made up of items contributed by members of the congregation, and with leftovers sent home with the bereaved family (Siegfried), it is more common in Australasia and the UK to gather either in the home of the principal mourners, someone else’s home or a local hotel, club or restaurant (Jalland). Church halls are a less common option in Australasia, and an increasing trend is the utilisation of facilities attached to the funeral home and supplied as a component of a funeral package (Australian Heritage Funerals). The provision of this catering largely depends on the venue chosen, with the cookery either done by family and/or friends, the hotel, club, restaurant or professional catering companies, although this does not usually affect the style of the food, which in Australia and New Zealand is often based on a morning or afternoon tea style meal (Jalland). Despite widespread culinary innovation in other contexts, funeral catering bears little evidence of experimentation. Ash likens this to as being “fed by grandmothers”, and describes “scones, pastries, sandwiches, biscuits, lamingtons—food from a fifties afternoon party with the taste of Country Women’s Association about it”, noting that funerals “require humble food. A sandwich is not an affront to the dead” (online). Numerous other memoirists note this reliance on familiar foods. In “S is for Sad” in her An Alphabet for Gourmets (1949), food writer M.F.K. Fisher writes of mourners’s deep need for sustenance at this time as a “mysterious appetite that often surges in us when our hearts seem breaking and our lives too bleakly empty” (135). In line with Probyn’s argument that food foregrounds the viscerality of life (7), Fisher notes that “most bereaved souls crave nourishment more tangible than prayers: they want a steak. […] It is as if our bodies, wiser than we who wear them, call out for encouragement and strength and […] compel us […] to eat” (135, 136). Yet, while funerals are a recurring theme in food memoirs (see, for example, West, Consuming), only a small number of Western cookbooks address this form of special occasion food provision. Feast by Nigella Lawson Nigella Lawson’s Feast: Food that Celebrates Life (2004) is one of the very few popular contemporary cookbooks in English that includes an entire named section on cookery for funerals. Following twenty-one chapters that range from the expected (Christmas, Thanksgiving, Easter, and wedding) to more original (children’s and midnight) feasts, Lawson frames her discussion with an anthropological understanding of the meaning of special occasion eating. She notes that we use food “to mark occasions that are important to us in life” (vii) and how eating together “is the vital way we celebrate anything that matters […] how we mark the connections between us, how we celebrate life” (vii). Such meals embody both personal and group identities because both how and what is eaten “lies at the heart of who we are-as individuals, families, communities” (vii). This is consistent with her overall aims as a food writer—to explore foods’ meanings—as she states in the book’s introduction “the recipes matter […] but it is what the food says that really counts” (vii). She reiterates this near the end of the book, adding, almost as an afterthought, “and, of course, what it tastes like” (318). Lawson’s food writing also reveals considerable detail about herself. In common with many other celebrity chefs and food writers, Lawson continuously draws on, elaborates upon, and ultimately constructs her own life as a major theme of her works (Brien, Rutherford, and Williamson). In doing so, she, like these other chefs and food writers, draws upon revelations of her private life to lend authenticity to her cooking, to the point where her cookbooks could be described as “memoir-illustrated-with-recipes” (Brien and Williamson). The privileging of autobiographical information in Lawson’s work extends beyond the use of her own home and children in her television programs and books, to the revelation of personal details about her life, with the result that these have become well known. Her readers thus know that her mother, sister and first and much-loved husband all died of cancer in a relatively brief space of time, and how these tragedies affected her life. Her first book, How to Eat: The Pleasures and Principles of Good Food (1998), opened with the following dedication: “In memory of my mother, Vanessa (1936–1985) and my sister Thomasina (1961–1993)” (dedication page). Her husband, BBC broadcaster and The Times (London) journalist John Diamond, who died of throat cancer in 2001, furthered this public knowledge, writing about both his illness and at length about Lawson in his column and his book C: Because Cowards Get Cancer Too (1999). In Feast, Lawson discusses her personal tragedies in the introduction of the ‘Funeral Foods’ chapter, writing about a friend's kind act of leaving bags of shopping from the supermarket for her when she was grieving (451). Her first recipe in this section, for a potato topped fish pie, is highly personalised in that it is described as “what I made on the evening following my mother’s funeral” (451). Following this, she again uses her own personal experience when she notes that “I don’t think anyone wants to cook in the immediate shock of bereavement […] but a few days on cooking can be a calming act, and since the mind knows no rest and has no focus, the body may as well be busy” (451). Similarly, her recipe for the slowly hard-boiled, dark-stained Hamine Eggs are described as “sans bouche”, which she explains means “without mouths to express sorrow and anguish.” She adds, drawing on her own memories of feelings at such times, “I find that appropriate: there is nothing to be said, or nothing that helps” (455). Despite these examples of raw emotion, Lawson’s chapter is not all about grief. She also comments on both the aesthetics of dishes suitable for such times and their meanings, as well as the assistance that can be offered to others through the preparation and sharing of food. In her recipe for a lamb tagine that includes prunes, she notes, for example, that the dried plums are “traditionally part of the funeral fare of many cultures […] since their black colour is thought to be appropriate to the solemnity of the occasion” (452). Lawson then suggests this as a suitable dish to offer to someone in mourning, someone who needs to “be taken care of by you” (452). This is followed by a lentil soup, the lentils again “because of their dark colour … considered fitting food for funerals” (453), but also practical, as the dish is “both comforting and sustaining and, importantly, easy to transport and reheat” (453). Her next recipe for a meatloaf containing a line of hard-boiled eggs continues this rhetorical framing—as it is “always comfort food […] perfect for having sliced on a plate at a funeral tea or for sending round to someone’s house” (453). She adds the observation that there is “something hopeful and cheering about the golden yolk showing through in each slice” (453), noting that the egg “is a recurring feature in funeral food, symbolising as it does, the cycle of life, the end and the beginning in one” (453). The next recipe, Heavenly Potatoes, is Lawson’s version of the dish known as Mormon or Utah Funeral potatoes (Jensen), which are so iconic in Utah that they were featured on one of the Salt Lake City Olympic Games souvenir pins (Spackman). This tray of potatoes baked in milk and sour cream and then topped with crushed cornflakes are, she notes, although they sound exotic, quite familiar, and “perfect alongside the British traditional baked ham” (454), and reference given to an earlier ham recipe. These savoury recipes are followed by those for three substantial cakes: an orange cake marbled with chocolate-coffee swirls, a fruit tea loaf, and a rosemary flavoured butter cake, each to be served sliced to mourners. She suggests making the marble cake (which Lawson advises she includes in memory of the deceased mother of one of her friends) in a ring mould, “as the circle is always significant. There is a cycle that continues but—after all, the cake is sliced and the circle broken—another that has ended” (456). Of the fruitcake, she writes “I think you need a fruit cake for a funeral: there’s something both comforting and bolstering (and traditional) about it” (457). This tripartite concern—with comfort, sustenance and tradition—is common to much writing about funeral foods. Cookbooks from the American South Despite this English example, a large proportion of cookbook writing about funeral foods is in American publications, and especially those by southern American authors, reflecting the bountiful spreads regularly offered to mourners in these states. This is chronicled in novels, short stories, folk songs and food memoirs as well as some cookery books (Purvis). West’s memoir Consuming Passions: A Food Obsessed Life (2000) has a chapter devoted to funeral food, complete with recipes (132–44). West notes that it is traditional in southern small towns to bring covered dishes of food to the bereaved, and that these foods have a powerful, and singular, expressive mode: “Sometimes we say all the wrong things, but food […] says, ‘I know you are inconsolable. I know you are fragile right now. And I am so sorry for your loss’” (139). Suggesting that these foods are “concern and sympathy in a Pyrex bowl” (139), West includes recipes for Chess pie (a lemon tart), with the information that this is known in the South as “funeral pie” (135) and a lemon-flavoured slice that, with a cup of tea, will “revive the spirit” (136). Like Lawson, West finds significance in the colours of funeral foods, continuing that the sunny lemon in this slice “reminds us that life continues, that we must sustain and nourish it” (139). Gaydon Metcalf and Charlotte Hays’s Being Dead is No Excuse: The Official Southern Ladies Guide to Hosting the Perfect Funeral (2005), is one of the few volumes available dedicated to funeral planning and also offers a significant cookery-focused section on food to offer at, and take to, funeral events. Jessica Bemis Ward’s To Die For: A Book of Funeral Food, Tips, and Tales from the Old City Cemetery, Lynchburg, Virginia (2004) not only contains more than 100 recipes, but also information about funeral customs, practical advice in writing obituaries and condolence notes, and a series of very atmospheric photographs of this historic cemetery. The recipes in the book are explicitly noted to be traditional comfort foods from Central Virginia, as Ward agrees with the other writers identified that “simplicity is the by-word when talking about funeral food” (20). Unlike the other examples cited here, however, Ward also promotes purchasing commercially-prepared local specialties to supplement home-cooked items. There is certainly significantly more general recognition of the specialist nature of catering for funerals in the USA than in Australasia. American food is notable in stressing how different ethnic groups and regions have specific dishes that are associated with post-funeral meals. From this, readers learn that the Amish commonly prepare a funeral pie with raisins, and Chinese-American funerals include symbolic foods taken to the graveside as an offering—including piles of oranges for good luck and entire roast pigs. Jewish, Italian and Greek culinary customs in America also receive attention in both scholarly studies and popular American food writing (see, for example, Rogak, Purvis). This is beginning to be acknowledged in Australia with some recent investigation into the cultural importance of food in contemporary Chinese, Jewish, Greek, and Anglo-Australian funerals (Keys), but is yet to be translated into local mainstream cookery publication. Possible Publishing Futures As home funerals are a growing trend in the USA (Wilson 2009), green funerals increase in popularity in the UK (West, Natural Burial), and the multi-million dollar funeral industry is beginning to be questioned in Australia (FCDC), a more family or community-centered “response to death and after-death care” (NHFA) is beginning to re-emerge. This is a process whereby family and community members play a key role in various parts of the funeral, including in planning and carrying out after-death rituals or ceremonies, preparing the body, transporting it to the place of burial or cremation, and facilitating its final disposition in such activities as digging the grave (Gonzalez and Hereira, NHFA). Westrate, director of the documentary A Family Undertaking (2004), believes this challenges us to “re-examine our attitudes toward death […] it’s one of life’s most defining moments, yet it’s the one we typically prepare for least […] [and an indication of our] culture of denial” (PBS). With an emphasis on holding meaningful re-personalised after-disposal events as well as minimal, non-invasive and environmentally friendly treatment of the body (Harris), such developments would also seem to indicate that the catering involved in funeral occasions, and the cookbooks that focus on the provision of such food, may well become more prominent in the future. References [AHF] Australian Heritage Funerals. “After the Funeral.” Australian Heritage Funerals, 2013. 10 Mar. 2013 ‹http://www.ahfunerals.com.au/services.php?arid=31›. Ash, Romy. “The Taste of Sad: Funeral Feasts, Loss and Mourning.” Voracious: Best New Australian Food Writing. Ed. Paul McNally. Richmond, Vic.: Hardie Grant, 2011. 3 Apr. 2013 ‹http://www.romyash.com/non-fiction/the-taste-of-sad-funeral-feasts-loss-and-mourning›. Brien, Donna Lee, Leonie Rutherford, and Rosemary Williamson. "Hearth and Hotmail: The Domestic Sphere as Commodity and Community in Cyberspace." M/C Journal 10.4 (2007). 28 Apr. 2013 ‹http://journal.media-culture.org.au/0708/10-brien.php›. Brien, Donna Lee, and Rosemary Williamson. “‘Angels of the Home’ in Cyberspace: New Technologies and Biographies of Domestic Production”. Biography and New Technologies. Australian National University. Humanities Research Centre, Canberra, ACT. 12-14 Sep. 2006. Conference Presentation. Diamond, John. C: Because Cowards Get Cancer Too… . London: Vermilion, 1998. Fisher, M.F.K. “S is for Sad.” An Alphabet for Gourmets. New York, North Point P, 1989. 1st. pub. New York, Viking: 1949. Gonzalez, Faustino, and Mildreys Hereira. “Home-Based Viewing (El Velorio) After Death: A Cost-Effective Alternative for Some Families.” American Journal of Hospice & Pallative Medicine 25.5 (2008): 419–20. Harris, Mark. Grave Matters: A Journey Through the Modern Funeral Industry to a Natural Way of Burial. New York: Scribner, 2007. Jalland, Patricia. Australian Ways of Death: A Social and Cultural History 1840-1918. Melbourne: Oxford UP, 2002. Jensen, Julie Badger. The Essential Mormon Cookbook: Green Jell-O, Funeral Potatoes, and Other Secret Combinations. Salt Lake City: Deseret, 2004. Keys, Laura. “Undertaking a Jelly Feast in Williamstown.” Hobsons Bay Leader 28 Mar. 2011. 2 Apr. 2013 ‹http://hobsons-bay-leader.whereilive.com.au/news/story/undertaking-a-jelly-feast-in-williamstown›. Lawson, Nigella. How to Eat: The Pleasures and Principles of Good Food. London: Chatto & Windus, 1998. ---. Feast: Food that Celebrates Life. London: Chatto & Windus, 2004. LeClercq, H. “The Agape Feast.” The Catholic Encyclopedia I, New York: Robert Appleton, 1907. 3 Apr. 2013. ‹http://www.piney.com/AgapeCE.html›. Luby, Edward M., and Mark F. Gruber. “The Dead Must Be Fed: Symbolic Meanings of the Shellmounds of the San Francisco Bay Area.” Cambridge Archaeological Journal 9.1 (1999): 95–108. Metcalf, Gaydon, and Charlotte Hays. Being Dead Is No Excuse: The Official Southern Ladies Guide to Hosting the Perfect Funeral. New York: Miramax, 2005. [NHFA] National Home Funeral Alliance. “What is a Home Funeral?” National Home Funeral Alliance, 2012. 3 Apr. 2013. ‹http://homefuneralalliance.org›. PBS. “A Family Undertaking.” POV: Documentaries with a Point of View. PBS, 2004. 3 Apr. 2013 ‹http://www.pbs.org/pov/afamilyundertaking/film_description.php#.UYHI2PFquRY›. Probyn, Elspeth. Carnal Appetites: Food/Sex/Identities. London: Routledge, 2000. Purvis, Kathleen. “Funeral Food.” The Oxford Companion to American Food and Drink. Ed. Andrew F. Smith. New York: Oxford UP, 2007. 247–48. Rogak, Lisa. Death Warmed Over: Funeral Food, Rituals, and Customs from Around the World. Berkeley: Ten Speed P, 2004. Siegfried, Susie. Church Potluck Carry-Ins and Casseroles: Homestyle Recipes for Church Suppers, Gatherings, and Community Celebrations. Avon, MA.: Adams Media, 2006. Simplicity Funerals. Things You Need To Know About Funerals. Sydney: Simplicity Funerals, 1990. Smith, Eric Alden, and Rebecca L. Bliege Bird. “Turtle Hunting and Tombstone Opening: Public Generosity as Costly Signaling.” Evolution and Human Behavior 21.4 (2000): 245–61.Spackman, Christy. “Mormonism’s Jell-O Mold: Why Do We Associate the Religion With the Gelatin Dessert?” Slate Magazine 17 Aug. (2012). 3 Apr. 2013.Thursby, Jacqueline S. Funeral Festivals in America: Rituals for the Living. Lexington: UP of Kentucky, 2006. Varidel, Rebecca. “Bompas and Parr: Funerals and Food at Nelson Bros.” Inside Cuisine 12 Mar. (2011). 3 Apr. 2013 ‹http://insidecuisine.com/2011/03/12/bompas-and-parr-funerals-and-food-at-nelson-bros›. Ward, Jessica Bemis. Food To Die for: A Book of Funeral Food, Tips, and Tales from the Old City Cemetery, Lynchburg, Virginia. Lynchburg: Southern Memorial Association, 2004. West, Ken. A Guide to Natural Burial. Andover UK: Sweet & Maxwell, 2010. West, Michael Lee. Consuming Passions: A Food Obsessed Life. New York: Perennial, 2000. Wilson, M.T. “The Home Funeral as the Final Act of Caring: A Qualitative Study.” Master in Nursing thesis. Livonia, Michigan: Madonna University, 2009.

APA, Harvard, Vancouver, ISO, and other styles

49

Henley, Nadine. "You will die!" M/C Journal 5, no.1 (March1, 2002). http://dx.doi.org/10.5204/mcj.1942.

Full text

Abstract:

Scenario: You are exhausted after a long day at work and collapse in front of the television for some mindless entertainment. One of your favourite comedy shows is on. You begin to relax. You laugh a couple of times. There's a commercial break. You watch the first ad for a hardware store, giving it only half your attention. And then there's another ad, something about a father and son in a car together and then ". WOOOMPH! A truck slams into the car. The message is "Speed kills!" Or there are people playing and sunbathing on a beach, happy holidays, and then vultures descend and surround them. The message is "Slip! Slop! Slap! Don't die in the sun this summer". Or someone is shown smoking a cigarette and the caption reads : "Give up now. You'll soon stop dying for a cigarette". This might be accompanied by scenes of a post-mortem, dissections of human lungs or brain. Context Threat appeals are used frequently in health and road safety promotion. Many use the threat of death as the consequence of undesirable behaviours, for example, "Quit smoking or you'll die' (Henley and Donovan). ("Non-death threats' appeal to other consequences such as "Quit smoking or your skin will age'.) There is an implicit notion of premature death threat, although this is rarely stated explicitly. When reminded of our risk of premature death, we are reminded by extension of the ultimate inevitability of our death. An understanding of the philosophy of existentialism can help us understand why consumers may, quite reasonably, tune out, or literally switch off health promotion messages that remind them of their own death. This paper explores the effect on consumers of these mass media invocations of the fear of death, or "death threats'. Verbatim comments are included from six focus groups conducted on fear and health promotion. Groups were delineated by age (16-20 years, 21-29 years and 30-49 years), gender, and socio-economic status (blue collar/white collar) (Henley). What is existential dread? Fear is one of the primary human emotions (along with anger, sadness, love, joy and surprise) and "dread' is one of the emotion names associated with fear (Shaver et al. 1067). We do not need to learn how to feel fear. We have to learn what to fear, however. Despite the joke about death and taxes, death is uniquely inevitable. (Some people do manage to avoid taxes!) In his definitive work, Denial of Death, Becker stated his belief that knowledge of our own death is the source of 'man's peculiar and greatest anxiety' (70); it's what makes us human. Existentialists think that knowing about the inevitability of our own death can be overwhelming, arousing the worst fear imaginable, "existential dread' (Bugental 287). Existential philosophers and psychologists believe that part of this anxiety stems from the existential dread of "not being'. Discussing Heidegger's analysis of the meaning of death in Being and Time, Barrett put it this way: The point is that I may die at any moment, and therefore death is my possibility now. It is like a precipice at my feet. It is also the most extreme and absolute of my possibilities: extreme, because it is the possibility of not being and hence cuts off all other possibilities; absolute, because man can surmount all other heartbreaks, even the deaths of those he loves, but his own death puts an end to him (201). The essence of existential philosophy is this idea that we are all deeply, terribly afraid of death. Fear of death can be seen even in very young children (Anthony, The child's; Anthony, The discovery; Nagy) who express considerable anxiety about death, but quickly learn from their parents and others how to deny it (Yalom). Existential psychologists have suggested that the fear of our own death is the cause of much of our psychopathology (Yalom). Existentialists believe that the most common response to existential anxiety is to deny it, creating in oneself a 'state of forgetfulness of being' as far as possible. Weisman described three levels of denial in terminally ill patients: "first-order denial' of the facts of illness; "second-order denial' of the implications of the illness; and "third-order denial' of death itself. He noted that often a patient moves from first and second order denial into "middle knowledge' (i.e., acceptance of near death), but then relapses. Weisman remarked that this relapse is often the signal that the terminal phase has begun. This aspect of denial is a complicated factor in the complex measurement of death anxiety. When people say they are not afraid of death, who can say whether they are denying fear or truly not afraid? In either case, health promotion appeals that threaten death may not be effective, either because the fear is denied or because there is no fear. In focus groups exploring people's concepts of death (Henley 111), few people acknowledged being afraid of their own death and many specifically stated that they were not afraid of their own death. One woman voiced the universal difficulty of truly conceiving what it might be like "not to be' (Kastenbaum and Aisenberg) when she said: 'death seems like such an unrealistic proposition'. People did acknowledge fears about death, such as dying painfully, so health promotion messages that threaten these other dimensions of death anxiety may be more effective. Health promotion practitioners frequently use these related death fears. The fear of causing death, for example, is used in road safety advertisements. However, this discussion on existential fear is limited to threat appeals of death per se. Death threats in health promotion Is arousing existential dread an effective way to market healthy behaviours? At first sight, it seems logical that the threat of death would be more persuasive than lesser threats and yet it may not be the most effective approach. There is some evidence that lesser threats may be more effective for some groups of adolescents and young adults for smoking (Donovan and Leivers), and for road safety behaviours (Donovan et al.). For example, for some 18 year old males, the threat of being caught drinking and driving, of losing their driving licence and, thus, their new-found independence may be a more effective deterrent than the threat of dying in a car accident (Donovan et al.). The humiliation of being arrested and charged for drink-driving may be the most powerful persuader for adults of all ages (Bevins). For men attending the Jerusalem Centre for Impotency and Fertility, impotence was reported a more persuasive threat than death: 78% of men who were told that smoking causes impotence quit smoking, compared to 40% who quit when told that smoking causes heart attacks ("No smoking tip"). One woman in a focus group said, 'you tend to think short-term, "can I afford a $100 fine?" rather than long-term, "this is my life." If I stop to think about it, obviously I'm more afraid of dying than $100 [fine], but that's not what I think about' (Henley 95). This makes sense in the context of forgetfulness, the denial of death. We don't want to be reminded of our death so we switch off the death message. Lesser threats may be more easily internalised. Does arousing existential dread do any harm? Perhaps. Job suggested that fear arousal is likely to be effective only for specific behaviours that successfully reduce the level of fear arousal and that high-fear messages may actually increase behaviours that people employ to reduce anxiety, such as smoking and alcohol consumption. People high in anxiety are hypothesised to be hypersensitive to threats and likely to employ a restricted range of self-soothing coping behaviours to reduce negative affect (Wickramasekera and Price). Death threat appeals such as "Quit smoking or you'll die' may arouse defensive, counter-productive responses, at least in some people, because it is impossible to identify any specific behaviour that could successfully reduce the particular, unique fear of death per se. Firestone identified a number of psychological defences against death anxiety, including self-nourishing and addictive habits, such as smoking and overeating. Ironically, these same behaviours are frequently the subject of health promotion campaigns. If such campaigns arouse death anxiety in an effort to curb defensive responses to death anxiety, there clearly could be an increase rather than a decrease in those defensive responses. Arousing death anxiety might contribute to fatalistic thinking. Job described some people's defenses against very high fear, for example, "...you've got to go sometime' or "...when your number's up, your number's up'. In focus groups, people commented, 'if an accident is going to happen, it's going to happen' and 'what's the point of giving up [unhealthy behaviours] if you get run over by a bus tomorrow?' (Henley 95, 108). Rippetoe and Rogers found that fatalistic thinking occurred when subjects did not believe that the recommended behaviour would avert the threat. That is, people may realise that quitting smoking could avert lung cancer and even some causes of premature death but that nothing can avert death itself. Fatalism may be one of the most maladaptive responses because the threat is acknowledged but rendered ineffective (Rippetoe and Rogers). Social marketers can make some of their persuasive communications more effective if they are more mindful of consumers' existential fears. A sensitivity to consumers' psychological defences against existential fear may result in more effective use of threat appeals in health promotion. Mindfulness Mindful that the title of this paper itself may arouse some existential dread, I end with a comment on the existentialist alternative to denial. Existentialists advocate a state of 'mindfulness of being' or 'ontological mode' (Heidegger, quoted in Yalom 31) in which "one remains mindful of being, not only mindful of the fragility of being but mindful, too ... of one's responsibility for one's own being." (Yalom 31). The existentialist strives to be as mindful, as present in the moment, and therefore as authentic as possible. This involves the acceptance of existential anxiety as an appropriate and reasonable response to the human condition (Bugental). Some focus group participants wanted to know in advance that they were going to die, 'so you can fit things in you'd want to do and say goodbye'. Others thought it was better not to know or 'you'd start having regrets'. One person pointed out that we do know in advance: 'you know you're going to die sometime!'. This last comment was followed by a sober, almost shocked silence suggesting that, even while we are freely discussing death on one level, the full meaning of death may still elude us. As consumers of health promotion messages, we are exposed to many reminders of our finite existence. If we sit mindlessly in front of the television receiving these messages, we may feel some unresolved discomfort. People talk about looking away, or switching channels when particularly shocking ads are shown. The existentialist alternative response would be to embrace these reminders and use them to sustain a state of mindfulness. With this state of mindfulness comes a heightened sense of responsibility for one's own being. It is in this ontological mode that we are most likely to adopt the healthy behaviours recommended in health promotion messages. By hearing the death threat openly, and acting to protect ourselves from at least those causes of premature death that may lie within our control, we may be able to discover a fuller experience of what it means to be alive. References Anthony, Sylvia. The Child's Discovery of Death. New York: Harcourt, Brace & World, 1940. Anthony, Sylvia. The Discovery of Death in Childhood and After. Harmondsworth, Middlesex: Penguin Education, 1973. Barrett, W. Irrational Man, A Study in Existential Philosophy. London: Heinemann, 1958. Becker, Ernest. The Denial of Death. New York: The Free Press, 1973. Bevins, John. "Using Advertising to Sell and Promote Health and Healthy Products". Paper presented at the ACHPER Health Products and Services Marketing Seminar. Kuring-gai College, Sydney, 1987. Bugental, J. F. T. The Search for Authenticity: An Existential-analytic Approach to Psychotherapy. New York: Holt, Rinehart and Winston, Inc., 1965. Donovan, Robert J., and Sue Leivers. Young Women and Smoking. Report to Commonwealth Department of Human Services and Health. Perth: Donovan Research, 1988. Donovan, Robert J., Nadine Henley, Geoffrey Jalleh, and Clive Slater. Road Safety Advertising: An Empirical Study and Literature Review. Canberra: Federal Office of Road Safety, 1995. Firestone, Robert W. "Psychological Defenses against Death Anxiety." Death Anxiety Handbook: Research, Instrumentation, and Application. Series in Death Education, Aging, and Health Care. Ed. Robert A. Neimeyer. Washington, DC: Taylor & Francis, 1994. 217-241. Henley, Nadine R. "Fear Arousal in Social Marketing: Death vs Non-death Threats." Doctoral Dissertation, University of Western Australia, Perth, 1997. Henley, Nadine and Robert J. Donovan. "Threat Appeals in Social Marketing: Death as a "Special Case'". International Journal of Nonprofit and Voluntary Sector Marketing, 4.4 (1999): 300-319. Job, R. F. Soames. "Effective and Ineffective Use of Fear in Health Promotion Campaigns." American Journal of Public Health, 78 (1988): 163-167. Kastenbaum, R., and R. Aisenberg. The Psychology of Death. London: Duckworth, 1974. Nagy, Maria H. "The Child's View of Death." The Meaning of Death. Ed. Herman Feifel. New York: McGraw-Hill Book Company, 1959. 79-98. "No Smoking Tip for Lovers". Daily Telegraph, (1994, September 24): p. 4. Rippetoe, P.A. and Rogers, R.W. "Effects of components of protection-motivation theory on adaptive and maladaptive coping with a health threat." Journal of Personality and Social Psychology, 52.3 (1987): 596-604. Shaver, P., J. Schwartz, D. Kirson, and C. O'Connor. "Emotion Knowledge: Further Exploration of a Prototype Approach." Journal of Personality and Social Psychology, 52.6 (1987): 1061-1086. Weisman, A.D. On dying and denying: A psychiatric study of terminality. New York: Behavioral Publications, 1972. Wickramasekera, Ian and Daniel C. Price. "Morbid Obesity, Absorption, Neuroticism, and the High Risk Model of Threat Perception." American Journal of Clinical Hypnosis, 39 (1997): 291-301. Yalom, I. D. Existential Psychotherapy. New York: Basic Books, 1980. Citation reference for this article MLA Style Henley, Nadine. "You will die! " M/C: A Journal of Media and Culture 5.1 (2002). [your date of access] < http://www.media-culture.org.au/0203/youwilldie.php>. Chicago Style Henley, Nadine, "You will die! " M/C: A Journal of Media and Culture 5, no. 1 (2002), < http://www.media-culture.org.au/0203/youwilldie.php> ([your date of access]). APA Style Henley, Nadine. (2002) You will die! . M/C: A Journal of Media and Culture 5(1). < http://www.media-culture.org.au/0203/youwilldie.php> ([your date of access]).

APA, Harvard, Vancouver, ISO, and other styles

50

Sloggett, Robyn. "Slipping and Sliding." M/C Journal 8, no.3 (July1, 2005). http://dx.doi.org/10.5204/mcj.2375.

Full text

Abstract:

On the back cover of The Art Forger’s Handbook, Eric Hebborn proclaims No drawing can lie of itself, it is only the opinion of the expert which can deceive. (Hebborn) Well certainly, but like many forgers Hebborn was dedicated to ensuring the experts have ample material with which to work. The debate about authenticity rolls into the debate about originality rolls into the debate about excellence, slipping between the verifiable and the subjective, shadowed by the expert assessing, categorising, and delivering verdicts. Yet the proclamation ‘This is authentic’ is not straightforward. It is impossible to prove that the statement ‘This is a painting by Sir Arthur Streeton’ is true. It is always possible (though not probable) that the work in question is an excellent copy, manufactured with materials identical to those employed by Streeton, with brushstrokes reflecting Streeton’s manipulation of paint, applied in the kind of sequence Streeton used and with a provenance crafted to simulate perfectly an acceptable provenance for a work by Streeton. Much easier to prove that a work is not by a particular artist; one very obvious anomaly will suffice (Sloggett 298). But an anomaly requires a context, the body of material against which to assess the new find. John Drew’s manipulation of the art market was successful not because of the quality of the pictures he paid John Myatt to produce (after all they were painted with household emulsion paint often extended with K-Y Jelly). His success lay in his ability to alter the identities of these works by penetrating the archives of the Tate and the Victoria and Albert Museum and manufacturing an archival history that virtually copied the history of works by his target artists, Nicholson, Giocometti, Chagall, Epstein, Dubeffet, and de Stals. While the paintings mimicked works by these artists, without a provenance (an identity and identity trail) they were nothing more than approximate copies, many which were initially rejected by the dealers and auction houses (Landesman 38). Identity requires history and context: for something to be deemed ‘real’, both need to be verifiable. The plight of stateless refugees lies in their inability to verify their history (who am I?) and their context (I exist here because…). Drew’s ability to deliver a history is only one way in which works can slip identities (or in the case of Drew’s works – can be pushed). Drew’s intention and his ability to profit by the deception denoted fraud. But authentication is more often sought to support not fraud but optimism. ‘Can you please look at this painting which hung in my grandfather’s lounge room for over 50 years? It was given to him by the artist. I remember it as a small boy, and my father also remembers it when he was a child. But I can’t sell it because someone said it didn’t look right. Can you tell if it is by the artist?’ Such a problem needs to be approached on two fronts. Firstly, how strong is the evidence that this work is by the artist and secondly, what is the hypothesis of best fit for this work? The classic authentication process examines a picture and, against a framework of knowns (usually based on securely provenanced works) looks for points of identification between the proffered work and provenanced works. From these points of identification a theory of best fit is developed. For example, a painting with the inscription ‘Arthur Streeton/1896’ is analysed for its pigment content in order to test the proposition that this is a work by Arthur Streeton from 1896. Pigment analysis indicates that titanium white (a pigment not available commercially until 1920) is found in the clouds. So the proposition must be modified: either this is a work by Streeton that has been heavily reworked after 1920, or this is not a work by Streeton, or this is a work by Streeton but the date is wrong. The authentication process will define and redefine each proposition until there is one that best fits the evidence at hand. Fluorescing the date to establish whether it is a recent addition would be part of this process. Examining other whites in the painting to check if the clouds had been added later would be another. Checking the veracity of the provenance would also be critical. We may decide that this is not an 1896 work by Streeton based on the evidence of the pigment. But what if an art historian discovers a small pigment manufacturer in Box Hill whose records show they produced titanium dioxide as a pigment in 1890? The new evidence may affect the conclusion. But more likely we would want to verify such evidence before we altered our conclusion. Between the extremes of Drew’s manufactured identities and the optimism of a third generation is the strengthened work, combining identity shift and hope. Dali pulled a reverse strengthening when he signed 20,000 blank sheets of paper for lithographs that had not yet been executed (Hebborn 79), but more usually it is the inscription not the image that is missing. Of course a signature is good, but signature works may not have, and do not need signatures. A signature may be a picture of a certain place (Heidelberg) at a certain time of day (moonrise); optimism will soon join the dots, producing a David Davies Moonrise. Often an inscription helps; a nondescript clean-shaven Victorian gentleman can become a bearded founding father, an anonymous nag the first winner of the Melbourne Cup. And if the buyer is not convinced, then a signature may win the day. Unlike Drew’s fabricated histories these changes in identity are confined to transformations of the object itself and then, by association, to its context. Art fraud is an endearing topic, partly because it challenges the subjective nature of expertise. When van Meegeren manufactured his most successful ‘Vermeer’ The Supper at Emmaus (1937) he explored the theories of experts, and then set about producing a work that copied not an existing Vermeer, but the critic’s theory of what an as-yet-undiscovered Vermeer would look like. Hannema, van Schendel and finally Bredius subscribed to the theory that Vermeer’s trip to Italy resulted in Caravaggio’s influence on the artist (Dutton 25). Van Meegeren obligingly produced such a work. So does it matter? Is an identical work as good a work? Is a sublime copyist of great artists a great artist? (Not that van Meegeren was either.) Authentication is a process of assessing claims about identity. It involves reputation, ownership, relationships and truth. When an artist executes a copy it is homage to the skill of the master. When Miss Malvina Manton produced a scene of dead poultry in 1874, she was copying the most popular painting in the fledgling collection of the National Gallery of Victoria, Schendel’s The Poultry Vendor (Inglis 63), and joined a league of copyists including Henry Gritten and Nicholas Chevalier who sought permission to copy the Gallery’s paintings. When John O’Loughlin copied works by Clifford Possum Tjapaltjarri and passed them off as original the impact on the artist was less benign (Gotting). Sid Nolan refused to identify problematic paintings attributed to his oeuvre claiming that to acknowledge such paintings would cast doubt on his entire oeuvre. Bob Dickerson assiduously tracks down and ‘outs’ problematic paintings from his oeuvre, claiming that not to do so would leave the thin edge of the wedge firmly embedded for future opportunists. Both are concerned with their identity. Creation is a fraught business, simply because the act of creation is the act of giving an identity. Whether we create a child, a musical score, a painting or a t-shirt brand, the newly created entity is located within a lineage and context that means more than the single individual creation. This is why identity theft is such a major crime. If someone steals an identity they also steal the collateral developed around that identity, the ability to deal in credit, to drive a car, to travel overseas, to purchase a house. Identity is a valuable commodity; for an artist it is their tool of trade. There is no doubt that the public celebrates the fake. Perhaps it is a celebration of the power of the object over the critic or the theoretician. But it is an extraordinarily costly celebration. Despite the earlier assertion that it is possible to make the perfect copy, very few even approximate the vibrancy and intelligence of an original. Most, if accepted, would seriously dilute the strength of the artist’s oeuvre. Forging Aboriginal art is even more disgraceful. In a society where cultural transmission has traditionally been based on complex relationships of dance, song, painting and objects to customary rights, laws and obligations, art fraud impacts on the very fabric of society. There will always be works that slip identities, and many are not pulled back. False works do damage; they dull our perceptions, dilute our ability to understand an artist’s contribution to society, and are usually no more than blunt instruments used for financial gain. References Australian Institute of Criminology. “Art Crime: Protecting Art, Protecting Artists and Protecting Consumers.” 2-3 Decembeer 1999. 1 May 2005 http://www.aic.gov.au/conferences/artcrime/>. Catterall, L. The Great Dali Art Fraud and Other Deceptions. Fort Lee, New Jersey: Barricade, 1992. Dutton, Denis, ed. The Forger’s Art Forgery and the Philosophy of Art. California: U of California P, 1983 Gotting, Peter. “Shame of Aboriginal Art Fakes.” 16 July 2000. 31 May 2005 http://www.museum-security.org/00/112.html#3>. Hebborn, Eric. The Art Forger’s Handbook. London: Cassell, 1997. Inglis, Alison. “What Did the Picture’s Surface Convey? Copies and Copying in the National Gallery of Victoria during the Colonial Period.” The Articulate Surface: Dialogues on Paintings between Conservators, Curators and Art Historians. Ed. Sue-Anne Wallace, with Jacqueline Macnaughtan and Jodi Parvey. Canberra: The Humanities Research Centre, the Australian National University and the National Gallery of Australia, 1996. 55-69. Landesman, Peter. “A 20th-Century Master Scam.” The New York Times Magazine (18 July 1999): 31-63. Sloggett, Robyn. “The Truth of the Matter: Issues and Procedures in the Authentication of Artwork.” Arts, Antiquity and Law 5.3 (September 2000): 295-303. Tallman, Susan. “Report from London Faking It.” Art in America (November 1990): 75-81. Citation reference for this article MLA Style Sloggett, Robyn. "Slipping and Sliding: Blind Optimism, Greed and the Effect of Fakes on Our Cultural Understanding." M/C Journal 8.3 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0507/09-sloggett.php>. APA Style Sloggett, R. (Jul. 2005) "Slipping and Sliding: Blind Optimism, Greed and the Effect of Fakes on Our Cultural Understanding," M/C Journal, 8(3). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0507/09-sloggett.php>.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography
Journal articles: 'Families Australia Canberra (A.C.T.)' – Grafiati (2024)
Top Articles
Latest Posts
Recommended Articles